mtDNA Types Research Articles

Low levels of supercoiled mitochondrial DNA are involved in heart failure induced by transverse aortic constriction in mice via an inflammatory response mediated by ZBP1

BackgroundInflammation in the myocardium plays a critical role in cardiac remodeling and the pathophysiology of heart failure (HF). Previous studies have shown that mitochondrial DNA (mtDNA) can exist in different topological forms. However, the specific influence of the ratio of supercoiled/relaxed mtDNA on the inflammatory response in cardiomyocytes remains poorly understood. The aim of this study was to elucidate the differential effects of different mtDNA types on cardiomyocyte inflammation through regulation of ZBP1. Materials and methodsA mouse model of HF was established by transverse aortic constriction (TAC) or doxorubicin (Doxo) induction. Histopathological changes were assessed by HE staining. ELISA was used to measure cytokine levels (IL-1β and IL-6). Southern blot analysis was performed to examine the different topology of mtDNA. Pearson correlation analysis was used to determine the correlation between the ratio of supercoiled/relaxed mtDNA and inflammatory cytokines. Reverse transcription quantitative PCR (RT-qPCR) was used to measure the mRNA expression levels of cytokines (IL-1β, IL-6) and Dloop, as an mtDNA marker. ResultsThe ratio of supercoiled to relaxed mtDNA was significantly increased in the myocardium of Doxo-induced mice, whereas no significant changes were observed in TAC-induced mice. The levels of IL-1β and IL-6 were positively correlated with the cytoplasmic mtDNA supercoiled/relaxed circle ratio. Different mtDNA topology has different effects on inflammatory pathways. Low supercoiled mtDNA primarily activates the NF-κB (Ser536) pathway via ZBP1, whereas high supercoiled mtDNA significantly affects the STAT1 and STAT2 pathways. The RIPK3-NF-κB pathway, as a downstream target of ZBP1, mediates the inflammatory response induced by low supercoiled mtDNA. Knockdown of TLR9 enhances the expression of ZBP1, p-NF-κB, and RIPK3 in cardiomyocytes treated with low supercoiled mtDNA, indicating the involvement of TLR9 in the anti-inflammatory role of ZBP1 in low supercoiled mtDNA-induced inflammation. ConclusionDifferent ratios of supercoiled to relaxed mtDNA influence the inflammatory response of cardiomyocytes and contribute to HF through the involvement of ZBP1. ZBP1, together with its downstream inflammatory mechanisms, mediates the inflammatory response induced by a low ratio of supercoiled mtDNA.

Quantitative color analysis of burned bone to predict DNA quantity, quality, and genotyping success.

Badly burned skeletal remains are commonly submitted to forensic laboratories for victim identification via DNA analysis methods. Burned skeletal remains present many challenges for DNA analysis as they can contain low amounts of DNA which can also be damaged and degraded, resulting in partial or no STR profiles. Therefore, a simple, but effective screening method that identifies which samples may provide the most successful STR or mtDNA typing results for identification would enable forensic laboratories to save time, money, and resources. One metric that can be used and a screening method is the color of burned bone, as bone color changes with exposure to fire as temperature and length of exposure increase. This research developed a quantitative screening method based on the surface color of burned bone. The different visual bone colors (light brown, dark brown, black, gray, and white) were quantified using the Commission on Illumination L*a*b color space. These values were then compared to DNA yield, STR, and mtDNA profile completeness to identify whether the L*a*b values can predict genotyping success. A Bayesian network was constructed to determine the probability of STR typing success, given a set of L*a*b values. Results demonstrated that samples with an a* value greater than or equal to one and b* value greater than eight (light brown and dark brown burned samples) were the most predictive of STR typing success and mtDNA typing success. A decision tree for processing burned bones was constructed based on the color value thresholds.

