MT-ND1 Gene Research Articles

M.3685T > C is a novel mitochondrial DNA variant that causes Leigh syndrome.

Variants in the mitochondrial genome can result in dysfunction of Complex I within the electron transport chain, thus causing disruptions in oxidative phosphorylation. Pathogenic variants in the MT-ND1 (NADH:ubiquinone oxidoreductase core subunit 1) gene that result in Complex I dysfunction are a known cause of Leigh syndrome. The patient is a 4-yr-old female who initially presented with generalized tonic–clonic seizures, with other symptoms of Leigh syndrome becoming apparent after the seizures. A three-generation pedigree revealed no family history of mitochondrial disorders. Laboratory studies were remarkable for elevated blood lactate, alanine, and GDF15. T2-weighted magnetic resonance imaging (MRI) revealed bilateral asymmetric signal hyperintensities in the basal ganglia, specifically in the bilateral putamen and right caudate. Magnetic resonance spectroscopy showed regionally elevated glucose and lactate. Mitochondrial respiratory chain enzyme analysis on skin fibroblasts demonstrated slightly reduced Complex I function. A 16-gene dystonia panel and chromosomal microarray analysis did not identify any disease-causing variants. Combined exome and mitochondrial genome sequencing identified the m.3685T > C (MT-ND1 p.Tyr127His) variant with 62.3% heteroplasmy with no alternative cause for the patient's condition. Mitochondrial genome sequencing of the mother demonstrated that the m.3685T > C variant occurred de novo. The m.3685T > C variant is absent from population databases. The tyrosine 127 residue is highly conserved, and several nearby pathogenic variants in the MT-ND1 gene have been previously associated with Leigh syndrome. We propose that the m.3685T > C variant is a novel mitochondrial DNA variant that causes Leigh syndrome, and we classify this variant as likely pathogenic based on currently available information.

Single-Cell Transcriptome Analysis of Chronic Antibody-Mediated Rejection After Renal Transplantation.

Renal transplantation is currently the most effective treatment for end-stage renal disease. However, chronic antibody-mediated rejection (cABMR) remains a serious obstacle for the long-term survival of patients with renal transplantation and a problem to be solved. At present, the role and mechanism underlying immune factors such as T- and B- cell subsets in cABMR after renal transplantation remain unclear. In this study, single-cell RNA sequencing (scRNA-seq) of peripheral blood monocytes (PBMCs) from cABMR and control subjects was performed to define the transcriptomic landscape at single-cell resolution. A comprehensive scRNA-seq analysis was performed. The results indicated that most cell types in the cABMR patients exhibited an intense interferon response and release of proinflammatory cytokines. In addition, we found that the expression of MT-ND6, CXCL8, NFKBIA, NFKBIZ, and other genes were up-regulated in T- and B-cells and these genes were associated with pro-inflammatory response and immune regulation. Western blot and qRT-PCR experiments also confirmed the up-regulated expression of these genes in cABMR. GO and KEGG enrichment analyses indicated that the overexpressed genes in T- and B-cells were mainly enriched in inflammatory pathways, including the TNF, IL-17, and Toll-like receptor signaling pathways. Additionally, MAPK and NF-κB signaling pathways were also involved in the occurrence and development of cABMR. This is consistent with the experimental results of Western blot. Trajectory analysis assembled the T-cell subsets into three differentiation paths with distinctive phenotypic and functional prog rams. CD8 effector T cells and γδ T cells showed three different differentiation trajectories, while CD8_MAI T cells and naive T cells primarily had two differentiation trajectories. Cell-cell interaction analysis revealed strong T/B cells and neutrophils activation in cABMR. Thus, the study offers new insight into pathogenesis and may have implications for the identification of novel therapeutic targets for cABMR.

