mtDNA Cyt Research Articles

Genetic Signature of River Capture Imprinted in Schizopygopsis Fish from the Eastern Tibetan Plateau.

Some East Asian rivers experienced repeated rearrangements due to Indian-Asian Plates' collisions and an uplift of the Tibetan Plateau. For the upper Changjiang (Yangtze/Jinsha River), its ancient south-flowing course and subsequent capture by the middle Changjiang at the First Bend (FB) remained controversial. The DNA of freshwater fishes possess novel evolutionary signals of these tectonic events. In this study, mtDNA Cyt b sequences of endemic Schizopygopsis fish belonging to a highly specialized grade of the Schizothoracinae from the eastern Tibetan Plateau were used to infer the palaeo-drainages connectivity history of the upper Changjiang system. Through phylogenetic reconstruction, a new clade D of Schizopygopsis with three genetic clusters and subclusters (DI, DII, DIIIa, and DIIIb) were identified from the upper Yalong, Changjiang, and Yellow Rivers; the Shuiluo River; the FB-upper Changjiang; and the Litang River; respectively. Ancient drainage connections and capture signals were indicated based on these cladogenesis events and ancestral origin inference: (1) the upper Yalong River likely acted as a dispersal origin of Schizopygopsis fish to the adjacent upper Yellow and Changjiang Rivers at ca. 0.34 Ma; (2) the Litang River seemed to have directly drained into the upper Changjiang/Yangtze/Jinsha River before its capture by the Yalong River at ca. 0.90 Ma; (3) the Shuiluo River likely flowed south along a course parallel to the upper Changjiang before their connection through Hutiao Gorge; (4) a palaeo-lake across the contemporary Shuiluo, Litang, and Yalong Rivers was inferred to have served as an ancestral origin of clade D of Schizopygopsis at 1.56 Ma. Therefore, this study sheds light on disentangling ambiguous palaeo-drainage history through integrating biological and geological evidence.

Range-Wide Phylogeography and Ecological Niche Modeling Provide Insights into the Evolutionary History of the Mongolian Racerunner (Eremias argus) in Northeast Asia.

The Mongolian racerunner, Eremias argus, is a small lizard endemic to Northeast Asia that can serve as an excellent model for investigating how geography and past climate change have jointly influenced the evolution of biodiversity in this region. To elucidate the processes underlying its diversification and demography, we reconstructed the range-wide phylogeographic pattern and evolutionary trajectory, using phylogenetic, population genetic, landscape genetic, Bayesian phylogeographic reconstruction and ecological niche modeling approaches. Phylogenetic analyses of the mtDNA cyt b gene revealed eight lineages that were unbounded by geographic region. The genetic structure of E. argus was mainly determined by geographic distance. Divergence dating indicated that E. argus and E. brenchleyi diverged during the Mid-Pliocene Warm Period. E. argus was estimated to have coalesced at~0.4351 Ma (Marine Isotope Stage 19). Bayesian phylogeographic diffusion analysis revealed out-of-Inner Mongolia and rapid colonization events from the end of the Last Interglacial to the Last Glacial Maximum, which is consistent with the expanded suitable range of the Last Glacial Maximum. Pre-Last Glacial Maximum growth of population is presented for most lineages of E. argus. The Glacial Maximum contraction model and the previous multiple glacial refugia hypotheses are rejected. This may be due to an increase in the amount of climatically favorable habitats in Northeast Asia. Furthermore, E. argus barbouri most likely represents an invalid taxon. The present study is the first to report a range-wide phylogeography of reptiles over such a large region in Northeast Asia. Our results make a significant contribution towards understanding the biogeography of the entire Northeast Asia.