Decoding the nature and complexity of extracellular mtDNA: Types and implications for health and disease

The mitochondrial DNA (mtDNA) is replicated and canonically functions within intracellular mitochondria, but recent discoveries reveal that the mtDNA has another exciting extracellular life. mtDNA fragments and mitochondria-containing vesicular structures are detected at high concentrations in cell-free forms, in different biofluids. Commonly referred to as cell-free mtDNA (cf-mtDNA), the field is currently without a comprehensive classification system that acknowledges the various biological forms of mtDNA and whole mitochondria existing outside the cell. This absence of classification hampers the creation of precise and consistent quantification methods across different laboratories, which is crucial for unraveling the molecular and biological characteristics of mtDNA. In this article, we integrate recent findings to propose a classification for different types of Extracellular mtDNA [ex-mtDNA]. The major biologically distinct types include: Naked mtDNA [N-mtDNA], mtDNA within non-mitochondrial Membranes [M-mtDNA], Extracellular mitochondria [exM-mtDNA], and mtDNA within Mitochondria enclosed in a Membrane [MM-mtDNA]. We outline the challenges associated with accurately quantifying these ex-mtDNA types, suggest potential physiological roles for each ex-mtDNA type, and explore how this classification could establish a foundation for future research endeavors and further analysis and definitions for ex-mtDNA. By proposing this classification of circulating mtDNA forms, we draw a parallel with the clinically recognized forms of cholesterol, such as HDL and LDL, to illustrate potential future significance in a similar manner. While not directly analogous, these mtDNA forms may one day be as biologically relevant in clinical interpretation as cholesterol fractions are currently. We also discuss how advancing methodologies to reliably quantify distinct ex-mtDNA forms could significantly enhance their utility as health or disease biomarkers, and how their application may offer innovative therapeutic approaches.

Eco‐physiological arguments on the functional impact of Lepus timidus mitochondrial DNA introgression in Iberian hares (Lepus granatensis)

AbstractGenetic exchanges between species provide valuable opportunities to dissect the relative importance of neutral and selective processes driving introgression events and to test their functional relevance. In the northern half of the Iberian Peninsula, the Iberian hare, Lepus granatensis, presents extensive patterns of mitochondrial DNA (mtDNA) introgression from the mountain hare, L. timidus, a species that disappeared from the region after the Last Glacial Maximum. Here, we test whether mtDNA introgression affects reproductive success and body condition of Iberian hare individuals. For that end, hares (n = 149) were sampled from populations along the mtDNA introgression gradient during the 2013–2014 and 2014–2015 hunting seasons. Reproductive performance indicators, including pregnancy status and testicular weight, were recorded, while body condition was measured as kidney fat (our response variables). Predictors included individual traits (sex and age), sampling period (month and hunting season), mtDNA introgression, occurrence or burden of different endoparasites and environmental factors. Our results showed that mtDNA introgression was negatively associated with pregnancy in females and body condition in males, while a positive association was found with body condition in females. These results suggest that carrying the mountain hare mtDNA has physiological effects in Iberian hares, but that the allospecific mtDNA type may not always be beneficial for the individual. This study shows that the patterns of mtDNA introgression seen in the Iberian hare today may result from a complex balance between deleterious and beneficial individual effects.

P-730 Detection of mitochondrial reversal following meiotic spindle transfer: a finding of importance for mitochondrial replacement therapies used for the purpose of avoiding mtDNA disease transmission

