Plasma mtDNA Research Articles

Role of released mitochondrial DNA in acute lung injury.

Acute lung injury(ALI)/acute respiratory distress syndrome(ARDS) is a form of acute-onset hypoxemic respiratory failure characterised by an acute, diffuse, inflammatory lung injury, and increased alveolar-capillary permeability, which is caused by a variety of pulmonary or nonpulmonary insults. Recently, aberrant mitochondria and mitochondrial DNA(mtDNA) level are associated with the development of ALI/ARDS, and plasma mtDNA level shows the potential to be a promising biomarker for clinical diagnosis and evaluation of lung injury severity. In mechanism, the mtDNA and its oxidised form, which are released from impaired mitochondria, play a crucial role in the inflammatory response and histopathological changes in the lung. In this review, we discuss mitochondrial outer membrane permeabilisation (MOMP), mitochondrial permeability transition pore(mPTP), extracellular vesicles (EVs), extracellular traps (ETs), and passive release as the principal mechanisms for the release of mitochondrial DNA into the cytoplasm and extracellular compartments respectively. Further, we explain how the released mtDNA and its oxidised form can induce inflammatory cytokine production and aggravate lung injury through the Toll-like receptor 9(TLR9) signalling, cytosolic cGAS-stimulator of interferon genes (STING) signalling (cGAS-STING) pathway, and inflammasomes activation. Additionally, we propose targeting mtDNA-mediated inflammatory pathways as a novel therapeutic approach for treating ALI/ARDS.

NOT ALL CELL-FREE MITOCHONDRIAL DNA IS EQUAL IN TRAUMA PATIENTS.

ABSTRACTMitochondrial DNA (mtDNA) acts as a proinflammatory damage-associated molecular pattern that stimulates innate immune activation via Toll-like receptor 9, similarly to bacterial DNA. A number of clinical studies have measured elevated cell-free mtDNA in the plasma of trauma patients, thought to originate from tissue injury and inflammatory processes; however, the magnitude of this increase, the absolute concentration, and the association with poor outcomes varies considerably across studies. Measurements of cell-free mtDNA in healthy individuals have shown that the majority of “cell-free” mtDNA (>95%) can be centrifuged/filtered from plasma in the size range of 0.45 to 5 μm, suggesting that there are larger forms of mtDNA-containing complexes in the plasma that could be considered cell-free. Whether this is true for trauma patients (and other relevant disease states) and the clinical relevance of the larger forms of mtDNA is unknown. These findings from healthy individuals also suggest that the centrifugation speeds used to generate cell-free plasma (which are rarely consistent among studies) could result in mixed populations of cell-free mtDNA that could confound associations with outcomes. We demonstrate in this study of 25 major trauma patients that the majority of the cell-free mtDNA in trauma patient plasma (>95%) is removed after centrifugation at 16,000g. Despite the larger forms of mtDNA being predominant, they do not correlate with outcomes or expected parameters such as injury/shock severity, multiple organ failure, and markers of inflammation, whereas low-molecular-weight cell-free mtDNA correlates strongly with these variables.

Circulating extracellular vesicles provide valuable protein, but not DNA, biomarkers in metastatic breast cancer

AbstractDetection of cell‐free circulating tumour DNA (ctDNA) and cancer‐specific extracellular vesicles (EVs) in patient blood have been widely explored as non‐invasive biomarkers for cancer detection and disease follow up. However, most of the protocols used to isolate EVs co‐isolate other components and the actual value of EV‐associated markers remain unclear. To determine the optimal source of clinically‐relevant circulating biomarkers in breast cancer, we applied a size exclusion chromatography (SEC) procedure to analyse separately the content in nucleic acids of EV‐enriched and EV‐depleted fractions, in comparison to total plasma. Both cellular and mitochondrial DNA (cellDNA and mtDNA) were detected in EV‐rich and EV‐poor fractions. Analysing specific mutations identified from tumour tissues, we detected tumour‐specific cellular alleles in all SEC fractions. However, quantification of ctDNA from total plasma was more sensitive than from any SEC fractions. On the other hand, mtDNA was preferentially enriched in EV fractions from healthy donor, whereas cancer patients displayed more abundant mtDNA in total plasma, and equally distributed in all fractions. In contrast to nucleic acids, using a Multiplexed bead‐based EV‐analysis assay, we identified three surface proteins enriched in EVs from metastatic breast cancer plasma, suggesting that a small set of EV surface molecules could provide a disease signature. Our findings provide evidence that the detection of DNA within total circulating EVs does not add value as compared to the whole plasma, at least in the metastatic breast cancer patients used here. However, analysis of a subtype of EV‐associated proteins may reliably identify cancer patients. These non‐invasive biomarkers represent a promising tool for cancer diagnosis and real‐time monitoring of treatment efficacy and these results will impact the development of therapeutic approaches using EVs as targets or biomarkers of cancer.

