Mucoid Colonies Research Articles

Nodulation Potential and Phenotypic Diversity of Rhizobia Nodulating Cowpea Isolated from Major Growing Areas of Ethiopia

Rhizobia are specific to a particular legume and need to be characterized by different methods. In Ethiopia, very few efforts have been made to evaluate the phenotypic characteristics and diversity of cowpea nodulating rhizobia. This study aimed to assess the nodulation potential and phenotypic diversity of rhizobia nodulating cowpea isolated from major growing areas of Ethiopia. Thirty soil samples were collected from different cowpea growing areas of Ethiopia of which 28 (93.3%) samples induced nodulation in the greenhouse. A total of 28 isolates obtained from nodulated plants were evaluated using presumptive tests and subjected to different phenotypic characteristics. On YEMA containing CR, the isolates produced colony colors that were whitish to pale pink. All isolates showed no growth on peptone glucose agar and the isolates were capable to grow on ketolactose medium but did not turn the media color to yellow. All the isolates were also confirmed to be gram-negative, rod-shaped, and non-spore-forming. The colony texture study revealed that 78.57% of the isolates had large mucoid colony whereas 21.43% of the isolates exhibited large watery colony texture with diameters ranging between 1 and 5mm. Depending on the colony color on YEMA containing bromothymol blue, 22 (78.57%) isolates were slow-growing whereas 6 (21.43%) isolates were fast-growing rhizobia. The cluster analysis based on phenotypic characteristics revealed a grouping of the isolates into two clusters at a similarity level of 75% and six further sub-clusters at a similarity level of about 91% indicating that there are variations and diversity among the isolates. Overall, this study revealed great variations among the cowpea nodulating rhizobial isolates and suggests that the soils of Ethiopia harbor populations of phenotypically diverse isolates. A further test to confirm these findings using genetic characterization and inclusion of reference strain is highly recommended.

Структура популяции Gluconacetobacter hansenii GH 1/2008 в статической культуре на различных источниках углерода

Структура популяции Gluconacetobacter hansenii GH 1/2008 в статической культуре на различных источниках углерода

CHARACTERIZATION OF SYMBIOTIC EFFECTIVENESS OF RHIZOBIA NODULATING FIELD PEA (PISUM SATIVUM).

Field Pea is one of the most important Legumes plants and widely grown in Ethiopia. A study was made to re- isolate, characterize, and select best rhizobia for field pea. Results showed that all the 25 isolates exhibited typical colony characteristics and presumptive reactions of fast growing rhizobia. Out of the 25 isolates, 3(KL3, BR1 andCF5) relatively superior isolates were selected in sterilized sand. All isolates characterized their morphological and physiological characteristics. All isolates formed watery and mucoid colonies on YEMA medium, their mean growth time mostly between 2 &4 hours and failed to grow on peptone glucose agar medium and to solubilize inorganic phosphate. Almost all isolates were tolerated to pH 5to 9, 2% and 3% salt concentration, and at temperature of 15oC to 35oC. The isolates were also tolerant to erythromycin, streptomycin and ampicillin, and relatively sensitive to penicillin and chloroamphenicol at concentration of 50μg/ml. All isolates utilized to sucrose, glucanate, galactose and fructose as the sole source of carbon, and almost all isolates grow on YEMA medium containing galactose (90%), fructose (88.9%) and glucanate (76.7%) and the isolates utilized many amino acids as the source of nitrogen. BR1 was the most competitive inoculant with nodule occupancy of 75%; followed by KL3 and CF5 with nodule occupancy of 60 and 50% respectively. The mean nodule number, nodule dry weight, mean shoot dry weight and N content and of the host plants inoculated with different isolates showed variations. Particularly BR1 can be recommended as inoculants and good strain for field pea in the future.

Diversity of mucoid to non-mucoid switch among carbapenemase-producing Klebsiella pneumoniae

BackgroundKlebsiella pneumoniae is a leading cause of intractable hospital-acquired multidrug-resistant infections and carbapenemase-producing K. pneumoniae (CPKp) are particularly feared. Most of the clinical isolates produce capsule as a major virulence factor. Recombination events at the capsule locus are frequent and responsible for capsule diversity within Klebsiella spp. Capsule diversity may also occur within clonal bacterial populations generating differences in colony aspect. However, little is known about this phenomenon of phenotypic variation in CPKp and its consequences.ResultsHere, we explored the genetic causes of in vitro switching from capsulated, mucoid to non-mucoid, non-capsulated phenotype in eight clinical CPKp isolates. We compared capsulated, mucoid colony variants with one of their non-capsulated, non-mucoid isogenic variant. The two colony variants were distinguished by their appearance on solid medium. Whole genome comparison was used to infer mutations causing phenotypic differences. The frequency of phenotypic switch was strain-dependent and increased along with colony development on plate. We observed, for 72 non-capsulated variants that the loss of the mucoid phenotype correlates with capsule deficiency and diverse genetic events, including transposition of insertion sequences or point mutations, affecting genes belonging to the capsule operon. Reduced or loss of capsular production was associated with various in vitro phenotypic changes, affecting susceptibility to carbapenem but not to colistin, in vitro biofilm formation and autoaggregation.ConclusionsThe different impact of the phenotypic variation among the eight isolates in terms of capsule content, biofilm production and carbapenem susceptibility suggested heterogeneous selective advantage for capsular loss according to the strain and the mutation. Based on our results, we believe that attention should be paid in the phenotypic characterization of CPKp clinical isolates, particularly of traits related to virulence and carbapenem resistance.