Deep mitochondrial phylogeographical pattern: cryptic population structure within an ecological niche in the near-threatened Himalayan vulture (Gyps himalayensis)

Abstract The Himalayan vulture (Gyps himalayensis) has higher environmental specificity than other species in the same genus, and its population has declined due to diclofenac exposure and shortage of carcasses as a food source. Previous analysis of mitochondrial (mt) DNA cytochrome b (Cyt b) sequences reported no distinct geographical population structure in the Himalayan vulture. Contradictory results were obtained in the present study, which investigated the population structure of 14 Himalayan vultures that migrated to Thailand during winter. Using samples obtained between 2010 and 2021, as well as limited GenBank samples, the study found that the Cyt b locus was incapable of distinguishing population structure. This dataset contrasted with the mtDNA control region (CR) and Cyt b + CR dataset, which divided them into two groups, as explained by the Middle–Late Pleistocene climate change scenario. The species split into populations from the central, western, and northern regions of its distribution range within the highland vulture ecological niche. This study reviews the different methods used as compared with previous proposals for defining guidelines for the conservation of this near-threatened scavenging species.

Genetic Variation in Catfish Family: Ariidae, Bagridae and Plotosidae of India Using MtDNA Cyt B Gene

Genetic Variation in Catfish Family: Ariidae, Bagridae and Plotosidae of India Using MtDNA Cyt B Gene

Phylogeography and demographic history of the cyprinid fish Barbodes semifasciolatus: implications for the history of landform changes in south mainland China, Hainan and Taiwan

Hainan Island and Taiwan Island are adjacent to the southern margin of mainland China and Vietnam. During glacial periods, global sea levels dropped, allowing that the land bridges connected the continental island and mainland, connecting rivers and providing dispersal opportunities that shaped the origin and diversification of freshwater fishes. Barbodes semifasciolatus is distributed in various water systems of Vietnam, Hainan, Taiwan, and southern mainland China and is restricted to the southern region of the Min River. Our study aimed to evaluate the genetic diversity and phylogeography of B. semifasciolatus using the mtDNA cyt b gene (1,141 bp). A total of 107 haplotypes were identified from 395 specimens in 23 populations, and high haplotype diversity (1.000) and low nucleotide diversity (0.0134) were detected. Mitochondrial phylogenetic analysis and haplotype network analyses revealed three major lineages according to geographical distribution. Lineage A was mainly distributed in Hainan Island, Vietnam and the southern region of the Pearl River in mainland China. Lineage B was distributed only in southeastern Hainan Island. Lineage C was distributed in the coastal rivers of mainland China and Taiwan. We suggest that the river in the Guangdong region is a colonization route in South Taiwan and that the populations distributed in the Pearl River region moved southward to Hainan Island and Vietnam based on the network and Bayesian binary MCMC (BBM) analysis. Our demographic history results indicated that the populations of B. semifasciolatus experienced a bottleneck event following a recent population expansion (DECINC model) supported by ABC analysis. We suggest that sea-level changes exerted pronounced effects on the demography of B. semifasciolatus on the continental island and in the mainland during the late Pleistocene glacial cycles.

Genetic diversity and relationship among Indonesian local sheep breeds on Java Island based on mitochondrial cytochrome b gene sequences