Abstract Study question Following transfer of the meiotic spindle from a patient’s oocyte into an enucleated donor oocyte, do relative levels of patient and donor mtDNA remain stable? Summary answer mtDNA transferred along with the patient’s spindle typically remain at a low level. However, disproportionate expansion of the patient’s mtDNA can occur in some cases. What is known already Mitochondrial DNA disorders are caused by mutations in the mitochondrial genome, disrupting ATP production. They have few treatment options and no cure. All mitochondria are derived from the oocyte, therefore mtDNA disorders are maternally inherited. It has been proposed that disease transmission could be avoided if female mtDNA mutation carriers underwent meiotic spindle transfer (MST), removing the chromosomes (on the spindle) from an affected oocyte and transferring them into the healthy cytoplasm of a donor oocyte. However, research using embryonic stem cells has suggested that the small population of mitochondria transferred along with the spindle can sometimes undergo dramatic expansion. Study design, size, duration 25 infertile couples were enrolled in a prospective pilot study evaluating MST as a treatment for infertility. The female participants had a mean age of 37.2, and an average of 6.4 previous unsuccessful IVF cycles (range 3-11) characterised by extremely poor embryo development and without any previous pregnancy. Importantly, none of the patients were carriers of a mtDNA disorder. Oocyte donors with previous successful IVF outcomes were matched with patients according to standard practice. Participants/materials, setting, methods Metaphase-II-spindles from patient oocytes were transferred into enucleated donor oocytes. Reconstructed oocytes underwent ICSI and the resulting embryos were transferred at the blastocyst stage. Mitochondrial genomes were sequenced to identify polymorphisms differing between the patient and oocyte donor. These variations were quantified in the embryos (blastocyst biopsies), during pregnancy (amniocentesis), in newborns (cord blood, cord tissue, urine), at 3-6 months and at one year (saliva, urine, blood), revealing the relative amounts of each mitochondrial type. Main results and the role of chance This MST pilot study resulted in the birth of six children, indicating that the procedure is compatible with the production of viable embryos, capable of producing healthy live births. The patient’s mtDNA was shown to represent <1% of the total in all blastocysts produced, confirming that MST is highly reproducible and that relatively few mitochondria are transferred along with the spindle. For five of the six children, the proportion of the total mtDNA attributable to the patient appeared to be stable, remaining at very low levels in all of the samples from later developmental stages. However, in one child the small quantity of mtDNA transferred along with the spindle increased disproportionately with respect to the mtDNA of the oocyte donor, ultimately representing 30-60% of the total at birth, depending on the tissue tested. The precise timing of the expansion of one type of mtDNA at the expense of the other is not known but occurred sometime between the blastocyst stage and birth. By the time of birth, the levels of donor and patient mtDNA appeared to have stabilised (no further increases were seen at 6 months and one year). All of the children born remain developmentally normal and healthy. Limitations, reasons for caution After using MST, several pregnancies were achieved for patients with a long history of unsuccessful IVF attempts, associated with poor oocyte quality and a failure to produce blastocysts. However, this small pilot study lacked the controls necessary for a definitive evaluation of MST as a tool for infertility treatment. Wider implications of the findings All children born following MST were healthy. However, our results clearly demonstrate that a substantial degree of mtDNA ‘reversal’ is possible. Consequently, mitochondrial replacement therapies used for avoidance of mtDNA disorders might not always be successful, even when initial levels of mutant mtDNA in reconstructed oocytes are very low. Trial registration number ISRCTN11455145

When does the female bias arise? Insights from the sex determination cascade of a flea beetle with a strongly skewed sex ratio

Reproduction-manipulating bacteria like Wolbachia can shift sex ratios in insects towards females, but skewed sex ratios may also arise from genetic conflicts. The flea beetle Altica lythri harbors three main mtDNA strains that are coupled to three different Wolbachia infections. Depending on the mtDNA types, the females produce either offspring with a balanced sex ratio or exclusively daughters. To obtain markers that can monitor when sex bias arises in the beetle’s ontogeny, we elucidated the sex determination cascade of A. lythri. We established a RT-PCR method based on length variants of dsx (doublesex) transcripts to determine the sex of morphologically indistinguishable eggs and larvae. In females of one mtDNA type (HT1/HT1*) known to produce only daughters, male offspring were already missing at the egg stage while for females of another type (HT2), the dsx splice variants revealed a balanced sex ratio among eggs and larvae. Our data suggest that the sex determination cascade in A. lythri is initiated by maternally transmitted female-specific tra (transformer) mRNA as primary signal. This tra mRNA seems to be involved in a positive feedback loop that maintains the production of the female splice variant, as known for female offspring in Tribolium castaneum. The translation of the maternally transmitted female tra mRNA must be inhibited in male offspring, but the underlying primary genetic signal remains to be identified. We discuss which differences between the mtDNA types can influence sex determination and lead to the skewed sex ratio of HT1.

Mitochondrial network structure controls cell-to-cell mtDNA variability generated by cell divisions.

Mitochondria are highly dynamic organelles, containing vital populations of mitochondrial DNA (mtDNA) distributed throughout the cell. Mitochondria form diverse physical structures in different cells, from cell-wide reticulated networks to fragmented individual organelles. These physical structures are known to influence the genetic makeup of mtDNA populations between cell divisions, but their influence on the inheritance of mtDNA at divisions remains less understood. Here, we use statistical and computational models of mtDNA content inside and outside the reticulated network to quantify how mitochondrial network structure can control the variances of inherited mtDNA copy number and mutant load. We assess the use of moment-based approximations to describe heteroplasmy variance and identify several cases where such an approach has shortcomings. We show that biased inclusion of one mtDNA type in the network can substantially increase heteroplasmy variance (acting as a genetic bottleneck), and controlled distribution of network mass and mtDNA through the cell can conversely reduce heteroplasmy variance below a binomial inheritance picture. Network structure also allows the generation of heteroplasmy variance while controlling copy number inheritance to sub-binomial levels, reconciling several observations from the experimental literature. Overall, different network structures and mtDNA arrangements within them can control the variances of key variables to suit a palette of different inheritance priorities.