Оccurrence of bacterial spot caused by Xanthomonas arboricola pv. pruni on peach and apricot in Serbia.

Xanthomonas arboricola pv. pruni (Xap) causes bacterial spot of leaves and fruits, defoliation, fruit dropping and twigs, branches or trunk cankers in most cultivated and ornamental Prunus species. The bacterium is listed as an EPPO (European and Mediterranean Plant Protection Organisation) A2 quarantine pathogen. Xap was first detected in 2019 on peach [Prunus persica L., unknown cultivar (cv.)] leaves in a 13-year-old orchard located in Irig (GPS: 45°6'10.538'' N, 19°54'8.04'' E), with a disease incidence of 10-20%. Thereafter, Xap was detected in 2020 on apricot (Prunus armeniaca L., cvs. NS4, NS Rodna and Roxana) leaves and fruits in a 5-year-old orchard located in Bešenovo (GPS: 45°04'59.0'' N, 19°41'23.0'' E), with disease incidence of 30-50%. Symptoms on leaves appeared along leaf midribs or margins in form of brown to black spots, with a pale green to yellow halo, evident on both leaf surfaces. The diseased area on leaves dropped out giving a shot-hole appearance, leaves turn yellow and drop prematurely. Bacterial spots of apricot fruits appeared in form of water-soaked or dark brown sunken lesions. Primarly detection of Xap in collected samples was obtained using polymerase chain reaction (PCR) with Xap - specific primers XapY17-F/XapY17-R, after amplifying target fragments of 943-bp (1). Xap reference strain NCPPB 3156 served as positive control. Isolations performed on yeast extract-dextrose-calcium carbonate agar (YDC) resulted in pale yellow, circular, raised and mucoid colonies after 3 days at 26 °C. A total of 20 representative isolates were aerobic, gram negative, catalase positive, oxidase and arginine dihydrolase negative; they induced hypersensitivity reaction, reduced nitrates, hydrolyzed aesculin and gelatine, but not starch, produced H2S, not produced indole (2). NCBI BLASTn search of the ftsX (ABC transporter ATP-binding protein) sequences (1) indicated 100% identity of Serbian isolates with Xap strains XAP HU2 (P. persica, Acc. no. MG049921) and XAP HU1 (P. armeniaca, Acc. no. KY039173) from Hungary. The nucleotide sequences of one isolate from peach (Xp219) and one from apricot (Xp320) were deposited in GenBank under Acc. nos. MT890969 and MT890970, respectively. Pathogenicity was performed on detached peach and apricot leaves for all 20 isolates and on leaves and shoots of potted 1-year-old plants of peach (cv. Vineyard peach) and apricot (cv. NS Rodna) for three isolates from each host (3, 4). Sterile distilled water and reference strain NCPPB 3156 were used as negative and positive controls. On detached leaves all isolates caused typical water-soaked spots 3 days after inoculation (DAI), while 10 DAI spots became brown and necrotic. Same symptoms were appeared on the leaves of potted plants. On peach and apricot shoots water-soaked, slightly reddish lesions emerged on inoculation sites 7-10 DAI, while 20 DAI lesions become dark, circular to elliptical 3.5-4 and 2.5-3 cm in size for peach and apricot, respectively. Negative controls were symptomless. Reisolated bacteria were confirmed to be the same as the original using PCR (1), fulfilling Koch's postulates. This is the first report of Xap in Serbia, which has occurred with a limited distribution in the Fruška Gora region (Vojvodina). Only two orchards in Serbia have been deteched with Xap so far. In the diseased peach orchard Xap was eradicated by uprooting trees. The apricot orchard is still under official control to limit disease spread. Appropriate cultivation practices, national inspection and surveillance is in place to prevent further pathogen spread and establishment to new hosts and regions in Serbia.

Utilization of industrial waste for the sustainable production of bacterial cellulose

The present study reports the higher yields of bacterial cellulose (BC) from Pseudomonas sp. BC6 isolated from the sugarcane rhizosphere. Various types of samples were screened for the isolation of potent BC producing bacteria. Initially six isolates showed the formation of a pellicle in Hestrin-Schramm Broth (HSB); however, one isolate identified as Pseudomonas sp. BC6 produced thick pellicles (more BC) under static conditions in the HSB and formed mucoid colonies on Hestrin-Schramm Agar (HSA). Following the staining with calcofluor, these colonies reflected intense fluorescence under UV light. The isolate yielded more BC in raw carbon (molasses) based HSB (9.3 gL−1) compared to pure carbon (glucose) source (6.9 gL−1). Cellulose membrane made of BC and conjugated with silver (Ag) nanoparticles showed the potent antibacterial activity against Gram-positive as well as Gram-negative bacterial pathogens. The ability of the isolate to produce BC from renewable sources offers the best, eco-friendly, and sustainable alternative to cellulose of plant origin.