BackgroundThe cytochrome b (Cyt b) gene is one of the most studied mitochondrial DNA (mtDNA) genes to determine sheep’s genetic profile. This study aimed to determine the genetic diversity and relationships of several Indonesian local sheep populations on Java Island, Indonesia, based on the mtDNA Cyt b gene sequences. Blood samples were collected from forty-one individual sheep in seven populations of Indonesia local sheep breeds on Java Island (Priangan = 6, Garut = 6, Batur = 7, Wonosobo = 5, Javanese Thin-Tailed/JTT = 7, Javanese Fat-Tailed/JFT = 5, and Sapudi = 5). DNA extraction was performed on blood samples, and the mtDNA Cyt b gene was amplified using specific primers (Alek-CBF: 5’-CAACCCCACCACTTACAA-3’ and Alek-CBR: 5’-CCTTGAGTCTTAGGGAGGTT-3’). The polymerase chain reaction (PCR) products were then sequenced, and data were analyzed using the MEGA version 7.0, DNA SP version 6.0, and NTSYS-pc version 2.11 software. ResultsA total of 1140 bp complete mtDNA Cyt b gene sequences in this study obtained 1134 monomorphic sites (I), six polymorphic sites (V), one segregation site (S), and five parsimony informative sites (P) with a nucleotide diversity (Pi), the average number of nucleotide differences (K), and sequence conservation (SC) were 0.00119, 1.35610, and 0.9947, respectively. There were six haplotypes consisting of two unique haplotypes and four shared haplotypes with a haplotype diversity (Hd) of 0.5415. The genetic distance within and between populations ranged from 0.0000 to 0.0016 and 0.0000 to 0.0020, respectively. Wonosobo, JFT, and Sapudi sheep have the closest relationship, and then these three breeds were close to JTT sheep, followed by Batur, Priangan, and Garut sheep. Two haplogroups have been found based on the Ovine haplogroup clustering. All Wonosobo, JTT, JFT, Sapudi sheep, and most Batur sheep were clustered into haplogroup B. In contrast, Garut sheep were mostly clustered into haplogroup A, while Priangan sheep were clustered into both haplogroups with the same percentage. ConclusionSeven Indonesian local sheep breeds on Java Island have a close relationship clustered into two haplogroups, namely haplogroups A and B. Most Indonesian local sheep breeds on Java Island in this study were clustered into haplogroup B, except for Garut and Priangan sheep.

Mitochondrial DNA sequence analysis of Arabibarbus grypus (Heckel, 1843) living in Great Zab (Erbil, Iraq)

Arabibarbus grypus (Heckel, 1843), which naturally lives in the Euphrates and Tigris River systems and is endemic, is an economically important fish species consumed by humans. Since the population of this species, which is hunted by both fishermen and local peo-ple, is decreasing day by day, its genetic characteristics need to be determined. This study aims to determine the genetic characteristics of A. grypus samples living in Great Zab based on sequence analysis of mtDNA cyt b and mtDNA d loop gene regions. Total DNA isolation was performed from muscle tissue using the kit. Then, Polymerase Chain Reac-tion was applied through spe-cific primers to mtDNA cyt b and mtDNA d loop gene re-gions, and the target regions were amplified. The products with the target length were sent to the commercial firm and sequence analysis was per-formed. Regarding these spec-imens living in Great Zab, two haplotypes were determined for the mtDNA cyt b gene re-gion and five haplotypes for the mtDNA d loop gene re-gion. These haplotypes were compared with the haplotypes in the gene bank and the re-sults were evaluated. Some important data has been ob-tained regarding the conserva-tion and management of this fish species. Since three new haplotypes were detected for the d loop region in this stud-ied locality, it is important to include the samples in this lo-cality in conservation studies.

A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia

A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCA GAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to, R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.

MtDNA COI and Cyt b Analysis of Carassius auratus (Linnaeus, 1758) Species Living in Atatürk Dam Lake (Turkey)

Today, biological invasion is one of the leading threats to biodiversity and is an issue that is gaining more and more importance. In recent years, molecular techniques have been widely used in the identification and monitoring of invasive species in many parts of the world. This study aimed to detect the infested species, Carassius auratus, in Atatürk Dam Lake and to reveal the population status. For these purposes, 10 Carassius auratus specimens were randomly selected from Atatürk Dam Lake. After DNA isolation of the selected samples, mtDNA COI and cyt b gene regions were sequenced and analyzed. In this study, sequence analyzes of individuals belonging to the C. auratus species living in Atatürk Dam Lake were performed for the first time using mtDNA COI and cyt b markers. Analyzed sequence results were compared with databases and it was concluded that the results obtained for both mtDNA markers were compatible. No other variation was observed. When the results are evaluated as a whole, it is possible to say that this species has spread recently. In future studies, it is recommended to determine the invasive species populations that are intensely found in Atatürk Dam Lake and other lakes and to determine the necessary strategies to combat these invasive species

Multilocus Phylogeography and Population Genetic Analyses of Opsariichthys hainanensis Reveal Pleistocene Isolation Followed by High Gene Flow around the Gulf of Tonkin.