REM-Sleep Deprivation Induces Mitochondrial Biogenesis in the Rat Hippocampus

Sleep loss is proposed as a trigger for manic episodes in bipolar disorder in humans. It has been shown that sleep and wakefulness can affect changes in mitochondrial gene expression, oxidative phosphorylation (OXPHOS) activity, and morphology in the brain. In this study, we investigated alterations in mitochondrial bioenergetic function in the brain of rats after 72-h rapid eye movement sleep deprivation (REM-SD). Alterations in the mitochondrial DNA (mtDNA) copy number were detected in the prefrontal cortex and hippocampus through amplification of mitochondrially encoded NADH dehydrogenase 1 (mt-Nd1) gene using quantitative real-time polymerase chain reaction. The expression levels of mitochondrial biogenesis-related proteins such as peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PPARGC1A), cytochrome c oxidase subunit 4I1 (COX4I1) and sirtuin 3 (SIRT3) were assessed using western blot analysis and immunohistochemistry. We found that REM-SD significantly increased the mtDNA copy number in the hippocampus but not in the prefrontal cortex. In addition, REM-SD increased the protein expression of COX4I1 in the hippocampus. Furthermore, we observed manic-like behaviors in rats exposed to 72-h REM-SD. REM-SD increased locomotion in the open-field test and the time spent in open arms in the elevated plus-maze test. REM-SD may induce mitochondrial dysfunction in the brain, which may be involved in the induction of mania.

Mitochondrial Genome Study Identifies Association Between Primary Open-Angle Glaucoma and Variants in MT-CYB, MT-ND4 Genes and Haplogroups

Background and purpose: Primary open-angle glaucoma (POAG) is an optic neuropathy characterized by death of retinal ganglion cells and atrophy of the optic nerve head. The susceptibility of the optic nerve to damage has been shown to be mediated by mitochondrial dysfunction. In this study, we aimed to determine a possible association between mitochondrial SNPs or haplogroups and POAG. Methods: Mitochondrial DNA single nucleotide polymorphisms (mtSNPs) were genotyped using the Illumina Infinium Global Screening Array-24 (GSA) 700K array set. Genetic analyses were performed in a POAG case-control study involving the cohorts, Groningen Longitudinal Glaucoma Study-Lifelines Cohort Study and Amsterdam Glaucoma Study, including 721 patients and 1951 controls in total. We excluded samples not passing quality control for nuclear genotypes and samples with low call rate for mitochondrial variation. The mitochondrial variants were analyzed both as SNPs and haplogroups. These were determined with the bioinformatics software HaploGrep, and logistic regression analysis was used for the association, as well as for SNPs. Results: Meta-analysis of the results from both cohorts revealed a significant association between POAG and the allele A of rs2853496 [odds ratio (OR) = 0.64; p = 0.006] within the MT-ND4 gene, and for the T allele of rs35788393 (OR = 0.75; p = 0.041) located in the MT-CYB gene. In the mitochondrial haplogroup analysis, the most significant p-value was reached by haplogroup K (p = 1.2 × 10−05), which increases the risk of POAG with an OR of 5.8 (95% CI 2.7–13.1). Conclusion: We identified an association between POAG and polymorphisms in the mitochondrial genes MT-ND4 (rs2853496) and MT-CYB (rs35788393), and with haplogroup K. The present study provides further evidence that mitochondrial genome variations are implicated in POAG. Further genetic and functional studies are required to substantiate the association between mitochondrial gene polymorphisms and POAG and to define the pathophysiological mechanisms of mitochondrial dysfunction in glaucoma.

Movement of Mitochondria with Mutant DNA through Extracellular Vesicles Helps Cancer Cells Acquire Chemoresistance.

Triple negative breast cancer (TNBC) is one of the most aggressive subtypes of breast cancer with the worst prognosis after chemo- or radiation therapy. This is mainly due to the development of cancer chemoresistance accompanied by tumor recurrence. In this work, we investigated a new mechanism of acquired chemoresistance of TNBC cells. We showed that extracellular vehicles (EVs) of chemoresistant TNBC cells can transfer mitochondria to sensitive cancer cells, thus increasing their chemoresistance. Such transfer, but with less efficiency, can be carried out over short distances using tunneling nanotubes. In addition, we showed that exosome fractions carrying mitochondria from resistant TNBC cells contribute to acquired chemoresistance by increasing mtDNA levels with mutations in the mtND4 gene responsible for tumorigenesis. Blocking mitochondrial transport by exosome inhibitors, including GW4869, reduced acquired TNBC chemoresistance. These results could lead to the identification of new molecular targets necessary for more effective treatment of this type of cancer.