Mitochondrial DNA Profiling in A Cohort of Antiretroviral Treated HIV Patients in Lagos, Nigeria: Assessment of Long-Term Effects of cART on Life Quality of PLWH

The use of combined antiretroviral therapy (cART) has turned HIV infection to a manageable condition, significantly reducing HIV-related morbidity and mortality globally. Risk of transmission has been substantially reduced in Africa where 67% of global infection is domiciled. However, long-term impact of cART on life quality of HIV patients elicits concern due to possible oxidative stress stimulus and accumulated toxicity. Mitochondrion, responsible for molecular metabolism in eukaryotes has been proposed as a marker for cellular dysfunction and ageing. Metabolic dysfunction due to accumulated oxidative stress may lead to mitochondrial DNA (mtDNA) mutation, protein alteration, and premature apoptosis leading to ageing. A cohort study comprising of 302 HIV infected persons receiving cART (Tenofovir, Lamivudine, Dolutegravir; TLD) at NIMR HIV reference clinic, and 113 healthy controls. Venous blood was collected in vacutainer tubes and plasma isolated. DNA extraction was done using NIMR-Biotech DNA Extraction kit, and mtDNA levels measured using SYBRGreen dye-based quantitative real-time PCR assay on Quant Studio 5. Primer sequences from human 12S ribosomal RNA with CCACGGGAAACAGCAGTGAT and CTATTGACTTGGGTTAATCGTGTGA as forward and reverse sequences respectively were used to amplify mtDNA locus. Melting curve was performed for every run to confirm successful amplification of targeted region. Total DNA from an immortalized Hela cell line, diluted in 10-fold serial dilutions, was used as standard curve. Plasma mtDNA levels were evaluated and data analyzed using IBM SPSS software (version 24). Among HIV infected individuals, 185 (88.1%) were female and mean age was 32±0.43 years while 36 (32%) and 27±0.57 years were female and mean age among controls, respectively. Mean CD4 count among HIV subjects was 427±29 cells/µl while 62.4% had less than 50 viral copies/ml. Majority of subjects (74.9%) were on first line cART while mean exposure to ART regimens was 4±0.3 years. No significant difference was observed between mtDNA concentration of HIV subjects (mean = 256±38 copies/µl) and healthy controls (mean: 247±72 copies/µl), neither among only HIV subjects, when stratified based on viral load or CD4 count. No association was observed between cell free (cf)-mtDNA and cART exposure among HIV patients. Lack of baseline information on initial cf-mtDNA among Africans was challenging in establishing that new ART regimens had enhanced recovery from mitochondrial-DAMP. There is need to continuously assess prolonged effect of cART to ensure good quality of life and healthy ageing for people living with HIV (PLWH).

Racial Differences in XO (Xanthine Oxidase) and Mitochondrial DNA Damage-Associated Molecular Patterns in Resistant Hypertension.

We previously reported increased plasma XO (xanthine oxidase) activity in patients with resistant hypertension. Increased XO can cause mitochondrial DNA damage and promote release of fragments called mitochondrial DNA damage-associated molecular patterns (mtDNA DAMPs). Here, we report racial differences in XO activity and mtDNA DAMPs in Black and White adults with resistant hypertension. This retrospective study includes 91 resistant hypertension patients (44% Black, 47% female) with blood pressure >140/90 mm Hg on ≥4 medications and 37 normotensive controls (30% Black, 54% female) with plasma XO activity, mtDNA DAMPs, and magnetic resonance imaging of left ventricular morphology and function. Black-resistant hypertension patients were younger (mean age 52±10 versus 59±10 years; P=0.001), with higher XO activity and left ventricular wall thickness, and worse diastolic dysfunction than White resistant hypertension patients. Urinary sodium excretion (mg/24 hour per kg) was positively related to left ventricular end-diastolic volume (r=0.527, P=0.001) and left ventricular mass (r=0.394, P=0.02) among Black but not White resistant hypertension patients. Patients with resistant hypertension had increased mtDNA DAMPs versus controls (P<0.001), with Black mtDNA DAMPS greater than Whites (P<0.001). Transmission electron microscopy of skeletal muscle biopsies in resistant hypertension patients demonstrates mitochondria cristae lysis, myofibrillar loss, large lipid droplets, and glycogen accumulation. These data warrant a large study to examine the role of XO and mitochondrial mtDNA DAMPs in cardiac remodeling and heart failure in Black adults with resistant hypertension.