The ichthyofauna of continental islands is characterized by immigration through a land bridge due to fluctuating sea levels. Hainan Island is adjacent to the southern margin of mainland China and provides opportunities for understanding the origin and diversification of freshwater fishes. The aim of our study was to evaluate the level of genetic variation and phylogeographic structure of Opsariichthys hainanensis on Hainan Island and mainland China, using mtDNA cyt b gene (1140 bp) and D-loop (926 bp), nuclear RAG1 gene (1506 bp), and 12 microsatellite loci. Mitochondrial phylogenetic analysis identified five major lineages according to the geographical distribution from different populations. We suggested that two dispersal events occurred: the population in the Changhua River migrated to the Red River (Lineage B), and the populations in the South Hainan region moved northwards to the North Hainan region. However, populations in Northwest Hainan Island dispersed to the populations around the Gulf of Tonkin (Lineage A1) and populations in Northeast Hainan Island dispersed to the populations in mainland China (Lineage A2). Our results indicated that the populations of O. hainanensis suffered a bottleneck event followed by a recent population expansion supported by the ABC analysis. We suggest that O. hainanensis populations were found mostly in the lowlands and a lack of suitable freshwater habitat in southern mainland China and Hainan during the Last Interglacial period, and then expansion occurred during the Last Glacial Maximum.

Morphogenetic diversity of the selected hatchery populations of an Indian major carp (Labeo rohita, Hamilton, 1822) in the Mymensingh region of Bangladesh

Environmental changes due to the domestication of wild population in hatchery conditions often lead to morphogenetic alterations in fish. Therefore, this study aimed to determine the genetic purity, demographic history, and population structure of Labeo rohita collected from three hatcheries in Bangladesh using a geometric morphometric approach in conjunction with mtDNA cyt b gene sequences and microsatellite markers. The geometric morphometric analysis revealed significant variation in centroid size (body size) among the different populations of L. rohita. However, MANCOVA and subsequent ANCOVA models showed no significant variation in body shape (relative wraps, RWs) among those populations. Both DNA-based techniques amplified all genotypes and revealed a high degree of genetic diversity across all populations. Clustering analyses based on the Neighbour-Joining (NJ) phylogenetic approach found that the hatchery populations have indisputably diverged from the wild populations. The study of haplotype networks, neutrality testing, and mismatch distributions revealed a complex population expansion pattern involving genetic introgression resulting from human translocation. This tendency is exacerbated further by anthropogenic factors, resulting in the loss of various alleles from hatchery populations. The unevenness of pair-wise FST and the hierarchical analysis of molecular variance of population structure showed a distinct variation between wild and hatchery populations. This genetic loss occurs due to improper domestication processes of the hatchery populations. Ignorance of appropriate hatchery procedures may lead to adverse selection by using poor seed leading to stock deterioration in the hatchery population. This study could help to establish appropriate breeding strategies and provide essential information for the genetic improvement program of L. rohita.

A preliminary investigation of genetic diversity amongst Rusa timorensis in Tanjung Malim, Perak and Bilut Agro Farm, Pahang, Malaysia