Whole Mitochondrial Genome Analysis in Turkish Patients with Mitochondrial Diseases

Background:Mitochondrial diseases are a clinically heterogeneous group of rare hereditary disorders that are defined by a genetic defect predominantly affecting mitochondrial oxidative phosphorylation. Mitochondrial diseases are caused by mutations of genes encoded by either nuclear DNA or mitochondrial DNA. Hundreds of different mitochondrial DNA point mutations and large-scale mitochondrial DNA rearrangements have been shown to cause mitochondrial diseases including Kearns–Sayre syndrome, Leber’s hereditary optic neuropathy, Leigh syndrome, myoclonic epilepsy with ragged-red fibers, mitochondrial encephalopathy lactic acidosis stroke.Aims:To investigate new variants that could be associated with mitochondrial diseases and to determine the effect of mitochondrial DNA mutations on the clinical spectrum.Study Design:Cross-sectional study.Methods:We screened whole mitochondrial DNA genome using next-generation sequencing in 16 patients who are considered to have mitochondrial disease. CentoGene and Mikrogen Genetic Diseases Diagnostic Center’s database were used to investigate sequence variants. Detected variants were evaluated in bioinformatic databases to determine pathogenicity and were classified as class 1 (pathogenic), class 2 (likely pathogenic), and class 3 (variant of uncertain significance) according to CentoGene-ACMG database.Results:As a result of the study, 2 patients were diagnosed with Leigh syndrome as previously reported class 1 mutations in MT-ATP6 and MT-ND5 genes. Four variants were identified for the first time in literature and 2 variants, previously reported but with uncertain pathogenic effect, are thought to be associated with mitochondrial disease.Conclusion:Mitochondrial DNA screening should be among the primary clinical tests in patients with suspected mitochondrial disease to rule out DNA-associated mutations.

Migratory Rolandic Encephalopathy Caused by the Mitochondrial ND3 Variant.

An 18-year-old woman was admitted to the hospital with focal seizures. Serial MRI studies showed migratory rolandic lesions (Figure, A–D) and the EEG showed sharp waves when the lesion appeared. The initial differential diagnosis included cerebral venous thrombosis, myelin oligodendrocyte glycoprotein antibody-associated disease, and metabolic disorders. Magnetic resonance venography, serum, and CSF analyses were unrevealing. An analysis of the entire mtDNA of urine sediment by next-generation sequencing showed a pathogenic m.10191T>C variant in the mt-ND3 gene (degree of heteroplasmy, 87%). Further analysis revealed the m.10191T>C variant was heteroplasmic in blood (24%) and oral mucosal (86%) cells. This case illustrates that m.10191T>C variant may present with migratory rolandic encephalopathy.1

P–217 The mitochondrial DNA copy number of cumulus granulosa cells is associated with the symmetry of cleavage embryo but not blastocyst quality

Abstract Study question To study the relationship between mitochondrial DNA copy number of cumulus granulosa cells (CGCs-mtDNA) and the quality of early embryos. Summary answer CGCs-mtDNA was related to the symmetry of cleavage. However, CGCs-mtDNA was not associated with fertilization, blastocysts quality, or blastocysts euploidy. What is known already The potential of early embryonic development mainly depends on the quality of oocytes to a large extent. Mitochondria of CGCs are directly involved in the establishment of oocytes capacitation during oocytes maturation and development. Study design, size, duration This is a retrospective study from December 2018 to January 2019, involving a total of 283 CGCs surrounding Metaphase II oocytes from 49 patients who underwent preimplantation genetic testing for aneuploidy (PGT-A) at the Reproductive and Genetic Hospital of CITIC-Xiangya. Participants/materials, setting, methods We used the TaqMan probes to quantitatively detect mitochondrial DNA copy number of per CGCs by quantitative PCR in mitochondrial genes (MT-ND1 and MT-CO1) and a nuclear gene (β-globin). Besides, according to the nature of the dependent variable, the binary logistic regression model and the logistic regression analysis model of ordered multi-classification were used for multivariate statistical analysis. Main results and the role of chance The CGCs-mtDNA corresponding to fertilized eggs was not different from that of unfertilized eggs in MT-ND1 gene and MT-CO1 gene (MT-ND1: fertilized vs. unfertilized, 600±337 vs. 604±367, P = 0.593; MT-CO1: fertilized vs. unfertilized, 1336±531 vs. 1329±478, P = 0.938). Interestingly, we found that the CGCs-mtDNA of D3 embryos with good quality was statistically higher than that of D3 embryos with fair or poor quality for MT-ND1 gene and MT-CO1 gene (MT-ND1: good quality vs. fair/poor quality, 803±627 vs. 587±307, P = 0.028; MT-CO1: good quality vs. fair/poor quality, 1682±554 vs. 1374±702, P = 0.025). Moreover, the CGCs-mtDNA corresponding to D3 embryos with even cleavage was higher than that of D3 embryos with uneven cleavage (MT-ND1: even cleavage vs. uneven cleavage, 803±627 vs. 590±309, P = 0.036; MT-CO1: even cleavage vs. uneven cleavage, 1562±552 vs. 1316±525, P = 0.037). Besides, we investigated the difference among the CGCs-mtDNA in blastocysts with the good quality, blastocysts with fair or poor quality, and the developmental blocked embryos before the blastocyst stage. But we didn’t found any difference among the above three groups (MT-ND1: P = 0.531; MT-CO1: P = 0.609). In the study of the relationship between CGCs-mtDNA and blastocysts euploidy, we got similar results (MT-ND1: P = 0.602; MT-CO1: P = 0.570). Limitations, reasons for caution The sample size of this study was relatively small. Wider implications of the findings: Although the sample size of this study is limited, our results indicated the importance of mitochondria in CGCs in early embryo development, especially in the first three days. The investigation of mitochondrial function in CGCs may shed light on the mechanism of CGCs-oocyte crosstalk. Trial registration number LL-SC–2019–005

