SREBP-1c mRNA Levels Research Articles

S1836 Glucagon Like Peptide 1 (GLP-1) Attenuates Hepatic Steatosis in Nonalcoholic Steatohepatitis in Diabetic Mice

Background and aims: Metabolic syndrome-related NASH is one of the emerging healththreatening problems in industrialized countries worldwide. Despite of numerous experimental/clinical challenges, therapeutic strategies for NASH have not been well established. In this study, we investigated the therapeutic effect of ursolic acid, a pentacyclic triterpene acid, on high-fat diet (HFD)-induced steatohepatitis in obese, diabetic KK-Ay mice.Methods: Male, 8-week old KK-Aymice were fed a diet containing 32% fat for 4 weeks, and subsequently given daily intra-gastric injections of UA (100 mg/kg BW, suspended in 0.5% metyl-cellulose solution) or vehicle alone in combination with continuous HFD-feeding for up to 4 weeks. Liver histology was assessed by H-E staining. Serum aminotransferases and tissue triglyceride levels were determined colorimetrically by standard enzymatic methods. Steady state mRNA levels for SREBP-1c, fatty acid synthase (FAS), enoyl-CoA hydratase (ECHD) and acyl-CoA oxidase 1 (ACOX1) in the liver were analyzed quantitatively by real-time RT-PCR. Results: All KK-Ay mice gained body weight constantly during 4-week pre-feeding period, and the control mice continued gaining body weight over 10% during the subsequent 4-week treatment period; however, mice given UA lost body weight nearly 7% (P<0.001 vs. control group) despite of the equivalent dietary consumption. Except for body weight loss, mice treated with UA appeared to be healthy. KK-Ay mice developed remarkable steatohepatitis following 4-week pre-feeding with HFD as expected; however, treatment with UA dramatically improved liver pathology within 1 week, and the effect was sustained for 4-week treatment period. Indeed, serum transaminases levels, as well as hepatic triglyceride contents, were decreased significantly in mice treated with UA. Interestingly, mice treated with UA showed significantly decreased expression of hepatic SREBP-1c and FAS mRNA levels, indicating that fatty acid synthesis is down-regulated by UA. Further, hepatic mRNA levels of β-oxidation enzymes such as ECHD and ACOX1 were also significantly lower in UAtreated mice.Conclusions: These findings clearly demonstrated that ursolic acid significantly improves HFD-induced severe steatohepatitis in KK-Ay mice without dietary restriction. The mechanisms underlying this therapeutic effect of UA most likely involve decreased fatty acid synthesis and radical-generating β-oxidation in the liver. Since this chemical is an active ingredient of herbal medicine, it is postulated that UA is useful for a new preventive/ therapeutic reagent for NASH.

S1834 An Atherogenic Diet Induces Steatohepatitis in Mice

Background and aims: Metabolic syndrome-related NASH is one of the emerging healththreatening problems in industrialized countries worldwide. Despite of numerous experimental/clinical challenges, therapeutic strategies for NASH have not been well established. In this study, we investigated the therapeutic effect of ursolic acid, a pentacyclic triterpene acid, on high-fat diet (HFD)-induced steatohepatitis in obese, diabetic KK-Ay mice.Methods: Male, 8-week old KK-Aymice were fed a diet containing 32% fat for 4 weeks, and subsequently given daily intra-gastric injections of UA (100 mg/kg BW, suspended in 0.5% metyl-cellulose solution) or vehicle alone in combination with continuous HFD-feeding for up to 4 weeks. Liver histology was assessed by H-E staining. Serum aminotransferases and tissue triglyceride levels were determined colorimetrically by standard enzymatic methods. Steady state mRNA levels for SREBP-1c, fatty acid synthase (FAS), enoyl-CoA hydratase (ECHD) and acyl-CoA oxidase 1 (ACOX1) in the liver were analyzed quantitatively by real-time RT-PCR. Results: All KK-Ay mice gained body weight constantly during 4-week pre-feeding period, and the control mice continued gaining body weight over 10% during the subsequent 4-week treatment period; however, mice given UA lost body weight nearly 7% (P<0.001 vs. control group) despite of the equivalent dietary consumption. Except for body weight loss, mice treated with UA appeared to be healthy. KK-Ay mice developed remarkable steatohepatitis following 4-week pre-feeding with HFD as expected; however, treatment with UA dramatically improved liver pathology within 1 week, and the effect was sustained for 4-week treatment period. Indeed, serum transaminases levels, as well as hepatic triglyceride contents, were decreased significantly in mice treated with UA. Interestingly, mice treated with UA showed significantly decreased expression of hepatic SREBP-1c and FAS mRNA levels, indicating that fatty acid synthesis is down-regulated by UA. Further, hepatic mRNA levels of β-oxidation enzymes such as ECHD and ACOX1 were also significantly lower in UAtreated mice.Conclusions: These findings clearly demonstrated that ursolic acid significantly improves HFD-induced severe steatohepatitis in KK-Ay mice without dietary restriction. The mechanisms underlying this therapeutic effect of UA most likely involve decreased fatty acid synthesis and radical-generating β-oxidation in the liver. Since this chemical is an active ingredient of herbal medicine, it is postulated that UA is useful for a new preventive/ therapeutic reagent for NASH.