Genetic and phenotypic associations of mitochondrial DNA copy number, SNP, and haplogroups with growth and carcass traits in beef cattle

Mitochondrial DNA copy number (mtDNA CN) is heritable and easily obtained from low-pass sequencing (LPS). This study investigated the genetic correlation of mtDNA CN with growth and carcass traits in a multi-breed and crossbred beef cattle population. Blood, leucocyte, and semen samples were obtained from 2,371 animals and subjected to LPS that resulted in nuclear DNA (nuDNA) and mtDNA sequence reads. Mitochondrial DNA CN was estimated as the ratio of mtDNA to nuDNA coverages. Variant calling was performed from mtDNA, and 11 single nucleotide polymorphisms (SNP) were identified in the population. Samples were classified in taurine haplogroups. Haplogroup and mtDNA type were further classified based on the 11 segregating SNP. Growth and carcass traits were available for between 7,249 and 60,989 individuals. Associations of mtDNA CN, mtDNA haplogroups, mtDNA types, and mtDNA SNP with growth and carcass traits were estimated with univariate animal models, and genetic correlations were estimated with a bivariate animal model based on pedigree. Mitochondrial DNA CN tended (P-value ≤0.08) to be associated with birth weight and weaning weight. There was no association (P-value >0.10) between mtDNA SNP, haplogroups, or types with growth and carcass traits. Genetic correlation estimates of mtDNA CN were -0.30 ± 0.16 with birth weight, -0.31 ± 0.16 with weaning weight, -0.15 ± 0.14 with post-weaning gain, -0.11 ± 0.19 with average daily dry-matter intake, -0.04 ± 0.22 with average daily gain, -0.29 ± 0.13 with mature cow weight, -0.11 ± 0.13 with slaughter weight, -0.14 ± 0.13 with carcass weight, -0.07 ± 0.14 with carcass backfat, 0.14 ± 0.14 with carcass marbling, and -0.06 ± 0.14 with ribeye area. In conclusion, mtDNA CN was negatively correlated with most traits investigated, and the genetic correlation was stronger with growth traits than with carcass traits.

Mitochondrial DNA as a marker for treatment-response in post-traumatic stress disorder

Post-traumatic stress disorder (PTSD) is a serious mental health condition thought to be mediated by a dysregulated stress response system. Stress, especially chronic stress, affects mitochondrial activity and their efficiency in duplicating their genomes. Human cells contain numerous mitochondria that harbor multiple copies of their own genome, which consist of a mixture of wild type and variant mtDNA - a condition known as mitochondrial heteroplasmy. Number of mitochondrial genomes in a cell and the degree of heteroplasmy may serve as an indicator of mitochondrial allostatic load. Changes in mtDNA copy number and the proportion of variant mtDNA may be related to mental disorders and symptom severity, suggesting an involvement of mitochondrial dysfunction also in PTSD. Therefore, we examined number and composition of mitochondrial DNA before and after six weeks of inpatient psychotherapy treatment in a cohort of 60 female PTSD patients. We extracted DNA from isolated monocytes before and after inpatient treatment and quantified cellular mtDNA using multiplex qPCR. We hypothesized that treatment would lead to changes in cellular mtDNA levels and that change in mtDNA level would be associated with PTSD symptom severity and treatment response. It could be shown that mtDNA copy number and the ratio of variant mtDNA decreased during therapy, however, this change did not correlate with treatment response. Our results suggest that inpatient treatment can reduce signs of mitochondrial allostatic load, which could have beneficial effects on mental health. The quantification of mtDNA and the determination of cellular heteroplasmy could represent valuable biomarkers for the molecular characterization of mental disorders in the future.

Evidence of backcross inviability and mitochondrial DNA paternal leakage in sea turtle hybrids.