P–542 Relationship between the single nucleotides polymorphisms in Mitochondrial Nicotinamide Adenine Dinucleotide Hydride dehydrogenase (NADH) Subunit 4 gene (MT-ND4) and male infertility

Abstract Study question Is there any association between male infertility and the polymorphic variants of Mitochondrial Nicotinamide Adenine Dinucleotide Hydride dehydrogenase (NADH) Subunit 4 (MT-ND4)? Summary answer Our findings suggested that male infertility was correlated to rs2853495 and rs869096886 SNPs in MTND4. What is known already The rate of mutations in the mtDNA, the powerhouse of the cell, is high due to the lack of histones and DNA repair mechanisms. Therefore, mutations that occur in the mitochondrial genome, play a major role in some human genetic disorders. 15 - 30% of male infertility are related to genetic predisposition. Sperm containing defective mitochondria cannot effectively produce ATP and more likely to produce reactive oxygen species (ROS) and free radicals, thereby causing a defect in mtDNA, make trouble energy, and deteriorate motility and fertility. Study design, size, duration: A prospective study carried out between 2018 and 2019. 112 semen samples were collected in this study. Participants/materials, setting, methods The present study was carried out at the department of Obstetrics and Gynecology, University of Saarland, Germany. Samples were divided into 68 subfertile and 44 fertile men. Mitochondrial DNA was extracted using a QIAamp DNA Mini Kit, after that the mtDNA was amplified by using REPLI-g Mitochondrial DNA Kit. Polymerase chain reaction (PCR) was used to amplify MT-ND4 gene. Then, samples were purified and sequenced using the Sanger method in the Microsynth Seq lab, Germany. Main results and the role of chance The genotypes frequencies of the study population showed a statistically significant association between rs2853495 G>A (Gly320Gly) and male infertility (P = 0.0351). Similarly, the allele frequency test showed that rs2853495 G>A (Gly320Gly) and rs869096886 A>G (Leu164Leu) were significantly associated with male infertility (adjusted OR = 2.616, 95% CI = 1.374 - 4.983, P = 0.0028; adjusted OR = 2.237, 95% CI = 1.245 - 4.017, P = 0.0073, respectively). On the other hand, no statistically significant difference was observed between the asthenozoospermia, oligozoospermia, teratozoospermia, asthenoteratozoospermia, oligoasthenoteratozoospermia, oligoteratozoospermia subgroups of subfertile males and the fertile ones. Limitations, reasons for caution The size number of the study samples. Wider implications of the findings: A larger prospective study will be required to confirm these associations of mitochondrial gene polymorphisms rs2853495 and rs869096886 in MT-ND4 and male infertility and to clarify the definite effect of the mitochondrial genetic variations on male infertility. Trial registration number Not applicable

The relevance of mitochondrial DNA variants fluctuation during reprogramming and neuronal differentiation of human iPSCs.