A Method for Evaluation of the Level of Circulating Mitochondrial DNA by ND1 and ND2 Genes.

The measurement of the level of mitochondrial DNA (mtDNA) in the blood is a difficult problem due to high variability of mitochondrial genes, deletions in the mitochondrial genome in some pathological conditions, different sources of mtDNA into the bloodstream (mtDNA from tissues, from blood cells, etc.). We designed primers and TaqMan probes for highly conserved regions of the ND1 and ND2 genes outside the mitochondrial deletions “hot zones”. For standardizing the technique, the true concentration of low-molecular-weight mtDNA was determined by real-time PCR for two targets: a fragment of the ND2 gene (122 bp) and the ND1 and ND2 genes (1198 bp). The sensitivity and specificity of the developed approach were verified on a DNA pool isolated from the blood plasma of healthy donors of various nationalities. The concentration of low-molecular-weight mtDNA in the blood plasma of two patients with COVID-19 was monitored over two weeks of inpatient treatment. A significant increase in the content of low-molecular-weight mtDNA was observed during the first 5 days after hospitalization, followed by a drop to the level of healthy donors. The developed technique makes it possible to assess the blood level of low-molecular-weight mtDNA regardless of the quality of sampling and makes it possible to standardize this biological marker in a wide range of infectious and non-infectious pathologies.

Extracellular Release of Mitochondrial DNA: Triggered by Cigarette Smoke and Detected in COPD.

Cigarette smoke (CS) is the most common risk factor for chronic obstructive pulmonary disease (COPD). The present study aimed to elucidate whether mtDNA is released upon CS exposure and is detected in the plasma of former smokers affected by COPD as a possible consequence of airway damage. We measured cell-free mtDNA (cf-mtDNA) and nuclear DNA (cf-nDNA) in COPD patient plasma and mouse serum with CS-induced emphysema. The plasma of patients with COPD and serum of mice with CS-induced emphysema showed increased cf-mtDNA levels. In cell culture, exposure to a sublethal dose of CSE decreased mitochondrial membrane potential, increased oxidative stress, dysregulated mitochondrial dynamics, and triggered mtDNA release in extracellular vesicles (EVs). Mitochondrial DNA release into EVs occurred concomitantly with increased expression of markers that associate with DNA damage responses, including DNase III, DNA-sensing receptors (cGAS and NLRP3), proinflammatory cytokines (IL-1β, IL-6, IL-8, IL-18, and CXCL2), and markers of senescence (p16 and p21); the majority of the responses are also triggered by cytosolic DNA delivery in vitro. Exposure to a lethal CSE dose preferentially induced mtDNA and nDNA release in the cell debris. Collectively, the results of this study associate markers of mitochondrial stress, inflammation, and senescence with mtDNA release induced by CSE exposure. Because high cf-mtDNA is detected in the plasma of COPD patients and serum of mice with emphysema, our findings support the future study of cf-mtDNA as a marker of mitochondrial stress in response to CS exposure and COPD pathology.