Utilization of exopolysaccharide producing lactic acid bacteria for improving the quality of low fat curd

An experiment was conducted to utilize exopolysaccharide producing lactic acid bacteria for the preparation of low fat curd. Exopolysaccharide producing cultures were isolated from 25 curd samples collected from different sources. From this samples 32 EPS producing cultures were isolated. Based on morphological, biochemical and sugar utilisation tests the isolates were grouped. According to results, two were Streptococcus thermophilus. Eight of the isolates were Lactobacillus. Remaining 22 isolates were identified as Lactococcus. All the 32 EPS producing isolates showed mucoid colonies with a slimy appearance when the isolates were streaked on MRS or M17 agar with 4 per cent sucrose which indicates the capability of EPS production. Exopolysaccharides produced by different isolates were purified by ethanol precipitation method followed by dialysis and they were quantified by phenol sulphuric acid method. The maximum EPS yield was observed in two isolates of Lactococcus lactis subsp lactis with 109 mg/L and 107.4 mg/L respectively. Low fat curd was prepared from skim milk by using these two EPS producing isolates. Physico - chemical parameters and sensory quality of the low fat curd were analysed by standard methods. Statistical analysis revealed that the whey separation and curd setting time of low fat curd decreased with the use of exopolysaccharide producing isolates. There was no significant difference in fat content but an increase in total solid content of curd samples prepared by EPS producing isolates was observed. Overall sensory scores were higher for low fat curd prepared with EPS producing isolates when compared to control curd prepared with non EPS producing cultures.

Difficulty in detecting low levels of polymyxin resistance in clinical Klebsiella pneumoniae isolates: evaluation of Rapid Polymyxin NP test, Colispot Test and SuperPolymyxin medium.

Polymyxins are important therapeutic options for treating infections, mainly those caused by carbapenem-resistant Klebsiella pneumoniae. Specific chemical characteristics of polymyxins make it difficult to perform antimicrobial susceptibility testing, especially within the clinical laboratory. Here we aimed to evaluate the performance of three phenotypic methods: Rapid NP Polymyxin Test, ColiSpot test and the SuperPolymyxin medium. To accomplish this, 170 non-duplicate clinical K. pneumoniae isolates were analysed (123 colistin-resistant and 47 susceptible). The sensitivity and specificity obtained for Rapid Polymyxin NP Test, Colispot and SuperPolymyxin medium were, respectively, 90% and 94%, 74% and 100%, and 82% and 85%. Very major errors occurred more frequently in low-level colistin-resistant isolates (MICs 4 and 8 μg/mL). Rapid Polymyxin NP proved to be a method capable of identifying colistin-resistant strains in acceptable categorical agreement. However, major errors and very major errors of this method were considered unacceptable for colistin-resistance screening. Although the Colispot test is promising and easy to perform and interpret, the results did not reproduce well in the isolates tested. The colistin-containing selective medium (SuperPolymyxin) showed limitations, including quantification of mucoid colonies and poor stability. Nevertheless, Colispot and SuperPolymyxin medium methods did not present acceptable sensitivity, specificity and categorical agreement. It is essential to use analytical tools that faithfully reproduce bacterial resistance in vitro, especially in last-line drugs, such as polymyxins, when misinterpretation of a test can result in therapeutic ineffectiveness.

First Report of Xanthomonas vasicola pv. vasculorum, the Causal Agent of Bacterial Leaf Streak of Corn, in South Dakota