787 A PROSPECTIVE RANDOMISED TRIAL TO COMPARE THE EFFICACY OF CORTICOSTEROIDS PLUS PENTOXIFYLLINE VERSUS CORTICOSTEROIDS ALONE IN THE TREATMENT OF SEVERE ALCOHOLIC HEPATITIS

of steatosis. Little is known, however, on the role of LXRs in the development of hepatic steatosis in chronic HCV infection. Aim: To evaluate in an in vitro model of hepatitis C the effect of HCV NS5A and core proteins and the viral replication in the intracellular lipid accumulation and the LXR-related metabolic target gene expression. Methods: Human hepatocyte-derived cell lines Chang Liver and Huh7 were used. CHL-NS5A and CHL-core were generated by stable transfection of CHL cells with pcDNA3.1-NS5A and pEFcore expression vectors, respectively. Huh7 cells expressing full length genotype 1b HCV replicons (G1) were also established. The lipid content was determined by flow cytometry using Nile Red. LXRalpha, SREBP-1c, SREBP-2, PPAR-gamma and FAS gene expression was measured by real time PCR. Results: We found that CHL-NS5A and CHL-core exhibited an increase of lipid accumulation compared to CHL cells (+245% and +107%, respectively). Moreover mRNA levels of LXRalpha, SREBP-1c, SREBP-2, PPAR-gamma and FAS were significantly increased when NS5A and core proteins were expressed (CHL-NS5A: +356%, +232%, +196%, +7800% and +101%, respectively; CHL-core: +33%, +28%, +22%, +817% and +53%, respectively) compared to CHL. Replication of HCV in G1 cells induced intracellular lipid accumulation (+190%) associated with a significant increase in the mRNA levels of LXRalpha (+14%), SREBP-1c (+65%), SREBP-2 (+44%) and PPARgamma (+131%) compared to Huh7 cells. Conclusions: In our experimental HCV in vitro model, viral replication illustrates a significant induction in the lipogenic LXR-related downstream target genes and in the intracellular overaccumulation of lipids; this could be partially leaded by the expression of HCV NS5A and core proteins. These findings may suggest a key role of LXRa in the lipid metabolic factors associated with HCV. Supported by G/467B01/64000/3, BFU2007–62977 and SAN673/ LE06/08, Conserjeria de Sanidad, JCyL. CIBERehd is funded by Instituto de Salud Carlos III (Spain).

Lipogenesis in arterial wall and vascular smooth muscle cells of Psammomys obesus: Its regulation and abnormalities in diabetes

Aim Lipogenesis is expressed in vascular smooth muscle cells (VSMCs), and such in situ lipogenesis could be providing the fatty acids for triglyceride synthesis and cholesterol esterification, and contributing to lipid accumulation in the arterial wall. This study investigated both the expression and regulation of lipogenesis in VSMCs to determine if they are modified in Psammomys obesus gerbils fed a high-fat diet as a model of insulin resistance and diabetes. Methods Aortas were collected from diabetic and non-diabetic P. obesus for histological examination, measurement of lipogenic gene expression and VSMC culture. Results The aortas of diabetic animals exhibited lipid deposits and foam cells as well as disorganization of elastic fibres. However, lipogenic gene expression was not modified. VSMCs in vitro from the aortas of diabetic animals had, compared with cells from non-diabetic animals, lower mRNA levels of SREBP-1c and ChREBP. An adipogenic medium stimulated moderate FAS and ACC1 expression in cells from both diabetic and non-diabetic animals, but glucose and insulin on their own had no such stimulatory action. Also, triiodothyronine (T3) had a clear stimulatory action, while angiotensin II had a moderate effect, in cells from non-diabetic P. obesus, but not from diabetic animals, whereas LXR agonists stimulated lipogenesis in cells from both animal groups. Conclusion Lipogenesis is expressed in the arterial walls and VSMCs of P. obesus. However, its expression was not increased in diabetes, and did not respond to either T3 or angiotensin II. Therefore, lipogenesis in situ is unlikely to contribute to the accumulation of lipids in the arterial walls of diabetic P. obesus gerbils.