A study on genetic diversity analysis was conducted on Rusa timorensis obtained from state of Perak and state of Pahang to investigate the level of genetic diversity occur and to compare the diversity amongst two R. timorensis breeders in Malaysia. A total of six (n=6) individual samples of R. timorensis were extracted from Tanjung Malim, Perak and Bilut Agro Farm, Pahang and amplified using mitochondria deoxyribonucleic acid (mtDNA) primers gene as a target molecular marker. The mtDNA region was amplified using a set of cytochrome b gene primers (5”AAACCAGAAAAGGAGAGCAAC3”;5”TCATCTAGGCATTTTCAGTGCC3”) and nucleotide sequence of the mtDNA cyt b was aligned by using MEGA Ver 7.0. The result indicated that the R. timorensis from Pahang has a low degree of variation (0.252) of genetic distance compared to, R. timorensis from Perak (0.696). The phylogenetic three analysis, indicated, R. timorensis from Pahang resulted the highest intra-specific relationship at 100% compared to , R. timorensis from Perak at 63% of intra-specific relationship. The results showed that the genetic diversity of, R. timorensis in Perak and Pahang is likely to decrease in the future. Therefore, future breeding program plan needs to be implemented to diversify the genetics of genus Rusa in Malaysia.

Temperature-Specific and Sex-Specific Fitness Effects of Sympatric Mitochondrial and Mito-Nuclear Variation in Drosophila obscura.

Simple SummaryDoes variation in the mitochondrial DNA sequence influence the survival and reproduction of an individual? What is the purpose of genetic variation of the mitochondrial DNA between individuals from the same population? As a simple laboratory model, Drosophila species can give us the answer to this question. Creating experimental lines with different combinations of mitochondrial and nuclear genomic DNA and testing how successful these lines were in surviving in different experimental set-ups enables us to deduce the effect that both genomes have on fitness. This study on D. obscura experimentally validates theoretical models that explain the persistence of mitochondrial DNA variation within populations. Our results shed light on the various mechanisms that maintain this type of variation. Finally, by conducting the experiments on two experimental temperatures, we have shown that environmental variations can support mitochondrial DNA variation within populations.The adaptive significance of sympatric mitochondrial (mtDNA) variation and the role of selective mechanisms that maintain it are debated to this day. Isofemale lines of Drosophila obscura collected from four populations were backcrossed within populations to construct experimental lines, with all combinations of mtDNA Cyt b haplotypes and nuclear genetic backgrounds (nuDNA). Individuals of both sexes from these lines were then subjected to four fitness assays (desiccation resistance, developmental time, egg-to-adult viability and sex ratio) on two experimental temperatures to examine the role of temperature fluctuations and sex-specific selection, as well as the part that interactions between the two genomes play in shaping mtDNA variation. The results varied across populations and fitness components. In the majority of comparisons, they show that sympatric mitochondrial variants affect fitness. However, their effect should be examined in light of interactions with nuDNA, as mito-nuclear genotype was even more influential on fitness across all components. We found both sex-specific and temperature-specific differences in mitochondrial and mito-nuclear genotype ranks in all fitness components. The effect of temperature-specific selection was found to be more prominent, especially in desiccation resistance. From the results of different components tested, we can also infer that temperature-specific mito-nuclear interactions rather than sex-specific selection on mito-nuclear genotypes have a more substantial role in preserving mtDNA variation in this model species.

Metacommunity structure reveals that temperature affects the landscape compositional patterns of avian malaria and related haemosporidian parasites across elevations

Metacommunity ecology studies how species compositional patterns and their distributions vary across local and regional scales and provides insights on processes driving the distribution of communities. Avian haemosporidians comprise a diverse and widely distributed parasite taxon; some studies have analyzed their alpha and beta diversity patterns. Yet, metacommunity structures of avian haemosporidians and thus relevant biotic and abiotic variables explaining such structures at the landscape scale (i.e., 10–200 km) have not been assessed. We studied the metacommunity structure of avian haemosporidian mtDNA cyt b lineages and the infected avian host assemblage across four different elevations in Central Veracruz, Mexico. We performed variation-partitioning analyses to evaluate the contribution of host-related traits and climatic variables to the metacommunity. We found a richness of 78 lineages within 38 infected species of birds. At the component community level, we observed that bird species infected with a lower number of parasite lineages (e.g., <3) represented a nested subset of those with a higher number of parasite lineages (e.g., >8) (i.e., nested structure). However, this nested pattern was due to the restricted spatiotemporal co-occurrence of hosts and parasites, given the high degree of turnover across elevations. Host-related traits (functional, transmission-associated, and phylogenetic relationships) only explained a small fraction of the variation (4.4%) in parasite lineage composition across avian hosts. At the habitat level, there was a group turnover by parasite genera across elevation (i.e., quasi-Clementsian structure), which was partly explained by climatic variables (mean annual temperature and annual diurnal range; 27.6%) that may constrain parasite reproduction and vector distribution across the environmental gradient. At the scale of our study, environmental conditions represented a more important driver of avian haemosporidian metacommunity structure than host-related traits, suggesting an important role of environmental filtering structuring parasite assemblages at the landscape level.