During routine scouting of corn (Zea mays L.) in 2018, corn leaves exhibiting bacteria-like symptoms were identified in Clay County, South Dakota. Symptomatic leaves showed narrow long lesions with wavy water-soaked margins, typical of bacterial leaf streak of corn caused by Xanthomonas vasicola pv. vasculorum (Korus et al. 2017). Incidence was near 100%, and the severity ranged from moderate to very severe across the field. Small sections of the symptomatic tissue were placed onto a stereomicroscope, and bacterial streaming was readily observed. The corn leaves were then surface sterilized by washing in 10% bleach for 30 s and rinsing three times in sterile water, placed on a modified King’s B medium, and incubated at 30°C for 48 h. Bacterial growth from two independent leaf samples was transferred onto fresh King’s B medium and incubated as previously stated. After 48 h, yellow, viscous mucoid bacterial colonies were observed on the medium. Surface-sterilized symptomatic leaf tissues were cut into 1-cm sections and placed in a 50-ml centrifuge tube and soaked overnight to allow for bacteria to ooze out of the leaf pieces. The leachate was used to extract DNA using the Ultra DNAeasy kit following the manufacturer’s instructions (Qiagen, Redwood, CA). PCR was run on the extracted DNA using putative membrane protein and putative exported protein primers (Xvv3_F, CAAGCAGAGCATGGCAAAC; Xvv3_R, CACGTAGAACCGGTCTTTGG; Xvv5_F, CCGTCGAAATGGTCTCAACT; Xvv5_R, CGGAAGAGTTGGAAGACAGC) (Lang et al. 2017). A negative check was DNA extracted from asymptomatic leaf tissue. The expected product size of 200 bp was obtained from the symptomatic leaves’ leachate DNA only. The PCR amplicons were sequenced at Functional Bioscience in Wisconsin. The resultant sequences were subjected to BLASTn analysis under the plant-associated environmental database and showed a 100% match to X. vasicola pv. vasculorum with 100% sequence coverage. The sequences of one isolate (based on the putative membrane protein primers) were submitted to GenBank (accession MN813968). The isolates were also subjected to biochemical tests and were positive for esculin hydrolysis and cytochrome oxidase, formed mucoid yellow colonies on yeast dextrose agar, and were negative for arabinose utilization. The morphological characteristics along with biochemical and PCR tests confirmed X. vasicola pv. vasculorum as the causal organism of the symptoms observed on corn. To complete Koch’s postulates, eight corn plants (hybrid DKC45-65RIB) were spray inoculated with a bacterial suspension of 1.48 × 10⁷ CFU at the V6 growth stage. Three corn plants were sprayed with distilled water as controls. All plants were placed in a humid chamber for 48 h and then transferred to the greenhouse with lighting set at 14/10 h of light/darkness and an average temperature of 26°C. This was repeated twice. Plants inoculated with the bacterial suspension developed long, narrow, wavy water-soaked lesions 5 to 6 days postinoculation, whereas no symptoms were observed in the control plants. Bacterial colonies were reisolated from inoculated plants only and were confirmed as X. vasicola pv. vasculorum by PCR as above. At this time, bacterial leaf streak seems to be localized but could spread to more corn fields. The impact of bacterial leaf streak on yield is not yet known. There is a need to create awareness among corn growers about the appropriate management practices for controlling this new bacterial disease.

Petroleum hydrocarbon degradation in soil augmented with used engine oil by novel Pantoea wallisii SS2: Optimisation by response surface methodology

The increased modernization and urbanisation of developing countries has resulted in a tremendous spurt in use of vehicles and automobiles. As a result of this, enormous amounts of used engine oil and lubricating oils are generated which are released into soil and water bodies. Novel ecofriendly techniques must be developed to eradicate this issue. Hence, in the present study a yellow pigmented circular flat mucoid colony of Gram negative bacillus, capable of utilising used engine oil as a sole source of carbon was isolated from motor garage soil. This bacterium could degrade used engine oil on Bushnell Hass agar plates within 48 h and could decolorize 6-dichlorophenol indophenol (redox indicator) within 4 days. It was identified as Pantoea wallisii SS2 by 16s rRNA sequencing and could hydrolyse a wide range of sugars. The screening of degradation conditions such as concentrations of used engine oil, inoculum, glucose, Tween 20, and degradation time that affect the %TPH reduction in used engine oil augmented soil was performed by one factor at a time approach. The significant factors (inoculum and glucose concentration) were optimised for maximum %TPH reduction by central composite design. At optimised conditions (13.53 %v/w inoculum and 8.82 g/kg glucose), %TPH reduction of 79.8% was obtained in soil augmented with 4% v/w used engine oil, 20 mg/kg Tween 20 in 21 days. This is the first study that reports the isolation of Pantoea wallisii in motor garage soil and its use in degradation of used engine oil in soil.

First Report of Citrus Scab on Trifoliate Orange (Poncirus trifoliata)

Citrus scab symptoms were observed on leaves of trifoliate orange (Poncirus trifoliata) in open field of Citrus Research Institute, National Institute of Horticultural and Herbal Science. Typical scab pustules were formed and they were elevated protuberances form and light brown to grey. The pathogens were isolated from the symptomatic leaves and then were identified to Elsinoe fawcettii by morphological characteristics, pathoge- nicity and PCR assay. The morphological characteristics of colonies formed very slow-growing, pulvinate, or raised and deeply fissured, gummy to mucoid or tomentose colonies on potato dextrose agar medium. The pathogens were pathogenic to leaves of Satsuma mandarin, lemon, sour orange and grapefruit with typical scab symptoms. In PCR assay, specific amplified of products of 717 bp with Efaw-1 and 384 bp with Efaw-2 were observed from trifoliate isolates and E. fawcettii as reference but not from E. australis. This is first report of trifoliate orange being positive for citrus scab disease.

First Report of Xanthomonas phaseoli pv. dieffenbachiae Causing Bacterial Leaf Blight on Anthurium andreanum in Mexico