SummaryThe generation of inducible pluripotent stem cells (iPSCs) is a revolutionary technique allowing production of pluripotent patient-specific cell lines used for disease modeling, drug screening, and cell therapy. Integrity of nuclear DNA (nDNA) is mandatory to allow iPSCs utilization, while quality control of mitochondrial DNA (mtDNA) is rarely included in the iPSCs validation process. In this study, we performed mtDNA deep sequencing during the transition from parental fibroblasts to reprogrammed iPSC and to differentiated neuronal precursor cells (NPCs) obtained from controls and patients affected by mitochondrial disorders. At each step, mtDNA variants, including those potentially pathogenic, fluctuate between emerging and disappearing, and some having functional implications. We strongly recommend including mtDNA analysis as an unavoidable assay to obtain fully certified usable iPSCs and NPCs.

The Origin and Functional Impact of Mitochondrial DNA Mutations in Acute Myeloid Leukemia

Recent whole-genome sequencing studies have identified somatic mutations in the mitochondrial genome of several human malignancies including acute myeloid leukemia (AML). Although mitochondrial DNA (mtDNA) mutations have previously been shown to promote tumorigenicity in some solid cancers, their role in AML development is unknown. To address this issue, we traced the origin of mtDNA mutations in primary human AML samples and determined their potential impact on mitochondrial respiration and cell fate decisions in hematopoietic stem and progenitor cells (HSPCs).We first characterized the spectrum of mtDNA mutations in AML by performing hybrid capture-based next generation sequencing of the 13 protein-coding mtDNA genes in 133 AML patient samples collected at the time of diagnosis. We also sequenced 150 recurrently mutated nuclear genes in parallel. We aligned mtDNA sequences to the revised Cambridge Reference Sequence and identified variants with > 5% variant allele frequency. Since matched normal samples were not available, we filtered out variants with a population frequency of > 0.1% in GenBank to enrich for somatic variants. Of the remaining variants, we filtered out ones that were synonymous or caused an amino acid change at a non-conserved residue to enrich for pathogenic mutations. Based on these criteria, we identified 87 different missense mutations in 39% (n=53) of the patients across 12 of the 13 genes. We did not find any hot spot mutations. Interestingly, mtDNA mutations were mutually exclusive with IDH1 R132 mutations (p < 0.05, Chi-square test). Patients with mtDNA mutations had inferior leukemia-free survival compared to those without mtDNA mutations (134 vs 477 days; p = 0.002, Log-rank test).To trace the origin of these mutations, we developed allele-specific TaqMan assays for 9 of the primary AML samples with known mtDNA mutations. The TaqMan assays were sufficiently sensitive to quantify heteroplasmy at the single cell level. Patient-specific mtDNA mutations were detected in single cells sorted from the hematopoietic stem cell (HSC) compartment (defined as CD45dim/CD33-/CD34+/CD38-/CD90+/CD45RA-) in 8 of the 9 samples. The heteroplasmy levels were generally lower in HSCs than leukemic blasts. Interestingly, mtDNA mutations were also detected at low levels in the T cell compartment of 3 of the 8 samples. Analysis of a matched diagnostic/relapsed pair showed persistence of the mtDNA mutation in HSCs and leukemic blasts. These findings collectively indicate that mtDNA mutations are acquired in HSCs and stable during disease evolution.To investigate the potential impact of mtDNA mutations on mitochondrial respiration, we generated a pair of transmitochondrial cybrids by repopulating mtDNA-depleted 143B osteosarcoma cells with mitochondria from either KG-1α AML cells or peripheral blood cells of a healthy donor. KG-1α cells harbor a nonsense mtDNA mutation (C13396T) in the MT-ND5 gene which encodes a core subunit of Complex I in the electron transport chain (ETC). The KG-1α cybrid had lower levels of basal and maximal respiration compared with the healthy control cybrid as determined by oxygen consumption rates. To confirm that this defect was due to impairment of Complex I activity, we ectopically expressed the yeast NADH dehydrogenase (NDI1) protein which bypasses endogenous Complex I function. NDI1 expression completely rescued the mitochondrial respiration defect in KG-1α cybrids, whereas expression of the AOX protein which bypasses Complex II and III failed to do so. To determine the potential impact of Complex I dysfunction on cell fate decisions in HSPCs, we transduced human CD34+ cord blood cells with shRNA lentiviral vectors targeting the nuclear genes NDUFV1 and NDUFB11 which encode critical subunits of Complex I. Knockdown of the genes resulted in an accumulation of CD34+ cells in ex vivo culture over time.In summary, our results demonstrate that mtDNA mutations are commonly found in AML patients and have potential impact on clinical outcomes. The acquisition these mutations appears to be an early event in AML leukemogenesis. Finally, we showed that mtDNA mutations can negatively impact ETC function which we speculate, may in turn drive clonal hematopoiesis by promoting self-renewal and blocking differentiation of HSCs. DisclosuresNo relevant conflicts of interest to declare.