Phylogenetic prospecting for cryptic species of the genus Merluccius (Actinopterygii: Merlucciidae)

Hakes of the genus Merluccius include 11 valid species as well a number of rare morphotypes suspected to be “cryptic species”. Concatenated nucDNA ITS1-rDNA and mtDNA cyt b sequences plus nested ITS1Nes sequences allowed to ascribe 14 specimens of nine rare morphotypes from the South Pacific and the South Atlantic to the phylogenetic backbone of this genus. Bayesian analyses pointed to M. bilinearis and M. albidus as the oldest species of the genus and the New World cluster, respectively. The phylogenetic status of M. angustimanus from the upper Gulf of California suggests its hybrid origin between M. gayi and M. productus from about 0.25 MYA, although an ever since confinement of a subset of those species cannot be ruled out. The molecular phylodiagnostic test suggests a common origin of all rare morphotypes and the absence of cryptic hake species in the Southern Cone. The molecular background of the morphotypes distributed between the Western Pacific South of New Zealand and the western Atlantic South of Argentina is compatible with their hybrid origin between M. gayi and both, M. australis or M. hubbsi, respectively.

Mitochondrial dna diversity of crossbanded barb Puntioplites bulu (Bleeker, 1851) from natural populations in peninsular Malaysia

Puntoplites bulu is a freshwater Cyprinidae and widely distributed in Southeast Asia. It has attracted considerable interest due to high demand and price. However, an apparent decline in its distribution and abundance is observed and this is due to several factors, such as habitat degradation, pollution, and overfishing. Intraspecific variation of P.bulu from three major rivers in Peninsular Malaysia were determined based on genetic divergence by using mtDNA Cyt b. Two distinct genetic lineages were apparent viz Central West and East Peninsular Malaysia with natural barriers (the Titiwangsa Range) acted as natural dividers between these two lineages. Alternatively, the close genetic relation and haplotype sharing that were observed between Perak and Kelantan populations could be due to human translocations. Further, haplotype sharing between Kelantan and Pahang populations revealed the migration ability of P. bulu through ancient connectivity. These findings provide an important base study for initiating a selective breeding program

Determination of genetic variations by using mitochondrial DNA cyt b sequences in populations of Carasobarbus luteus (Cyprinidae)

As the human population increases, freshwater fish has become an important alternative source of protein to meet the need of protein. Especially numerous fish species from the family Cyprinidae are consumed by the people. Among these fish, Carasobarbus luteus (Heckel, 1843) is also one of the most preferred species thanks to its edible flesh as well as its low price. Since it is economically important, there has been the pressure of overfishing and invasive species on the populations of this species, resulting in decrease of the sources day by day. Management and conservation of the species have importance therefore it is need to know its genetic variations in the first place. The present study analyzed sequences of mtDNA cyt b locus and established the genetic variability following the collection of 65 individuals from five different localities in diverse river systems where C. luteus populations naturally inhabit. Sequence analysis revealed 13 polymorphic sites and 5 haplotypes. Birecik was the locality with the highest value in terms of both haplotype diversity and nucleotide diversity, Diyarbakır was the one with the lowest value. Tajima’s D and Fu’s Fs values were found to be statistically insignificant for all the localities. Population genetic diversity of this fish species was found to be low in terms of mtDNA cyt b marker. It is recommended to take measures to stop the loss of genetic diversity and to start conservation studies.