Tryptase promotes human monocyte-derived macrophage foam cell formation by suppressing LXRα activation

Accumulated mast cells in atherosclerotic plaques secrete a high level of tryptase that may participate in the pathogenesis of atherosclerotic disease by diverse pathways. However, the role of tryptase in the lipid metabolism of macrophages remains to be defined. In the present study, we found that the addition of tryptase into THP-1-derived macrophages increased both intracellular lipid accumulation and total cholesterol level. Tryptase promoting foam cell formation was also observed by transmission electron microscope. These effects were resisted by APC366, a selective inhibitor of mast cell tryptase. Tryptase dramatically resisted 22RHC induced activation of LXRα protein expression, which can be reversed by SAM-11 (a PAR-2-specific neutralizing antibody) and reduced LXRα, ABCG1, ABCA1 and SREBP-1c mRNA levels and ABCG1 protein level, which were all blocked by APC366. PAR-2 agonist also redeemed 22RHC stimulation to activate LXRα, ABCG1 protein expression, and mRNA levels of LXRα and its target genes in both THP-1-derived macrophages and primary human monocyte-derived macrophages. In primary macrophages that were first transfected with PAR-2 siRNA and then treated with tryptase, both the ABCG1 protein level and mRNA levels of LXRα and ABCG1 were higher than those in the control siRNA-treated cells. Taken together, our data clarified the PAR-2 expression of human macrophages and suggested that tryptase might promote lipid accumulation in macrophages and foam cell formation by suppressing LXRα activation via PAR-2/LXRα/LXRα target genes signaling pathway. This investigation sheds a new light on the role of tryptase in foam cell formation and pathogenesis of atherosclerosis.

Elevation of tumor necrosis factor-α induces the overproduction of postprandial intestinal apolipoprotein B48-containing very low-density lipoprotein particles: evidence for related gene expression of inflammatory, insulin and lipoprotein signaling in enterocytes

The aim of this study was to determine whether systemic elevation of tumor necrosis factor (TNF)-alpha induces intestinal-derived apolipoprotein B (apoB)48-containing very low-density lipoprotein (VLDL) production in hamsters after fat loading and whether TNF-alpha disturbs the related mRNA expression in inflammatory, insulin and lipoprotein signaling pathways in primary enterocytes. In vivo TNF-alpha and Triton-WR1339 infusion, Western blotting and reverse transcriptase-polymerase chain reaction were combined to explore the mechanisms underlying intestinal overproduction of apoB48-containing chylomicrons and VLDL(1) particles by TNF-alpha. TNF-alpha infusion increased intestinal production of chylomicron and VLDL(1)-apoB48 in postprandial (fat load) states. Following TNF-alpha-treatment in enterocytes, there was enhanced gene expression of Il1alpha and beta, Il6 and Tnf and decreased mRNA levels of components of the insulin signaling pathway including the insulin receptor (Ir), Ir substrate-1 and 2, PI3 k, and Akt, but increased phosphatase and tensin homolog deleted on chromosome ten (Pten) protein and mRNA expression. TNF-alpha also induced Cd36 and peroxisome proliferators-activated receptor (Ppar)gamma expression, as well as microsomal triglyceride transfer protein (Mtp) protein and mRNA, but suppressed the sterol regulatory element binding protein (Srebp)1c protein and mRNA level. Systemic elevation of TNF-alpha stimulates the postprandial overproduction of apoB48-containing chylomicrons and VLDL(1) particles by disturbing intestinal gene expression of the inflammatory, insulin and lipoprotein pathways. These findings provide mechanistic links among the inflammatory factor, TNF-alpha, intestinal inflammatory/insulin insensitivity and the overproduction of intestinal apoB48-containing lipoproteins.