Xanthomonas phaseoli pv. dieffenbachiae (= Xanthomonas axonopodis pv. dieffenbachiae) (Xad) was first reported as causing bacterial blight on anthurium (Anthurium andreanum) in New Jersey, U.S.A. (McCulloch and Pirone 1939) and described as Bacterium dieffenbachiae. The bacterium occurs in a broad range of ornamental crops, with most reports coming from anthurium, although there are reports on Syngonium, Dracaena, caladium, Xanthosoma, and Philodendron (Borkar and Yumlembam 2016). In Mexico, there are no reports of the bacteria. In March 2018 and May 2019, anthurium plants grown in a commercial orchard were detected with symptoms of leaf and spadix blight and discoloration on the vascular tissue with an incidence of about 60%. Leaves from 15 plants showing symptoms of a vascular discoloration and water-soaked spots were collected from the township Adolfo Ruiz Cortinez in San Andres Tuxtla, Veracruz (18°26′59″N, 95°12′44″W) and Ocozotepec, Veracruz (18°15′00.0″N, 94°54′00.0″W) and processed for isolation. Leaf tissue was surface disinfected with 1% sodium hypochlorite before being placed in sterile water. The suspension was streaked onto King’s B medium and incubated at 28°C. Yellow, mucoid, and slimy bacterial colonies appeared after 4 days, and strains were purified by selecting single colonies. The bacterium was rod-shaped, motile by a polar flagellum, and gram negative, and was positive for catalase, gelatinase, casein, and starch hydrolysis, eliciting a hypersensitive response in tobacco plants, and acid production from carbohydrates (Chase et al. 1992; Lelliott and Stead 1987). For further confirmation, DNA was extracted from bacterial colonies using PureLink Genomic DNA Kits (Invitrogen Life Technologies, Carlsbad, CA) following the manufacturer’s instructions. Immunoassay analyses were performed by specific antibodies (Bacterial Reagent Set for Xad, Agdia, Elkhart, IN) and processed according to the manufacturer’s instructions. Five-microliter subsamples were subjected to PCR using universal primers 8F and 1492R (Turner et al., 1999) and gyrB genes according to the method of Parkinson et al. (2007, 2009), using primers X. gyrPCR2F and X. gyrrsp1 and corroborated by sequencing (MN394616, MN394617, MN394618, MN394619, and MN402441; and MN402442, MN402443, MN402444, MN402445, and MN402446, respectively). All strains were confirmed by specific primers PXadU and PXadL and nested PCR with NXadU and NXadL primers (Robene-Soustrade et al. 2006). Pathogenicity was tested in 6-week-old plants of A. andreanum; leaves were infiltrated with a suspension at a concentration of 10⁸ CFU/ml into the mesophyll. Plants were then held at a constant 26°C with a 16-h photoperiod. Symptoms appeared 7 days postinoculation as water-soaked spots and leaf blight. The pathogen was reisolated and cultured, and after 4 days samples appeared morphologically to be the same bacterium and were positively identified using the Xad-specific primer set. This is the first report of Xad on anthurium causing bacterial blight in Mexico, and the impact of the disease can be devastating due to the number of hosts present and the favorable climatic conditions for the development of the disease. However, we believe that more studies are needed on the epidemiology and spread of the bacteria.

The Predation Strategy of Myxococcus xanthus.

Myxobacteria are ubiquitous in soil environments. They display a complex life cycle: vegetatively growing cells coordinate their motility to form multicellular swarms, which upon starvation aggregate into large fruiting bodies where cells differentiate into spores. In addition to growing as saprophytes, Myxobacteria are predators that actively kill bacteria of other species to consume their biomass. In this review, we summarize research on the predation behavior of the model myxobacterium Myxococcus xanthus, which can access nutrients from a broad spectrum of microorganisms. M. xanthus displays an epibiotic predation strategy, i.e., it induces prey lysis from the outside and feeds on the released biomass. This predatory behavior encompasses various processes: Gliding motility and induced cell reversals allow M. xanthus to encounter prey and to remain within the area to sweep up its biomass, which causes the characteristic “rippling” of preying populations. Antibiotics and secreted bacteriolytic enzymes appear to be important predation factors, which are possibly targeted to prey cells with the aid of outer membrane vesicles. However, certain bacteria protect themselves from M. xanthus predation by forming mechanical barriers, such as biofilms and mucoid colonies, or by secreting antibiotics. Further understanding the molecular mechanisms that mediate myxobacterial predation will offer fascinating insight into the reciprocal relationships of bacteria in complex communities, and might spur application-oriented research on the development of novel antibacterial strategies.

First Report of Xanthomonas campestris Infecting Invasive Garlic Mustard in the United States