The Mitochondrial Markers Provide New Insights Into the Population Demographic History of Coilia nasus With Two Ecotypes (Anadromous and Freshwater)

The Pleistocene climate oscillations have been proven to have profound influences in the evolutionary processes of marine species and left significantly tractable footprints in genomes of marine fauna. However, such history remains unknown for the Japanese grenadier anchovy Coilia nasus, a relatively large fish found in marine, freshwater and brackish water. In order to provide insight into the phylogeographic pattern and historical demography of C. nasus, we employed the mtDNA D-loop and Cyt b as molecular markers to estimate the genetic variation among populations of C. nasus. We took samples from 18 populations throughout the distribution of C. nasus. Partial sequences of mtDNA D-loop (n = 424) and Cyt b (n = 129) were obtained. Four phylogeographic lineages were revealed by the mtDNA D-loop analysis. Frequency changes of the four lineages throughout the species’ distribution indicated limited genetic exchange among three major geographic regions. Patterns of isolation-by-distance were detected among the populations. Neutrality test, mismatch distribution, and network analyses consistently showed that all the four lineages had populations with relatively stable over time and then subjected to sudden expansion during the late-Pleistocene era (c. 20 000 – 75 000 years ago). The phylogeographic and demographic history of C. nasus was highly influenced by climatic fluctuations in the Pleistocene. Geographic isolation resulted from Pleistocene climatic fluctuations might have profound impacts on the distribution pattern of genetic variation of C. nasus. Our result also indicated that the population expansion event for C. nasus occured along with habitat continuous expansion during the inter-glacial period.

Cравнительный анализ нуклеотидной изменчивости гена cyt b мтДНК линя (Tinca tinca L.) в популяциях западной и восточной частей Евразии

Линь (Tinca tinca L.) – один из древнейших сохранившихся представителей семейства карповых (Cyprinidae) в водоёмах Евразии, выделяемый в отдельное монотипическое подсемейство Tincinae. Ранее были выявлены филогеографические группы, разделяющиеся на западные (Англия, Испания, Польша) и восточные (Болгария, Иран, Китай) популяции Евразии. Была поставлена задача установить, к какой филогруппе будут относиться популяции северо-восточной части России, в частности, Ярославской области, а также оценить максимальное правдоподобие нуклеотидных замещений по гену cyt b. Проведён сравнительный анализ полученных данных с данными по линю западной и восточной частей Евразии. Оказалось, что общее смещение транзиции/трансверсии в российских популяциях составляет R = 168,236, в западных популяциях – R = 488,667. В популяциях линя Рыбинского водохранилища в значительной степени трансзиции преобладают над трансверсиями. Это свидетельствует о высоком генетическом разнообразии, устойчивости и адаптационных характеристиках линя из Рыбинского водохранилища. В западных популяциях количество трансзиций и трансверсий по своим значениям близки, наблюдается небольшое преобладание трансзиций над трансверсиями. В основном западные популяции линя имеют не естественное, а искусственное происхождение, являясь результатом направленного антропогенного скрещивания. Соответственно значительно снижаются показатели устойчивости и адаптации, а также повышается риск возникновения вредных (летальных) спонтанных мутаций, которые могут быстро закрепиться и повлиять на состояние западных популяций линя. Это подтверждается коэффициентами скорости транзиции/трансверсии: в западных популяциях они практически одинаковы k1 = 985.029 (пурины) и k2 = 1000 (пиримидины), в российских популяциях коэффициенты скорости транзиции/трансверсии составляют k1 = 1000 (пурины) и k2 = 1 (пиримидины). Проведённый анализ подтверждает существование двух филогеографических групп, но в связи с недостатком данных по российским популяциям необходимо продолжение исследования, тем более, что российская (в частности ярославская) популяция занимает особое положение по соотношению транзиций и трансверсий. Tench (Tinca tinca L.) is one of the oldest surviving representatives of the cyprinid family (Cyprinidae) in water bodies of Eurasia distinguished into a separate monotypic subfamily Tincinae. Earlier phylogeographic groups were identified divided into western (England, Spain, Poland) and eastern (Bulgaria, Iran, China) populations of Eurasia. The task was to establish which phylogroup the populations of the northeastern part of Russia, in particular, the Yaroslavl region, would belong to, as well as to assess the maximum likelihood of nucleotide substitutions on the cyt b gene. A comparative analysis of the obtained data was carried out with data on the line of the western and eastern parts of Eurasia. It turned out that the total displacement of transition / transversion in Russian populations is R = 168.236, in western populations – R = 488.667. In the tench populations of the Rybinsk reservoir, to a large extent, transitions prevail over transversions. This indicates a high genetic diversity, resistance and adaptive characteristics of tench from the Rybinsk Reservoir. In western populations the number of transitions and transversions are close in their values, there is a small predominance of transitions over transversions. Basically, the western populations of tench are not of natural but artificial origin, being a result of directed anthropogenic crossing. Accordingly, the indicators of resistance and adaptation are significantly reduced and the risk of harmful (lethal) spontaneous mutations which can quickly gain a foothold and affect the state of western tench populations increases. This is confirmed by the coefficients of the rate of transition / transversion: in western populations they are practically the same k1 = 985.029 (purines) and k2 = 1000 (pyrimidines), in Russian populations the rates of transition / transversion are k1 = 1000 (purines) and k2 = 1 (pyrimidines). The performed analysis confirms the existence of two phylogeographic groups, but due to the lack of data on Russian populations, it is necessary to continue the research especially since the Russian (in particular Yaroslavl) population occupies a special position in terms of the ratio of transitions and transversions.