Detection of Mitochondrial DNA Copy Number in Plasma Exosomes of Patients with Non-small Cell Lung Cancer

For the prevalence of lung cancer and its poor diagnosis, the seeking of the efficient biomarkers for this disease is an urgent requirement, especially from non-invasive samples such as plasma. The mitochondria DNA (mtDNA) copy number change has been evaluated as a potential indicator of cancer risk, however, there have been few studies regarding mtDNA in plasma derived exosomes. In this study, the mtDNA copy number was measured on 29 plasma exosome samples of patients with non-small cell lung cancer (NSCLC) and 29 plasma exosome samples of cancer-free controls by real-time PCR assay, then being statistically analyzed to evaluate the relationship between these figures and several pathological features of NSCLC patients. As the results, the existence of mtDNA in exosomes isolated from plasma was detected through PCR assay using primers covering most of the mtDNA length. The relative mtDNA copy numbers determined in the exosomes of the disease and control groups were 1619.1 ± 2589.0 and 1207.0 ± 1550.0, respectively, whereas these values in two disease stages were 783.6 ± 759.3 (stage I-II) and 2647.0 ± 3584.0 (stage III-IV). Comparing among these groups, the difference was only statistically significant between the disease groups of stage I-II and stage III-IV (p&lt;0.05), the group of stage III-IV and the control group (p&lt;0.05). Indeed, the mtDNA copy number is associated with tumor stage and stage N (p&lt;0.05). On the other aspect, the smoking habit of NSCLC patients could be an underlying reason behind the alteration in mtDNA copy number in the plasma exosomes. In short, our study demonstrates that the mtDNA copy number in exosomes resourced from plasma could be a potential biomarker for the detection and prognosis of NSCLC.

Next-Generation Sequencing-Based Analysis of Urine Cell-Free mtDNA Reveals Aberrant Fragmentation and Mutation Profile in Cancer Patients.

Many studies have demonstrated the high efficacy of cell-free nuclear DNA in cancer diagnostics. Compared to nuclear DNA, mitochondrial DNA (mtDNA) exhibits distinct characteristics, including multiple copies per cell and higher mutation frequency. However, the potential applicability of cell-free mtDNA (cf-mtDNA) in plasma and urine remains poorly investigated. Here, we comprehensively analyzed the fragmentomic and mutational characteristics of cf-mtDNA in urine and plasma samples from controls and cancer patients using next-generation sequencing. Compared to plasma cf-mtDNA, urine cf-mtDNA exhibited increased copy numbers and wider spread in fragment size distributions. Based on 2 independent animal models, urine cf-mtDNA originated predominantly from local shedding and transrenal excretion. Further analysis indicated an enhanced fragmentation of urine cf-mtDNA in renal cell carcinoma (RCC) and colorectal cancer (CRC) patients. Using the mtDNA sequence of peripheral blood mononuclear cells for reference, the mutant fragments were shorter than wild-type fragments in urine cf-mtDNA. Size selection of short urine cf-mtDNA fragments (<150 bp) significantly enhanced the somatic mutation detection. Our data revealed remarkably different base proportions of fragment ends between urine and plasma cf-mtDNA that also were associated with fragment size. Moreover, both RCC and CRC patients exhibited significantly higher T-end and lower A-end proportions in urine cf-mtDNA than controls. By integrating the fragmentomic and mutational features of urine cf-mtDNA, our nomogram model exhibited a robust efficacy for cancer diagnosis. Our proof-of-concept findings revealed aberrant fragmentation and mutation profiles of urine cf-mtDNA in cancer patients that have diagnostic potential.

Effects of acute endurance exercise and exhaustive exercise on innate immune signals induced by mtDNA

Objective: Numerous studies have shown that mitochondrial DNA (mtDNA) can trigger innate immune signaling, and exercise can induce mitochondrial stress. Therefore, this study is aimed at investigating the influence of different types of acute exercise on the innate immune signaling triggered by mtDNA. Methods: Male C57BL/6 mice ( n = 18) were randomly and equally divided into three groups. They were control group, acute moderate-intensity endurance exercise group (AMIE), and 3-day exhaustive exercise group (EE) respectively. Mice were sacrificed immediately after exercise. The spleen, liver, and blood were taken for analysis. Results: The amount of mtDNA in the liver cytoplasm and plasma was significantly decreased after AMIE ( p &lt; .05). However, the amount of mtDNA in plasma was increased after EE (p &lt; .05). The mRNA expression of TFAM, and most TLR9 and cGAS/STING signaling pathway-related genes in the liver and spleen was markedly elevated, whereas the expression of those genes in leukocytes was reduced after AMIE. Furthermore, AMIE significantly decreased the protein expression of NLRP3 inflammasome in the liver ( p &lt; .05) and STING in spleen ( p &lt; .01). Also, AMIE and EE caused a drop in circulating IFN-β levels ( p &lt; .05). Conclusion: A single bout of moderate-intensity exercise reduces mtDNA-induced innate immune signaling and suppresses inflammatory responses by decreasing hepatic cytoplasmic and circulating mtDNA. However, repeated bouts of exhaustive exercise stimulate innate immune signaling by increasing levels of circulating mtDNA.