Hybridization is known to be part of many species' evolutionary history. Sea turtles have a fascinating hybridization system in which species separated by as much as 43million years are still capable of hybridizing. Indeed, the largest nesting populations in Brazil of loggerheads (Caretta caretta) and hawksbills (Eretmochelys imbricata) have a high incidence of hybrids between these two species. A third species, olive ridleys (Lepidochelys olivacea), is also known to hybridize although at a smaller scale. Here, we used restriction site-associated DNA sequencing (RAD-Seq) markers, mitogenomes, and satellite-telemetry to investigate the patterns of hybridization and introgression in the Brazilian sea turtle population and their relationship with the migratory behaviours between feeding and nesting aggregations. We also explicitly test if the mixing of two divergent genomes in sea turtle hybrids causes mitochondrial paternal leakage. We developed a new species-specific PCR-assay capable of detecting mitochondrial DNA (mtDNA) inheritance from both parental species and performed ultra-deep sequencing to estimate the abundance of each mtDNA type. Our results show that all adult hybrids are first generation (F1) and most display a loggerhead migratory behaviour. We detected paternal leakage in F1 hybrids and different proportions of mitochondria from maternal and paternal species. Although previous studies showed no significant fitness decrease in hatchlings, our results support genetically-related hybrid breakdown possibly caused by cytonuclear incompatibility. Further research on hybrids from other populations in addition to Brazil and between different species will show if backcross inviability and mitochondrial paternal leakage is observed across sea turtle species.

Environmental thallium exposure and the risk of early embryonic arrest among women undergoing in vitro fertilization: thallium exposure and polymorphisms of mtDNA gene interaction and potential cause exploring.

Early embryonic arrest (EEA) leads to cancelation of fresh cycles among infertile women undergoing in vitro fertilization (IVF), bringing a great challenge for IVF. Whether exposure to thallium (Tl) is associated with an increased risk of EEA, especially its interaction with polymorphisms of mitochondria DNA (mtDNA) gene, is worthy of study. A case-control design was performed, including 74 EEA cases with 123 IVF cycles and 157 age and BMI-matched controls with 180 IVF cycles. Levels of Tl and other toxic metals (lead (Pb), (mercury) Hg, and (arsenci) As) were assessed by measuring them in blood samples collected on the day of oocyte retrieval; PCR amplification and sequencing were performed to screen the polymorphic sites of mtDNA gene in D-loop region. Bayesian kernel machine regression (BKMR) was used to confirm that Tl played a leading role in the situation of combined exposure; generalized estimating equation (GEE) models were used to evaluate the associations of Tl concentrations, polymorphisms of mtDNA gene, and their interactions with the risk of EEA. The impact of Tl exposure or polymorphisms of mtDNA gene on the oogenesis and embryonic development was also evaluated. BKMR analysis revealed that PIP (posterior inclusion probability) value of T1 was 0.9096, indicating that it played a leading role in the situation of combined exposure. Compared to the first quartile of Tl, the adjusted ORs (95% CIs) of EEA risk were 0.66 (0.26, 1.70), 1.18 (0.52, 2.64), and 4.53 (2.11, 9.69) for the second, third, and fourth quartile, respectively (p trend < 0.001). Compared to the wild type of mtDNA 16,519 gene (T 16,519T), the adjusted OR (95% CI) of EEA risk for the variant type (T 16,519 C) was 3.11 (1.70, 5.72), and the variant types of the other sites with a minor allele frequency > 10% were not significantly related with the risk of EEA after FDR (False Discovery Rate)correction. With respect to interaction, compared to women at low Tl exposure level & wild type of mtDNA 16,519 gene group, the adjusted OR (95% CI) of EEA risk for women at high Tl exposure level & variant type of mtDNA 16,519 gene group was 9.28 (3.33, 25.81). Additionally, Tl exposure and polymorphisms of mtDNA 16,519 gene are inversely associated with the outcomes of oogenesis and embryonic development significantly. Our study indicated that high Tl exposure level was associated with the increased risk of EEA and Tl played a leading role in the situation of combined exposure; the strength of association was much higher when Tl exposure interacted with polymorphism of 16,519 mtDNA gene. These relationships might originate from the impact of Tl exposure or polymorphism of 16,519 mtDNA gene on the oogenesis and early embryonic development in vitro. Infertile women should keep high vigilant against Tl exposure especially those with variant type of mtDNA 16,519 gene.

A Comprehensive Description and Evolutionary Analysis of Testudines Mitochondrial Genomes

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.