HomePlant DiseaseVol. 104, No. 4First Report of Xanthomonas campestris Infecting Invasive Garlic Mustard in the United States PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Xanthomonas campestris Infecting Invasive Garlic Mustard in the United StatesMatthew A. Tancos and Reid D. FrederickMatthew A. Tancos†Corresponding author: M. A. Tancos; E-mail Address: matthew.tancos@ars.usda.govhttp://orcid.org/0000-0002-6317-3393Foreign Disease-Weed Science Research Unit, United States Department of Agriculture-Agricultural Research Service, Frederick, MD 21702Search for more papers by this author and Reid D. Frederickhttp://orcid.org/0000-0002-1672-5327Foreign Disease-Weed Science Research Unit, United States Department of Agriculture-Agricultural Research Service, Frederick, MD 21702Search for more papers by this author AffiliationsAuthors and Affiliations Matthew A. Tancos † Reid D. Frederick Foreign Disease-Weed Science Research Unit, United States Department of Agriculture-Agricultural Research Service, Frederick, MD 21702 Published Online:12 Feb 2020https://doi.org/10.1094/PDIS-09-19-1963-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat Garlic mustard (Alliaria petiolata) is an aggressive nonnative cruciferous (Brassica) plant from Eurasia that was introduced into North America around the 19th century (Durka et al. 2005). The biennial Brassica herb has since rapidly invaded and displaced native flora in much of the eastern and midwestern United States and Canada, thriving in woodlands, hedgerows, lawns, and other shady environments. In May of 2019, foliar leaf symptoms developed on garlic mustard along the edge of a forested property in Frederick County, Maryland. Initial leaf symptoms were chlorotic angular V-shaped lesions originating from the leaf margins, characteristic of a bacterial infection. As the disease progressed, leaves wilted and lesions became necrotic, covering entire leaf margins. The disease was patchy along the property and nearby forest edge, but the disease was observed on both second-year mature flowering plants and first-year immature rosettes. Disease incidence in the affected area was 75 to 80%. Symptomatic leaf tissue was surface sterilized, macerated, and streaked onto yeast extract dextrose calcium carbonate agar (Wilson et al. 1967), from which bright yellow, mucoid bacterial colonies were isolated. The 16S rRNA gene was sequenced to confirm the bacterium was a Xanthomonas sp. (accession MN823168), followed by sequencing eight conserved loci (atpD, dnaK, efP, glnA, gyrB, rpoD, tpiA, and fyuA) for multilocus sequence analysis and pathovar determination (accessions MN444860 to MN444867) (Fargier et al. 2011). Gene sequences were aligned, concatenated, and compared with reference Brassica-associated X. campestris strains, for a total length of 4,485 nucleotides, and used to generate a maximum likelihood phylogram using W-IQ-TREE (Fargier et al. 2011; Lange et al. 2016; Trifinopoulos et al. 2016). Sequence analysis revealed the garlic mustard isolate (strain FDWSRU 18048) did not cluster with the agronomically damaging X. campestris pv. campestris or pv. raphani strains but instead clustered with nonpathogenic X. campestris strains, the weakly pathogenic strain CFBP 5814, and strains of X. campestris pv. incanae with bootstrap support of 99% (Fargier et al. 2011; Lange et al. 2016). To fulfill Koch’s postulates, true leaves of a healthy transplanted garlic mustard rosette were wound-inoculated with a sterile pin dipped into a 24-h-old culture and inoculated into the outer margin of a single leaf, and the petiole and midrib of a second leaf on the same plant (Vicente et al. 1998). A third leaf was mock inoculated with sterile water. Plants were grown in a growth chamber with 14 h of light at 26°C. Symptoms appeared between 10 and 14 days postinoculation, with chlorotic V-shaped leaf lesions extending from the sites of inoculation, whereas the petiole inoculation led to vascular blackening and leaf wilting. No symptoms were observed on the mock-inoculated leaves. Symptoms were identical to diseased field samples. Inoculations were repeated with the same results. Bacteria reisolated from symptomatic plants were sequence confirmed to be X. campestris. To our knowledge, this is the first confirmed report of X. campestris naturally infecting garlic mustard in the United States. Future studies will investigate the Brassica host range for this isolate due to the plant’s extensive distribution and potential to serve as a reservoir for X. campestris.The author(s) declare no conflict of interest.

Mucoid and coccoid Helicobacter pylori with fast growth and antibiotic resistance.

In this study, one Helicobacter pylori isolate, from gastric biopsy of a dyspeptic patient that turned into mucoid-coccoid (MC) form upon consecutive subcultures, was identified. The culturability, antibiotic resistance, and lipid contents of MC were compared with those of non-mucoid (NM) spiral Hpylori. Mucoid-coccoid and NM Hpylori were subcultured on Brucella blood agar (BBA) and incubated under aerobic and microaerobic atmospheres at 37°C. Cultures were examined for colony characteristics and bacterial morphology after 1-3days. The isolates were identified by biochemical tests and detection of Hpylori-16S rDNA. Antibiogram was performed with currently used antibiotics for Hpylori eradication. Cellular lipid contents were extracted and analyzed by gas chromatography. Compared with pin-pointed and glistening colonies of NM Hpylori that appeared under microaerobic conditions, MC Hpylori grew well in consecutive subcultures under aerobic and microaerobic atmospheres and produced white patches of mucoid colonies. MC exhibited coccoid and NM spiral morphology. Both isolates were catalase, oxidase, and urease positive and contained 16S rDNA. Compared with NM that was susceptible to almost all the antibiotics, MC was resistant to all the antibiotics. Lipid analyses showed high frequency of unsaturated fatty acids and cholesterol in MC. Coccoid forms with high fatty acid and cholesterol contents that show resistance to antibiotics might resist against other stressful conditions such as gastric acidity and immune response. Moreover, mucoid property may enhance resistance of coccoids to stresses. With mucoid-coccoid lifestyle, Hpylori may establish a chronic infection refractory to antimicrobial therapy.

Stability of the Salmonella Typhimurium rcsC11 mutant under different stress conditions.