Association between oxidized nucleobases and mitochondrial DNA damage with long-term mortality in patients with sepsis

BackgroundSepsis not only leads to short-term mortality during hospitalization, but is also associated with increased mortality during long-term follow-up after hospital discharge. Metabolic stress during sepsis may cause oxidative damage to both nuclear and mitochondrial DNA (mtDNA) and RNA, which could affect long-term health and life span. Therefore, the aim of this study was to assess the association of sepsis with oxidized nucleobases and (mt)DNA damage and long-term all-cause mortality in septic patients. Methods91 patients with sepsis who visited the emergency department (ED) of the University Medical Center Groningen between August 2012 and June 2013 were included. Urine and plasma were collected during the ED visit. Septic patients were matched with 91 healthy controls. Death rate was obtained until June 2020.The degree of oxidation of DNA, RNA and free nucleobases were assessed in urine by mass-spectrometry. Lipid peroxidation was assessed in plasma using a TBAR assay. Additionally, plasma levels of mtDNA and damage to mtDNA were determined by qPCR. ResultsSepsis patients denoted higher levels of oxidated DNA, RNA, free nucleobases and lipid peroxidation than controls (all p < 0.01). Further, sepsis patients displayed an increase in plasma mtDNA with an increase in mtDNA damage compared to matched controls (p < 0.01). Kaplan meier survival analyses revealed that high degrees of RNA- and nucleobase oxidation were associated with higher long-term all-cause mortality after sepsis (p < 0.01 and p = 0.01 respectively). Of these two, high RNA oxidation was associated with long-term all-cause mortality, independent of adjustment for age, medical history and sepsis severity (HR 1.29 [(1.17–1.41, 95% CI] p < 0.01). ConclusionsSepsis is accompanied with oxidation of nuclear and mitochondrial DNA and RNA, where RNA oxidation is an independent predictor of long-term all-cause mortality. In addition, sepsis causes mtDNA damage and an increase in cell free mtDNA in plasma.

The level of free-circulating mtDNA in patients with radon-induced lung cancer

ObjectiveAccording to the World Health Organization, radon is the second leading cause of lung cancer after smoking. Cell free circulating mitochondrial DNA (cf mtDNA) have been used not only as a biomarker of carcinogenesis but also as a biomarker of exposure to radiation, but nothing is known about changes in the level of cf mtDNA following radon exposure. Therefore, the purpose of this study was to estimate the cf mtDNA copy number as a biomarker of the response to radon exposure in lung cancer pathogenesis. Methods207 subjects were examined including 41 radon-exposed lung cancer patients, 40 lung cancer patients without radon exposure and 126 healthy controls exposed/not exposed to high level of radon. Total cell free circulating DNA from blood samples was extracted and used to detect cell free circulating mitochondrial DNA copy number by quantitative real-time polymerase chain reaction (qRT-PCR). ResultsOur data indicate that the level of cf mtDNA in the radon-induced lung cancer patients was significantly higher than that of the other study participants. There was a significant difference in the level of cf mtDNA in the blood plasma of healthy volunteers exposed and not exposed to high doses of radon. Moreover, in healthy volunteers living in areas with high radon levels, the mtDNA copy number was higher than that in patients with lung cancer who were not exposed to high doses of radon. ConclusionOur study provides evidence for a possible role of cf mtDNA as a promising biomarker of lung cancer induced by exposure to high dose of radon.