MtDNA Heteroplasmy: Origin, Detection, Significance, and Evolutionary Consequences

Mitochondrial DNA (mtDNA) is predominately uniparentally transmitted. This results in organisms with a single type of mtDNA (homoplasmy), but two or more mtDNA haplotypes have been observed in low frequency in several species (heteroplasmy). In this review, we aim to highlight several aspects of heteroplasmy regarding its origin and its significance on mtDNA function and evolution, which has been progressively recognized in the last several years. Heteroplasmic organisms commonly occur through somatic mutations during an individual’s lifetime. They also occur due to leakage of paternal mtDNA, which rarely happens during fertilization. Alternatively, heteroplasmy can be potentially inherited maternally if an egg is already heteroplasmic. Recent advances in sequencing techniques have increased the ability to detect and quantify heteroplasmy and have revealed that mitochondrial DNA copies in the nucleus (NUMTs) can imitate true heteroplasmy. Heteroplasmy can have significant evolutionary consequences on the survival of mtDNA from the accumulation of deleterious mutations and for its coevolution with the nuclear genome. Particularly in humans, heteroplasmy plays an important role in the emergence of mitochondrial diseases and determines the success of the mitochondrial replacement therapy, a recent method that has been developed to cure mitochondrial diseases.

Structure and movement of the hybrid zone between two divergent lineages of the Japanese newtCynops pyrrhogaster(Amphibia: Urodela) in central Japan

The maintenance mechanisms of hybrid zones between two lineages/species and their gene flow dynamics are major topics for speciation studies. Elucidating these dynamics can help us to understand the process of speciation. The newt Cynops pyrrhogaster is distributed on the main islands of Japan and comprises five mitochondrial DNA (mtDNA) lineages. In this study, we surveyed the genetic relationship between two lineages (northern and central) around their boundary. We genotyped 202 individuals from 24 populations using the mitochondrial cytochrome b gene and 12 microsatellite loci. MtDNA analysis revealed that the two lineages were distributed parapatrically to each other without coexistence, whereas the microsatellite analysis indicated the presence of a hybrid zone. The estimated dispersal rates were higher from both parental lineages to the hybrid populations than those in the opposite directions. These data indicate that the hybrid zone is a tension zone, which is maintained by an equilibrium between selection against hybrid individuals and the invasion of both parental individuals from adjacent areas. The two parental lineages are genetically moderately isolated from each other and appear to be biologically independent species. The overall dispersal rate was more pronounced in the south-to-north direction. More than 10 individuals having central type of mtDNA retained some genetic characteristics derived from the northern lineage, which can be regarded as genetic footprint of their northern lineage ancestor. These results suggest that the hybrid zone has shifted from south to north, resulting in replacing the range of the northern lineage to that of the central lineage.

Intraspecific Mitochondrial DNA Comparison of Mycopathogen Mycogone perniciosa Provides Insight Into Mitochondrial Transfer RNA Introns.

Mycogone perniciosa is the main causative agent of wet bubble disease, which causes severe damage to the production of the cultivated mushroom Agaricus bisporus around the world. Whole-genome sequencing of 12 isolates of M. perniciosa was performed using the Illumina sequencing platform, and the obtained paired-end reads were used to assemble complete mitochondrial genomes. Intraspecific comparisons of conserved protein-coding genes, transfer RNA (tRNA) and ribosomal RNA (rRNA) genes, introns, and intergenic regions were conducted. Five different mitochondrial DNA (mtDNA) haplotypes were detected among the tested isolates, ranging from 89,080 to 93,199 bp in length. All of the mtDNAs contained the same set of 14 protein-coding genes and 2 rRNA and 27 tRNA genes, which shared high sequence similarity. In contrast, the number, insertion sites, and sequences of introns varied greatly among the mtDNAs. Eighteen of 43 intergenic regions differed among the isolates, reflecting 65 single nucleotide polymorphisms, 76 indels, and the gain/loss of nine long fragments. Intraspecific comparison revealed that two introns were located within tRNA genes, which is the first detailed description of mitochondrial tRNA introns. Intronic sequence comparison within the same insertion sites revealed the formation process of two introns, which also illustrated a fast evolutionary rate of introns among M. perniciosa isolates. Based on the intron distribution pattern, a pair of universal primers and four pairs of isolate-specific primers were designed and were used to identify the five mtDNA types. In summary, the rapid gain or loss of mitochondrial introns could be an ideal marker for population genetics analysis.