Lack of association between single polymorphic variants of the mitochondrial nicotinamide adenine dinucleotide dehydrogenase 3, and 4L (MT-ND3 and MT-ND4L) and male infertility.

Male infertility is a multifactorial condition associated with different genetic abnormalities in at least 15%-30% of cases. The purpose of this study was to identify suspected correlations between infertility and polymorphisms in mitochondrial NADH dehydrogenase subunits 3 and 4L (MT-ND3 and MT-ND4L) in subfertile male spermatozoa. Sanger sequencing of the mitochondrial DNA target genes was performed on 68 subfertile and 44 fertile males. Eight single nucleotide polymorphisms (SNPs) in MT-ND3 (rs2853826, rs28435660, rs193302927, rs28358278, rs41467651, rs3899188, rs28358277 and rs28673954) and seven SNPs in MT-ND4L (rs28358280, rs28358281, rs28358279, rs2853487, rs2853488, rs193302933 and rs28532881) were detected and genotyped. The genotypes and allele frequencies of the study population have shown a lack of statistically significant association between MT-ND3 and MT-ND4L SNPs and male infertility. However, no statistically significant association was found between the asthenozoospermia, oligozoospermia, teratozoospermia, asthenoteratozoospermia, oligoasthenoteratozoospermia and oligoteratozoospermia subgroups of subfertile males. However, rs28358278 genotype of the MT-ND3 gene was reported in the subfertile group but not in the fertile group, which implies a possible role of this SNP in male infertility. In conclusion, the investigated polymorphic variants in the MT-ND3 and MT-ND4L genes did not show any significant association with the occurrence of male infertility. Further studies are required to evaluate these findings. Moreover, the subfertile individuals who exhibit a polymorphism at rs28358278 require further monitoring and evaluation.

A high mutation load of m.14597A>G in MT-ND6 causes Leigh syndrome

Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder associated with mitochondrial deficiency. m.14597A>G (p.Ile26Thr) in the MT-ND6 gene was reported to cause Leberʼs hereditary optic neuropathy (LHON) or dementia/dysarthria. In previous reports, less than 90% heteroplasmy was shown to result in adult-onset disease. Here, by whole mitochondrial sequencing, we identified m.14597A>G mutation of a patient with LS. PCR–RFLP analysis on fibroblasts from the patient revealed a high mutation load (> 90% heteroplasmy). We performed functional assays using cybrid cell models generated by fusing mtDNA-less rho0 HeLa cells with enucleated cells from patient fibroblasts carrying the m.14597A>G variant. Cybrid cell lines bearing the m.14597A>G variant exhibited severe effects on mitochondrial complex I activity. Additionally, impairment of cell proliferation, decreased ATP production and reduced oxygen consumption rate were observed in the cybrid cell lines bearing the m.14597A>G variant when the cells were metabolically stressed in medium containing galactose, indicating mitochondrial respiratory chain defects. These results suggest that a high mutation load of m.14597A>G leads to LS via a mitochondrial complex I defect, rather than LHON or dementia/dysarthria.

MELAS/LS Overlap Syndrome Associated With Mitochondrial DNA Mutations: Clinical, Genetic, and Radiological Studies.