Increased Mitochondrial DNA in an ECMO Model Is Associated with Loss of Platelet Function

BackgroundExtracorporeal Membrane Oxygenation (ECMO) represents a promising technology for resuscitating trauma patients with severe lung and/or cardiac injury. Common ECMO-related complications of thrombosis and bleeding result in significant rates of mortality and morbidity. Multiple studies with ex-vivo ECMO devices using blood demonstrate an increased proinflammatory response. Mitochondrial DNA (mtDNA) is a known damage associated molecular pattern (DAMP) that has been shown to have proinflammatory effects. Recent studies have correlated poor clinical outcomes to increased levels of plasma mtDNA. The objective of this study was to determine the levels of mtDNA in an ECMO model as a function of shear stress and duration of pump flow and evaluate the possible impact of mtDNA on platelet function.MethodsBlood was collected from healthy donors under a US Army Institute of Surgical Research approved standard operating procedure. We constructed an ex-vivo ECMO circuit that circulates heparinized human blood for six hours at differing flow rates (static control-0 L/min, 0.3, and 0.7 L/min). Quantification of mtDNA and assays of platelet function were performed on samples obtained from each group and were compared to static controls at 0, 60, 120, 240, and 360 min. mtDNA levels were assayed by measuring the copy number of the NADH dehydrogenase 1 gene using quantitative real-time PCR. Additional tests were performed on platelet count, aggregation, viability (as measured by calcein/CD41a), TEG, and Multiplate.ResultsIncreased flow rates and duration resulted in significantly higher levels of plasma mtDNA compared to static controls (static control, 0 L/min flow rate: 120 min = 3 x 105 ± 1.8 x 105, 240 min = 4 x 105 ± 2 x 105 copies/µL; 0.3 L/min flow rate: 0 min = 4 x 105 ± 0.8 x 105, 120 min = 8 x 105± 0.2 x 105, 240 min = 8 x 105 ± 1.6 x 105 copies/µL; 0.7 L/min flow rate: 0 min = 3 x 105 ± 0.9x 105, 120 min = 19 x 105± 4 x 105, 240 min = 35 x 105 ± 6 x 105 copies/µL; p < 0.001). Platelet count and viability were not significantly different. In contrast, both TEG platelet mapping and Multiplate demonstrated significant losses in ADP and collagen aggregation response (Multiplate at 120 min: static control 1564± 265, 0.3 L/min = 830 ± 474, 0.7 L/min = 1010 ± 261; 240 min: static control 874± 381, 0.3 L/min = 527 ± 384, 0.7 L/min = 405 ± 268; p < 0.01) when compared to static controls.ConclusionsIncreased mtDNA in surgical patients has been linked to poor outcomes. It has recently been shown that circulating mtDNA can trigger the innate immune system through toll-like receptor 9 (TLR9) and NF-κB activation, causing deleterious effects. In this study we found that mtDNA levels significantly increase as a function of shear stress and increased duration of pump flow. These increases were shown to be associated with loss in platelet function in both TEG and Multiplate measures of ADP and collagen agonist stimulated responses. Future ECMO studies will explore the correlation between circulating mtDNA levels and TLR9. mtDNA may be a clinically relevant biomarker and therapeutic target for efforts to mitigate life-threatening ECMO coagulation complications. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Increased levels of circulating cell-free mtDNA in plasma of late life depression subjects

BackgroundOxidative stress (OS) has been implicated in the pathophysiology of late-life depression (LLD). Mitochondria are the primary source of oxidative stress and can be significantly damaged with increased OS. Circulating cell-free mtDNA (ccf-mtDNA) is a marker of cellular stress and mitochondria damage triggered by oxidative stress. MethodsWe evaluated the plasma levels of ccf-mtDNA in between 32 LLD and 21 never-depressed participants. We also investigated the association between ccf-mtDNA and the severity of depressive episodes and cognition performance. ResultsWe found a higher ccf-mtDNA level in LLD cases compared with controls (t = −2.91, p = 0.005). Also, ccf-mtDNA was significantly correlated with the severity of depression (r = 0.42, p = 0.001). There was no significant correlation between ccf-mtDNA and measures of cognitive decline. LimitationsThe small sample size and cross-sectional design were the main limitations of this study. ConclusionOur results suggest that LLD is associated with elevated mitochondrial damage and cellular stress. If validated, the measurement of ccf-mtDNA in LLD can guide the development of novel treatments focused on cytoprotection and reduction of mitochondrial dysfunction for this condition.