MtDNA Heteroplasmy at the Core of Aging-Associated Heart Failure. An Integrative View of OXPHOS and Mitochondrial Life Cycle in Cardiac Mitochondrial Physiology

The most common aging-associated diseases are cardiovascular diseases which affect 40% of elderly people. Elderly people are prone to suffer aging-associated diseases which are not only related to health and medical cost but also to labor, household productivity and mortality cost. Aging is becoming a world problem and it is estimated that 21.8% of global population will be older than 65 years old in 2050; and for the first time in human history, there will be more elderly people than children. It is well accepted that the origin of aging-associated cardiovascular diseases is mitochondrial dysfunction. Mitochondria have their own genome (mtDNA) that is circular, double-stranded, and 16,569 bp long in humans. There are between 500 to 6000 mtDNA copies per cell which are tissue-specific. As a by-product of ATP production, reactive oxygen species (ROS) are generated which damage proteins, lipids, and mtDNA. ROS-mutated mtDNA co-existing with wild type mtDNA is called mtDNA heteroplasmy. The progressive increase in mtDNA heteroplasmy causes progressive mitochondrial dysfunction leading to a loss in their bioenergetic capacity, disruption in the balance of mitochondrial fusion and fission events (mitochondrial dynamics, MtDy) and decreased mitophagy. This failure in mitochondrial physiology leads to the accumulation of depolarized and ROS-generating mitochondria. Thus, besides attenuated ATP production, dysfunctional mitochondria interfere with proper cellular metabolism and signaling pathways in cardiac cells, contributing to the development of aging-associated cardiovascular diseases. In this context, there is a growing interest to enhance mitochondrial function by decreasing mtDNA heteroplasmy. Reduction in mtDNA heteroplasmy is associated with increased mitophagy, proper MtDy balance and mitochondrial biogenesis; and those processes can delay the onset or progression of cardiovascular diseases. This has led to the development of mitochondrial therapies based on the application of nutritional, pharmacological and genetic treatments. Those seeking to have a positive impact on mtDNA integrity, mitochondrial biogenesis, dynamics and mitophagy in old and sick hearts. This review covers the current knowledge of mitochondrial physiopathology in aging, how disruption of OXPHOS or mitochondrial life cycle alter mtDNA and cardiac cell function; and novel mitochondrial therapies to protect and rescue our heart from cardiovascular diseases.

Phylogenetic Study and Divergence of Weaver Ant, &amp;lt;i&amp;gt;Oecophylla smaragdina&amp;lt;/i&amp;gt; Fabricius in Bangladesh (Hymenoptera: Formicidae)

The weaver ant species, <i>Oecophylla smaragdina</i>, is widely distributed from India through Southeast Asia to northern Australia including many tropical Western Pacific islands. Recent phylogenetic study of <i>O. smaragdina</i> showed that the species is divided into 7 groups based on mtDNA and the Bangladesh populations belong to SE Asian mainland clade despite its geographical proximity to India. The present study aims to reveal the phylogenetic aspect of <i>O. smaragdina</i> in Bangladesh with its divergence time estimation based on extensive materials. Sampling was executed according to zonation of 5 areas which are demarcated by 3 main rivers and a total of 95 colonies from 87 localities of 47 Districts were collected during 2013 to 2018 from Bangladesh. The molecular analyses, using 2 mitochondrial loci: Cytochrome b oxidase subunit 2 (Cytb) consisting of 507 bp and Cytochrome c oxidase subunit I (COI) consisting of 639 bp done in Ku, Japan. The analysis of 84 colonies revealed that 47 are the Indian clade (Indian type) and 37 are the SE Asian mainland clade (SE Asian type). The distribution of mtDNA types showed the occurrence of both the two types with some overlapping distribution in the central part of Bangladesh. The divergence time analysis in Bangladesh populations, resulted that Indian type diverged ca. 2.2 Ma and SE Asian type diverged ca. 0.20 Ma corresponding to early to late Pleistocene. This study suggested a comprehensive phylogenetic scenario of <i>O. smaragdina</i> in Bangladesh.