Introduction: Mitochondrial diseases are characterized by considerable clinical and genetic heterogeneity. Mitochondrial encephalomyopathy with lactate acidosis and stroke-like episodes (MELAS) and Leigh syndrome (LS) are both established mitochondrial syndromes; sometimes they can overlap.Methods: A retrospective observational cohort study was done to analyze the clinical manifestations, biochemical findings, neuroimaging and genetic data, and disease outcomes of 14 patients with identified MELAS/LS overlap syndrome.Results: A total of 14 patients, 9 males and 5 females, were enrolled. The median age at onset was 14 years, while the average age was 12.6 years. As for clinical features in concordance with MELAS, the top three most common symptoms were seizures, cognitive impairment, and stroke-like episodes (SLE). Brain atrophy was present in seven patients. As for the clinical hallmarks of LS, the top three most common symptoms were ataxia, spastic paraplegia, and bulbar palsy. Patients presented with individual syndrome or overlap syndromes with similar frequency, and the prognosis did not seem to be related to the initial presentation. Thirteen patients were identified with MTND mutations, among which m.13513G>A mutation in the MT-ND5 gene was the most common. Only one patient with m.8344A>G mutation of MTTK gene was found.Discussion: Our study demonstrated that MTND genes are important mutation hot spots in MELAS/LS overlap syndrome. The follow-up is very important for the final diagnosis of overlap syndrome.

Mitochondrial nicotinamide adenine dinucleotide hydride dehydrogenase (NADH) subunit 4 (MTND4) polymorphisms and their association with male infertility

PurposeThe purpose of the present study was to determine the relationship between infertility and the polymorphisms of mitochondrial NADH dehydrogenase subunit 4 (MTND4) by spermatozoa analysis in fertile and subfertile men.MethodsSamples were divided into 68 subfertile men (case group) and 44 fertile men (control group). After semen analysis, samples were purified. The whole genome was extracted using a QIAamp DNA Mini Kit and the mitochondrial DNA was amplified by using the REPLI-g Mitochondrial DNA Kit. Polymerase chain reaction (PCR) was used to amplify the MT-ND4 gene. Then, samples were purified and sequenced using the Sanger method.ResultsTwenty-five single-nucleotide polymorphisms (SNPs) were identified in the MTND4 gene. The genotype frequencies of the study population showed a statistically significant association between rs2853495 G>A (Gly320Gly) and male infertility (P = 0.0351). Similarly, the allele frequency test showed that rs2853495 G>A (Gly320Gly) and rs869096886 A>G (Leu164Leu) were significantly associated with male infertility (adjusted OR = 2.616, 95% CI = 1.374–4.983, P = 0.002; adjusted OR = 2.237, 95% CI = 1.245–4.017, P = 0.007, respectively).ConclusionIn conclusion, our findings suggested that male infertility was correlated with rs2853495 and rs869096886 SNPs in MTND4.

The association between multiple risk factors, clinical correlations and molecular insights in Parkinson’s disease patients from Tamil Nadu population, India

Parkinson’s disease (PD) is a neurodegenerative disease with multifactorial aetiology that influences the quality of life. However, the association of possible factors with PD is need to be investigated in Indian population, hence we aimed to determine the association of lifestyle, environmental factors, biochemical parameters and genetic insights of MT-ND1 gene in PD patients. Using a standardised questionnaire, PD patients and control group of about 146 subjects were interviewed on demographic, lifestyle and environmental factors. The subjects includes n = 73 Parkinson’s patients [juvenile (n = 4); early-onset (n = 8); late-onset (n = 61)] with equal number of age and sex matched controls, further we had obtained institutional ethical clearance and informed consent from study participants. Biomarker investigations and MT-ND1 alterations were investigated by appropriate molecular techniques. During the average follow-up years of 5.1, significant association was observed among smoking, alcohol, caffeinated drinks, surgery, pesticide exposure at p < 0.05 in varied PD age groups. Occupational exposure to agriculture and industry showed an increased risk among the late-onset group. The biomarkers uric acid (UA) and dopamine (DA) were significant at p < 0.05 in all the three PD age groups. The MT-ND1 alteration with A3843 G variant was significant at p < 0.05 for AG allele in all the three PD groups but the highest prevalence was observed in late-onset group. From our study, smoking, alcohol, caffeinated drinks, occupational influence of agriculture and industry and pesticide exposure had more association with PD occurrence. Hence, to the best of our knowledge, this is the first kind of study in Tamil Nadu population, India to validate the various factors with PD. Therefore we suggest that further research is mandatory to detect other possible associations among PD, using comprehensive larger sample size.