The virulence genes of Salmonella are modulated during infection by several regulatory systems, and the RcsCDB system is one of the most important of these. The S. Typhimurium EG14873 (rcsC11) strain harbours the rcsC11 point mutation, displaying a constitutive activation of this system, which is characterized by mucoid colonies and attenuated virulence phenotypes. In this work, the stability of the rcsC11 mutation was analysed under stress conditions. Under acid and anaerobic stresses, we observed the appearance of small and non-mucoid colonies of the rcsC11 strain. The sequencing of the rcsC gene from these colonies showed that the mutation is conserved. Moreover, we found that small colonies were also generated when the wild-type strain grew in acid and anaerobic conditions. It is worth noting that the transition from normal to atypical colonies of both strains only took place after several days of incubation and was not observed during eukaryotic cell infection. Therefore, the appearance of these atypical colonies is a characteristic feature of S. Typhimurium strains under stressful situations and does not involve a reversion of the rcsC11 allele and nor does it imply any risk to mammalian cells. Therefore, we propose that the S. Typhimurium rcsC11 strain is a good candidate for the development of attenuated vaccines.

Exopolysaccharide production in Ensifer meliloti laboratory and native strains and their effects on alfalfa inoculation.

Bacterial surface molecules have an important role in the rhizobia-legume symbiosis. Ensifer meliloti (previously, Sinorhizobium meliloti), a symbiotic Gram-negative rhizobacterium, produces two different exopolysaccharides (EPSs), termed EPS I (succinoglycan) and EPS II (galactoglucan), with different functions in the symbiotic process. Accordingly, we undertook a study comparing the potential differences in alfalfa nodulation by E. meliloti strains with differences in their EPSs production. Strains recommended for inoculation as well as laboratory strains and native strains isolated from alfalfa fields were investigated. This study concentrated on EPS-II production, which results in mucoid colonies that are dependent on the presence of an intact expR gene. The results revealed that although the studied strains exhibited different phenotypes, the differences did not affect alfalfa nodulation itself. However, subtle changes in timing and efficacy to the effects of inoculation with the different strains may result because of other as-yet unknown factors. Thus, additional research is needed to determine the most effective inoculant strains and the best conditions for improving alfalfa production under agricultural conditions.

First Report of a Leaf Blight in Rice (Oryza sativa) Caused by Pantoea ananatis and Pantoea stewartii in Thailand

In 2014 to 2017, the prevalence of leaf blight disease was surveyed in various rice fields located in northern Thailand with 40% disease incidence. Rice leaves with leaf blight symptoms (30 to 50% of the lesion area) ranging from yellow, light brown, to slightly reddish spots were collected and used for bacterial isolation, identification, and storage. Pieces of rice leaf were cut, surface sterilized, and then placed on nutrient glucose agar (NGA). After incubation at 28°C for 24 to 48 h, a single colony of each isolate was picked and restreaked on the NGA plate two additional times. Round, yellow, smooth, nonflat, mucoid colonies were observed on the NGA plate. Bacterial isolates that were gram-negative and rod-shaped were selected for molecular identification. The positive bacterial isolates were used for DNA extraction and PCR amplification of the 16S-23S rDNA spacer region of Xanthomonas oryzae pv. oryzae (∼470 bp) (Adachi and Oku 2000). An unexpected PCR product (∼700 bp) using the XOR primer pair was observed. The PCR product was gel purified for DNA sequencing analysis. The sequencing data were subjected to a BLASTn search of the NCBI database. Results showed 694/700 (99%) identity of our suspected sequences to the gyrB gene of Pantoea ananatis (GenBank no. KT203549.1). Additionally, four pairs of primers specific to housekeeping genes of P. ananatis were designed from P. ananatis strain LMG 20103 (GenBank no. CP001875.2), which are gyrB, rpoB, infB, and atpD. The result showed all four primers successfully amplified all four amplicons in 11 bacterial isolates, and all the sequencing data after BLASTn showed 99 to 100% similarity to P. ananatis (GenBank no. KT203549.1 with 666/670 [99%] identity [gyrB], KT735144.1 with 564/564 [100%] identity [rpoB], KT429228.1 with 499/499 [100%] identity [infB], and KT203523.1 with 593/594 [99%] identity [atpD]). Seven bacterial isolates were shown to be positive only for gyrB and rpoB gene amplifications, and the sequencing data indicated that they belonged to P. stewartii (GenBank no. KT203549.1 with 670/670 [100%] identity [gyrB] and KT735140.1 with 564/564 [100%] identity [rpoB]). Moreover, to validate the species identification, biochemical characterization was performed using the API 20E system, and the result showed all 18 bacterial isolates were identified as Pantoea spp. 2 (urease negative and indole positive). The partial sequencing data of gyrB gene and rpoB genes of all bacterial isolates conducted in this study were deposited in the NCBI database with accession numbers MH244161 to MH244200. Two bacterial isolates from each species were used to confirm for the infectivity of these pathogens in rice via the clipping method. The bacterial suspension (10⁸ CFU/ml) in sterile distilled water was inoculated into rice plants. Inoculation of rice plants with sterile distilled water was used as a negative control (five individual plants per group). The yellow, orange to brown stripes were observed at day 7 postinoculation as expected. To fulfill Koch’s postulates, the bacteria were reisolated from symptomatic leaves for DNA extraction and PCR amplification. The sequence alignment of rpoB gene showed 100% identity between the reisolated sample and the original one. This study is the first report of leaf blight in rice caused by P. ananatis and P. stewartii in Thailand. Toward this end, it has become increasingly evident that P. ananatis and P. stewartii are among the most important and newly emerged leaf blight disease causing pathogens in rice.