Examination of unidentifiable spined loach individuals found in the overlap zone of two tetraploid species within a single river in Japan

An endangered tetraploid spined loach species, Cobitis takenoi (Cypriniformes: Cobitidae; hereafter called Tango loach) is known to inhabit only a single river in Kyoto Prefecture, Japan. Since Tango loach was discovered recently, in 2010, and only described in 2016, its morphology, ecology, and genetics are not well studied. Another tetraploid spined loach species Cobitis sp. BIWAE type A (hereafter, called Ohshima loach) inhabits the same river. The two loaches are reported as morphologically distinguishable from each other. Although the habitats of the two species in the river are segregated (Ohshima loach and Tango loach inhabit the upper and lower reaches, respectively), they overlap to a small degree in the boundary area. Recently, some individuals with morphological characteristics that are intermediate between the two species were found in the overlap zone. It was suspected that hybrids between the two species were produced since breeding seasons of the two species overlapped. To investigate whether the two species produce hybrids, we performed mitochondrial and nuclear DNA analyses on the unidentifiable individuals. Eight individuals unidentifiable to the species level collected in the river between 2017 and 2018 were examined and compared with the Tango and Ohshima loach species. Using mitochondrial DNA (mtDNA) cytochrome b analysis, we found that six individuals had mtDNA types identical to Tango loach and two individuals had mtDNA types identical to Ohshima loach. Furthermore, sequencing analysis of nuclear recombination activating gene 1 (RAG-1) revealed that each species had species-specific alleles. The phylogenetic analysis indicated that alleles in Tango loach were divided into two clusters and those from Ohshima loach formed a single cluster. There were no discrepancies in the combination between mtDNA and nuclear DNA species types within each specimen. DNA fingerprinting analysis (AFLP) showed that the species-unidentifiable individuals exhibited distinctly segregated genetic groups corresponding with Tango and Ohshima loaches. In summary, no hybrids were detected from among any unidentifiable individual examined in this study. New conventional genetic method for discriminating the two sympatric loach species developed here can be effective tool for the conservation of the Tango loach since there was no strict diagnostic morphological character between them.

MtDNA sequence features associated with 'selfish genomes' predict tissue-specific segregation and reversion.

Mitochondrial DNA (mtDNA) encodes cellular machinery vital for cell and organism survival. Mutations, genetic manipulation, and gene therapies may produce cells where different types of mtDNA coexist in admixed populations. In these admixtures, one mtDNA type is often observed to proliferate over another, with different types dominating in different tissues. This ‘segregation bias’ is a long-standing biological mystery that may pose challenges to modern mtDNA disease therapies, leading to substantial recent attention in biological and medical circles. Here, we show how an mtDNA sequence’s balance between replication and transcription, corresponding to molecular ‘selfishness’, in conjunction with cellular selection, can potentially modulate segregation bias. We combine a new replication-transcription-selection (RTS) model with a meta-analysis of existing data to show that this simple theory predicts complex tissue-specific patterns of segregation in mouse experiments, and reversion in human stem cells. We propose the stability of G-quadruplexes in the mtDNA control region, influencing the balance between transcription and replication primer formation, as a potential molecular mechanism governing this balance. Linking mtDNA sequence features, through this molecular mechanism, to cellular population dynamics, we use sequence data to obtain and verify the sequence-specific predictions from this hypothesis on segregation behaviour in mouse and human mtDNA.

Semimytilus algosus: first known hermaphroditic mussel with doubly uniparental inheritance of mitochondrial DNA

Doubly uniparental inheritance (DUI) of mitochondrial DNA is a rare phenomenon occurring in some freshwater and marine bivalves and is usually characterized by the mitochondrial heteroplasmy of male individuals. Previous research on freshwater Unionida mussels showed that hermaphroditic species do not have DUI even if their closest gonochoristic counterparts do. No records showing DUI in a hermaphrodite have ever been reported. Here we show for the first time that the hermaphroditic mussel Semimytilus algosus (Mytilida), very likely has DUI, based on the complete sequences of both mitochondrial DNAs and the distribution of mtDNA types between male and female gonads. The two mitogenomes show considerable divergence (34.7%). The presumably paternal M type mitogenome dominated the male gonads of most studied mussels, while remaining at very low or undetectable levels in the female gonads of the same individuals. If indeed DUI can function in the context of simultaneous hermaphroditism, a change of paradigm regarding its involvement in sex determination is needed. It is apparently associated with gonadal differentiation rather than with sex determination in bivalves.