Advances in Diagnosis of Mitochondrial Diseases: Case Report of an Infant with Pearson Syndrome

Pearson syndrome (PS) is a mitochondrial disorder that presents in early infancy as a multisystemic disease affecting the bone marrow and pancreas. It may present with anemia, diarrhea, exocrine pancreatic dysfunction, and failure to thrive.[1] Delay in diagnosis can lead to severe morbidity and mortality in infancy. We report the case of a 9-month-old presenting with failure to thrive, severe macrocytic anemia and pancytopenia initially thought to have gastroesophageal reflux and feeding intolerance. Severe macrocytic anemia and pancytopenia prompted an early bone marrow evaluation. Abnormal bone marrow findings including vacuolated marrow precursors and ringed sideroblasts along with persistent mild lactic acidosis led to a rapid and extensive genetics workup. Whole exome sequencing including mitochondrial genome sequencing detected a 2.3 kb heteroplasmic deletion in m.12113_14421 encompassing the MT-ND5 gene consistent with the diagnosis of Pearson Syndrome. This case report highlights the advances in molecular genetic testing to diagnose patients with complex medical histories along the spectrum of mitochondrial diseases and the importance of early diagnosis to start treatment.

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P&amp;lt;0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

The prevalence of cercarial infection and development of a duplex PCR for detection of the cercarial stage of Haplorchis taichui and H. pumilio in first intermediate hosts from Chai Nat province, Thailand

This study aimed to investigate the prevalence of cercarial infections in freshwater snails collected from the Chai Nat province of Central Thailand. Moreover, we aimed to develop a duplex PCR technique, using the ITS2 and candidate MT-ND1 gene, to determine the dissemination of H. taichui and H. pumilio, respectively. Six types of cercariae were discovered with an overall prevalence of 4.71% (59/1,252). The parapleurolophocercous cercariae were demonstrated to be the dominant type, infecting only Melanoides tuberculata snails. The duplex PCR was optimized for specific amplification of ITS2 for H. taichui (115 bp) and MT-ND1 for H. pumilio (335 bp). Both specific primers confirmed the specificity of the duplex PCR reaction, with no cross-reactivity with other heterophyids or related species. In addition, this duplex PCR could be used to detect co-infection at a concentration of 3.0 ng/µL. For the molecular identification, 9 of 22 parapleurolophocercous cercaria specimens in Chai Nat province generated the specific DNA fragment of H. pumilio. These results proved that the MT-ND1 gene is a species-specific method for heterophyid detection and provides a rapid method for identification based on larval and adult stages of H. taichui and H. pumilio in their intermediate and/or definitive hosts in the infected area.

Molecular Inferences on Scomberomorus brasiliensis, From the Western South Atlantic, Based on Two Mitochondrial Genes

The Serra Spanish Mackerel, Scomberomorus brasiliensis is one of the principal fishery resources found in the tropical and subtropical waters of the western South Atlantic. Declining catches of S. brasiliensis off the coast of northeastern Brazil indicate that this species is being overfished. Despite the importance of this species to local fisheries, few data are available on its genetic diversity or population parameters. Given this scenario, the present study evaluated the genetic variability of S. brasiliensis off the coast of the western South Atlantic, based on mitochondrial genes. We compiled two databases, one with partial sequences of the MT-CYB gene (N =105), and the other of the MT-ND4 gene of the Serra Spanish Mackerel, sampled from eight localities, ranging from Cumana in Venezuela to Paranagua, in soutern Brazil. The results of the analysis indicate low levels of genetic diversity in the study. Samples from Cumana, on the coast of Venezuela were the most differentiated, although the results of the AMOVA were not significant. The PhiST values, the genetic divergence, and the haplotype network all indicate the widespread sharing of haplotypes by the mackerel from all the different localities. Analyses of the historical demography, based on both markers, indicate the occurrence of past population expansion, coinciding with fluctuations in sea level that occurred 10,000 years ago. The demographic and phylogeographic analyses of the mitochondrial DNA revealed the existence of a single genetic stock of S. brasiliensis on the coast of the western South Atlantic according to. These findings are fundamental to the development of effective conservation strategies.