Leishmania infection and blood sources analysis in Phlebotomus chinensis (Diptera: Psychodidae) along extension region of the loess plateau, China

BackgroundVisceral leishmaniasis (VL) was one of the most important parasitic diseases in China, caused by Leishmania protozoans and transmitted by sand flies. Recently VL cases have reappeared in China, including the extension region of the Loess Plateau. The purpose of this study was to collect fundamental data on the host-vector VL system in the Loess Plateau to assist in the development of prevention and control measures.MethodsSand flies were collected by light traps from rural areas in Shanxian, Henan, China in 2015, as well as in Wuxiang and Yangquan, Shanxi, China in 2017. The blood sources of sand flies were analyzed by PCR detecting the host-specific mitochondrial cytochrome b (mtDNA cyt b) gene fragments. Leishmania infection in sand flies was detected by amplifying and sequencing ribosomal DNA internal transcribed spacer 1 (ITS1). The Leishmania specific antibodies in the sera of local dogs were detected by ELISA kit.ResultsBlood sources showed diversity in the extension region of the Loess Plateau, including human, chicken, dog, cattle, pig and goat. Multiple blood sources within a sand fly were observed in samples from Yangquan (17/118, 14.4%) and Wuxiang (12/108, 11.1%). Leishmania DNA was detected in sand flies collected from Yangquan with minimum infection rate of 1.00%. The ITS1 sequences were conserved with the Leishmania donovani complex. The positive rate of Leishmania specific antibodies in dogs was 5.97%.ConclusionsThis study detected the blood sources and Leishmania parasites infection of sand flies by molecular methods in the extension region of Loess Plateau, China. A high epidemic risk of leishmaniasis is currently indicated by the results as the infection of Leishmania in sand flies, the extensive blood sources of sand flies including humans, and positive antibody of Leishmania in local dog sera. Given the recent increase of VL cases, asymptomatic patients, dogs and other potential infected animals should be screened and treated. Furthermore, the density of sand flies needs to be controlled and personal protection should be strengthened.