Postoperative Rise of Circulating Mitochondrial DNA Is Associated with Inflammatory Response in Patients following Pancreaticoduodenectomy

Introduction: Accumulation of plasma mitochondrial DNA (mtDNA) following severe trauma has been shown to correlate with the development of systemic inflammatory response syndrome (SIRS) and may predict mortality. Our objective was to investigate the relationship between levels of circulatory mtDNA following pancreaticoduodenectomy (PD) and the postoperative course. Methods: Levels of plasma mtDNA were assessed by real-time PCR of the mitochondrial genes ND1 and COX3 in 23 consecutive patients who underwent PD 1 day prior to surgery, within 8 h after surgery, and on postoperative day (POD)1 and POD5. The abundance of mtDNA was assessed relative to preoperative levels and in relation to parameters reflecting the postoperative clinical course. Results: When pooled for all patients, the circulating mtDNA levels were significantly increased after surgery. However, while a significant (at least >2-fold and up to >20-fold) rise was noted in 11 patients, no change in mtDNA levels was noted in the other 12 following surgery. Postoperative rise in circulating mtDNA was associated with an increased rate of postoperative fever until day 5, decreased hemoglobin and albumin levels, and increased white blood cell counts. These patients also suffered from increased rates of delayed gastric emptying. No significant differences were demonstrated in other postoperative parameters. Conclusion: Circulating mtDNA surge is associated with an inflammatory response following PD and may potentially be used as an early marker for postoperative course. Studies of larger patient cohorts are warranted.

The cGAS-STING pathway connects mitochondrial damage to inflammation in burn-induced acute lung injury in rat

ObjectiveDamage associated molecular patterns (DAMPs) are pathological mediators linking local tissue damage to systemic inflammation in various diseases. Some DAMPs, such as mitochondrial DNA (mtDNA), can be recognized by the cytoplasmic cGAS protein to trigger the activation of the stimulator of interferon genes (STING)-dependent innate immune pathway responsible for infection or sterile inflammation. The objective of our study was to evaluate the association between circulating mtDNA and cGAS-STING pathway activation in mediating inflammation following burn injury. Methods48 adult Sprague-Dawley male rats were divided into eight groups (Sham, 2, 4, 8, 12, 24, 48, 72 h after burn injury). The animals underwent 40% total body surface area scald injury to produce a full-thickness burn. Plasma samples were collected via cardiac puncture under deep anesthesia. Tissues were harvested and placed in formalin, followed by paraffin embedment. Total plasma DNA was isolated followed by measurement of mtDNA using quantitative polymerase chain reaction. Haemotoxylin-Eosin stain and Western blot was used for lung histology and protein assays, respectively. Statistical analyses were performed using ANOVA and student’s t-test and represented as mean ± s.d. ResultsPlasma mtDNA trended upward at early time-points following burn injury with peak levels at 8 h after burn when compared to the control group (345 ± 83.4 copies/μl vs. 239 ± 43.1 copies/μl, p = 0.07) and followed a bell-shaped distribution. Lung slices from burned rats showed acute injury marked by increased inflammatory infiltrate, with the maximum changes seen at 24 h, accompanied with significant upregulation of neutrophil elastase (p = 0.04). Compared with sham animals, cGAS and STING protein levels in lung tissue were up-regulated at 4 and 8 h after burn (p = 0.03 and p < 0.001, respectively). ConclusionActivation of the cGAS-STING pathway by increased plasma mtDNA is an important pathway driving neutrophil infiltration in burn-induced acute lung injury in rats. A further understanding of the STING-mediated immunopathology in lung and other susceptible organs may be important for the development of novel therapies for burn injury.

Protective effects of farnesyltransferase inhibitor on sepsis-induced morphological aberrations of mitochondria in muscle and increased circulating mitochondrial DNA levels in mice

Sepsis remains a leading cause of mortality in critically ill patients and is characterized by multi-organ dysfunction. Mitochondrial damage has been proposed to be involved in the pathophysiology of sepsis. In addition to metabolic impairments resulting from mitochondrial dysfunction, mitochondrial DNA (mtDNA) causes systemic inflammation as a damage-associated molecular pattern when it is released to the circulation. Metabolic derangements in skeletal muscle are a major complication of sepsis and negatively affects clinical outcomes of septic patients. However, limited knowledge is available about sepsis-induced mitochondrial damage in skeletal muscle. Here, we show that sepsis induced profound abnormalities in cristae structure, rupture of the inner and outer membranes and enlargement of the mitochondria in mouse skeletal muscle in a time-dependent manner, which was associated with increased plasma mtDNA levels. Farnesyltransferase inhibitor, FTI-277, prevented sepsis-induced morphological aberrations of the mitochondria, and blocked the increased plasma mtDNA levels along with improved survival. These results indicate that protein farnesylation plays a role in sepsis-induced damage of the mitochondria in mouse skeletal muscle. Our findings suggest that mitochondrial disintegrity in skeletal muscle may contribute to elevated circulating mtDNA levels in sepsis.