Antibiotic resistance, putative virulence factors and curli fimbrination among Cronobacter species

This study aimed to investigate antibiotic resistance and putative virulence factors among Cronobacter sakazakii isolated from powdered infant formula and other sources. The following 9 cultures (CR1-9) were collected from our culture collection: C. sakazakii and 3 Cronobacter species: C. sakazakii ATCC® 29544™, C. muytjensii ATCC® 51329™, C. turicensis E866 were used in this study. Isolates were subjected to antibiotic susceptibility and the following virulence factors (protease, DNase, haemolysin, gelatinase, motility and biofilm formation) using phenotypic methods. All the bacteria were able to form biofilm on agar at 37 °C and were resistant to ampicillin, erythromycin, fosfomycin and sulphamethoxazole. It was observed from this study that tested strains formed weak and strong biofilm with violet dry and rough (rdar), brown dry and rough (bdar), red mucoid and smooth (rmas) colony morphotypes on Congo red agar. Rdar expresses curli and fimbriae, while bdar expresses curli. Both biofilm colony morphotypes are commonly found in Enterobacteriaceae including Salmonella species. This study also reveals a new colony morphotypes in Cronobacter species. Conclusively, there was correlation between putative virulence factors and antibiotic resistance among the tested bacteria. Further study on virulence and antibiotic resistance genes is hereby encouraged.

First Report of Xanthomonas hortorum pv. hederae Causing Bacterial Leaf Spot of Hedera helix in Taiwan

Hedera helix (ivy) is a popular evergreen commonly grown worldwide as outdoor and indoor plants. In 2018, symptoms similar to bacterial leaf spot were observed on potted ivies in two nurseries, one located in Tianwei Township, Changhua County (observed in January) and the other in Nantun District, Taichung City, Taiwan (observed in May). In both locations, leaf spot symptoms were seen on over 90% of the plants. The lesions were irregularly shaped and were necrotic or water-soaked. A total of seven infected plants were sampled and brought to the laboratory, one collected in Changhua and six sampled in Taichung. Diseased tissues were cut, and bacterial streaming was observed under a light microscope. The samples were streaked onto nutrient agar (NA) and onto NA with 0.2% yeast extract and then were incubated at 25°C. Round yellow colonies were recovered from all seven plants, and seven independent bacterial strains (Hed1 to Hed7) were isolated (each from a different plant). Hed1 was obtained from the plant collected in Changhua, whereas the others were isolated from plants collected in Taichung. All seven strains produced yellow mucoid colonies on yeast dextrose calcium carbonate agar, similar to most known xanthomonads (Schaad et al. 2001). They tested positive for esculin degradation, weak positive for casein hydrolysis, and negative for the abilities to degrade Tween 80 and starch (Schaad et al. 2001). Infiltration of these strains’ suspensions into tomato leaves (cv. Known-you 301) induced hypersensitive responses. Identification of Hed1 to Hed7 was conducted via multilocus sequence analysis targeting the fusA, gyrB, gapA, gltA, lacF, and lepA genes (Almeida et al. 2010). Gene fragments were sequenced for all seven strains. For every fragment tested, Hed1 to Hed7 all had the same sequences (GenBank accession nos. MK124762 to MK124767). Comparing the concatenated 2,745-bp sequences of Hed1 to Hed7 among each other and against sequences included in the Plant-Associated Microbes Database (http://genome.ppws.vt.edu/cgi-bin/MLST/home.pl) (Almeida et al. 2010) revealed that all seven strains shared identical sequences with the type strain of Xanthomonas hortorum pv. hederae (LMG733) and had lower than 98% identity with the other Xanthomonas species and pathovars. To fulfill Koch’s postulates, three strains (Hed1, Hed2, and Hed6) were randomly selected and spray inoculated onto potted ivies at a concentration of approximately 1 × 10⁸ CFU/ml (in 0.02% Silwet L-77). Each strain was inoculated onto three plants. Three additional plants sprayed with 0.02% Silwet L-77 solution without bacteria served as controls. The plants were then bagged in plastic bags for 3 days to maintain high humidity. Within 3 weeks, necrotic leaf spots developed on all bacteria-inoculated plants but not on the control plants. Bacterial strains were reisolated from the plants inoculated with Hed1, Hed2, and Hed6, and all reisolates shared the same gapA sequence with the original strains. Bacterial leaf spot on ivy has been reported in Greece, Japan, and other parts of the world (Pirc et al. 2012; Suzuki et al. 2002; Trantas et al. 2016). The present study is, to our knowledge, the first report of the occurrence of this disease in Taiwan. Ivies are often planted in shaded/indoor areas at high densities and are watered frequently in nurseries. These conditions could favor the development of bacterial leaf spot and the transmission of its pathogen.