Hepatic lipid metabolism response to dietary fatty acids is differently modulated by PPARα in male and female mice

In human beings, women are at lower risk of cardiovascular diseases, and respond differently from men to dietary fatty acids. The aim of the present study was to investigate (i) the influence of gender on the response of lipid metabolism to dietary n-3 PUFA, and (ii) the contribution of PPARalpha to this response. Male and female mice, wild-type (WT) and PPARalpha-null (KO), were fed on diets rich in either saturated FA (SFA) or 18:3 n-3 (ALA). Lipid composition, mRNA levels and certain activities of key enzymes and major transcription factors were determined in the liver. WT mice were slightly affected by dietary FA. However, in WT female mice, but not in males, mRNA levels of PPARalpha-dependent genes (L-FABP, ACO) were higher in the mice fed on the ALA-rich diet. When compared to WT mice, KO female mice exhibited a decreased lipogenesis capacity (40% lower FAS, ACC, and SREBP-1c mRNA level), whereas KO males showed a decrease in peroxisomal beta-oxidation (activity and expression of ACO reduced by 20 and 40%, respectively). When compared to SFA-fed KO mice, steatosis was twice lower in KO mice fed on ALA, despite the absence of dietary effect on plasma TG, CPT1 and ACO activities, or ACC and FAS expression. Besides, in mice on the SFA diet, steatosis was alleviated in females, and CPT1 expression was up-regulated to a higher extent in females than in males (2.7- and 3.6-fold, respectively, as compared to the corresponding WT groups). Our data suggests estrogen to modulate the regulation of hepatic lipid metabolic pathway by dietary fatty acids. Besides, PPARalpha invalidation resulted in unexpected regulations by ALA of its known targets and was compensated partly in females, which was therefore less sensitive to the detrimental effects of a SFA-rich diet.

Anti-Obesity Effect of Fish Oil and Fish Oil-Fenofibrate Combination in Female KK Mice

The aim of our study is to elucidate the effects of EPA- or DHA-rich fish oil, and of the latter plus fenofibrate, on lipid metabolism in female KK mice. Female KK mice were fed purified experimental diets containing lard/safflower oil (4:6, Lard/SO), EPA-rich fish oil (EPA), DHA-rich fish oil (DHA), or DHA-rich fish oil plus 0.2% (w/w) fenofibrate (DHA+FF) for 8 weeks. At the end of the experiments, we measured levels of plasma lipids, hepatic triglycerides, and cholesterol, as well as the hepatic mRNA expression of lipogenic and lipidolytic genes. The final body weight of EPA- and DHA-fed groups was significantly lower than that of the Lard/SO-fed group, and that of the DHA+FF-fed group was the lowest. All three fish oil treatments significantly reduced plasma insulin levels. Hepatic lipid levels significantly decreased in all three of these groups compared with the Lard/SO-fed group. Plasma adiponectin increased in both the EPA-and DHA-fed groups, but the increase was suppressed in the DHA+FF-fed group. Hepatocytes of Lard/SO-fed mice were filled with numerous fat droplets, but fat accumulation was inhibited in both EPA- and DHA-fed mice and was significantly prevented by fenofibrate treatment. SREBP-1c mRNA levels were decreased by about half in EPA- and DHA-fed mice compared with Lard/SO-fed mice. FAS, Insig-1, HMG-CoA reductase, and LDL-receptor mRNA levels also markedly decreased in both EPA- and DHA-fed mice, but there was no additional decrease in DHA+FF fed mice. Fenofibrate treatment significantly induced mRNA expression of AOX and UCP-2, but not of PPARalpha. These data suggest that fish oil inhibited body weight gain and exhibited an anti-obesity effect through the inhibition of lipid synthesis in female KK mice. Furthermore, fenofibrate treatment markedly inhibited body weight gain by the induction of fatty acid oxidation. Plasma adiponectin levels did not increase in mice fed DHA-rich fish oil with fenofibrate, although white adipose tissue (WAT) weight significantly decreased. We considered that adiponectin sensitivity increased more in mice fed DHA-rich fish oil with fenofibrate than in mice fed DHA-rich fish oil alone.