Plasma mitochondrial DNA levels are associated with acute lung injury and mortality in septic patients

BackgroundMitochondrial DNA (mtDNA) is a critical activator of inflammation. Circulating mtDNA released causes lung injury in experimental models. We hypothesized that elevated plasma mtDNA levels are associated with acute lung injury (ALI) in septic patients.MethodsWe enrolled 66 patients with sepsis admitted to the Department of Critical Care Medicine of Peking Union Medical College Hospital between January 2019 and October 2019. Respiratory, hemodynamic and bedside echocardiographic parameters were recorded. Plasma mtDNA, procalcitonin, interleukin 6, and interleukin 8 levels were examined.ResultsPlasma mtDNA levels within 24 h after admission were significantly increased in the group of septic patients with ALI [5.01 (3.38–6.64) vs 4.13 (3.20–5.07) log copies/µL, p 0.0172]. mtDNA levels were independently associated with mortality (hazard ratio, 3.2052; 95% CI 1.1608–8.8500; p 0.0253) and ALI risk (odds ratio 2.7506; 95% CI 1.1647–6.4959; p 0.0210). Patients with high mtDNA levels had worse outcomes, and post hoc tests showed significant differences in 28-day survival rates. Increased mtDNA levels were seen in patients with abdominal infection.ConclusionsIncreased plasma mtDNA levels within 24 h after admission were significantly associated with ALI incidence and mortality in septic patients.

NGS-based accurate and efficient detection of circulating cell-free mitochondrial DNA in cancer patients

Mitochondrial DNA (mtDNA) mutations are closely implicated in the pathogenesis of multiple cancers, making circulating cell-free mtDNA (ccf-mtDNA) as a potential non-invasive tumor biomarker. However, an effective approach to comprehensively profile ccf-mtDNA mutations is still lacking. In this study, we first characterized ccf-mtDNA by low-depth whole-genome sequencing (WGS) and found that plasma DNA samples exhibited a dramatic decrease in mtDNA copy number when compared with fresh tumor tissues. Further analysis revealed that plasma ccf-mtDNA had a biased distribution of fragment size with a peak around 90 bp. Based on these insights, we developed a robust captured-based mtDNA deep-sequencing approach that enables accurate and efficient detection of plasma ccf-mtDNA mutations by systematic optimization of probe quantity and length, hybridization temperature, and PCR amplification cycles. Moreover, we found that placement of isolated plasma for 6 h at both 4°C and room temperature (RT) led to a dramatic decrease of ccf-mtDNA stability, highlighting the importance of proper plasma sample processing. We further showed that the optimized approach can successfully detect a substantial fraction of tumor-specific mtDNA mutations in plasma ccf-mtDNA specifically from hepatocellular carcinoma (HCC) patients but not from colorectal cancer (CRC) patients, suggesting the presence of a potential cancer-specific difference in the abundance of tumor-derived mtDNA in plasma.

Mitochondrial DNA in extracellular vesicles declines with age.

The mitochondrial free radical theory of aging suggests that accumulating oxidative damage to mitochondria and mitochondrial DNA (mtDNA) plays a central role in aging. Circulating cell‐free mtDNA (ccf‐mtDNA) isolated from blood may be a biomarker of disease. Extracellular vesicles (EVs) are small (30–400 nm), lipid‐bound vesicles capable of shuttling proteins, nucleic acids, and lipids as part of intercellular communication systems. Here, we report that a portion of ccf‐mtDNA in plasma is encapsulated in EVs. To address whether EV mtDNA levels change with human age, we analyzed mtDNA in EVs from individuals aged 30–64 years cross‐sectionally and longitudinally. EV mtDNA levels decreased with age. Furthermore, the maximal mitochondrial respiration of cultured cells was differentially affected by EVs from old and young donors. Our results suggest that plasma mtDNA is present in EVs, that the level of EV‐derived mtDNA is associated with age, and that EVs affect mitochondrial energetics in an EV age‐dependent manner.