Cinnamon extract inhibits the postprandial overproduction of apolipoprotein B48-containing lipoproteins in fructose-fed animals

We have reported previously that a cinnamon extract (CE), high in type A polyphenols, prevents fructose feeding-induced decreases in insulin sensitivity and suggested that improvements of insulin sensitivity by CE were attributable, in part, to enhanced insulin signaling. In this study, we examined the effects of CE on postprandial apolipoprotein (apo) B-48 increase in fructose-fed rats, and the secretion of apoB48 in freshly isolated intestinal enterocytes of fructose-fed hamsters. In an olive oil loading study, a water-soluble CE (Cinnulin PF, 50 mg/kg body weight, orally) decreased serum triglyceride (TG) levels and the over production of total- and TG-rich lipoprotein-apoB48. In ex vivo 35S labeling study, significant decreases were also observed in apoB48 secretion into the media in enterocytes isolated from fructose-fed hamsters. We also investigated the molecular mechanisms of the effects of CE on the expression of genes of the insulin signaling pathway [insulin receptor (IR), IR substrate (IRS)1, IRS2 and Akt1], and lipoprotein metabolism [microsomal TG transfer protein (MTP), sterol regulatory element-binding protein (SREBP1c) in isolated primary enterocytes of fructose-fed hamsters, using quantitative real-time polymerase chain reaction. The CE reversed the expression of the impaired IR, IRS1, IRS2 and Akt1 mRNA levels and inhibited the overexpression of MTP and SREBP1c mRNA levels of enterocytes. Taken together, our data suggest that the postprandial hypertriglycerides and the overproduction of apoB48 can be acutely inhibited by a CE by a mechanism involving improvements of insulin sensitivity of intestinal enterocytes and regulation of MTP and SREBP1c levels. We present both in vivo and ex vivo evidence that a CE improves the postprandial overproduction of intestinal apoB48-containing lipoproteins by ameliorating intestinal insulin resistance and may be beneficial in the control of lipid metabolism.

Farnesol Decreases Serum Triglycerides in Rats: Identification of Mechanisms Including Up‐Regulation of PPARα and Down‐Regulation of Fatty Acid Synthase in Hepatocytes

Obesity is associated with impaired fatty acid (FA) oxidation and increased de novo hepatic lipogenesis that may contribute to the development of hypertriglyceridemia, an important risk factor for the development of cardiovascular disease. Strategies to improve hepatocyte FA metabolism, including dietary interventions, are therefore important for the prevention of obesity-associated co-morbidities. Farnesol is consumed in the diet as a component of plant products. In the present study, we administered farnesol orally to rats for seven days and found significantly reduced serum triglyceride concentrations compared with controls. Potential mechanisms underlying the hypotriglyceridemic effect of farnesol were investigated using clone-9 cultured rat hepatocytes. Farnesol significantly upregulated expression of peroxisome proliferator-activated receptor alpha (PPARalpha) and the PPARalpha-regulated genes fatty acyl-CoA oxidase and carnitine palmitoyl transferase 1a, suggesting that increased hepatic FA oxidation may contribute to serum triglyceride lowering in rats. Farnesol did not change SREBP-1c mRNA levels, but significantly down-regulated fatty acid synthase (FAS) mRNA and protein levels and activity, indicating that attenuated lipogenesis may also contribute to hypotriglyceridemic effects of farnesol in vivo. Rescue experiments revealed that down-regulation of FAS by farnesol was not related to activation of PPARalpha, but rather was caused by a 9-cis retinoic acid mediated mechanism that involved down-regulation of retinoid X receptor beta. Diets rich in plant products are associated with a lower risk of cardiovascular disease. Our findings suggest that farnesol may contribute to this protective effect by lowering serum TG levels.

LXRα Enhances Lipid Synthesis in SZ95 Sebocytes

Differentiation of sebocytes is strongly associated with enhanced lipid synthesis and accumulation in the cells. Liver X receptors (LXRs) are members of the nuclear receptor superfamily, which play a critical role in cholesterol homeostasis and lipid metabolism. We examined whether LXRalpha regulated lipid synthesis in the immortalized human sebaceous gland cell line SZ95. When the SZ95 sebocytes were treated with the ligand of LXR such as TO901317 or 22(R)-hydroxycholesterol, lipid droplets were accumulated in the majority of cells when examined by Oil Red O staining. The expression of the known LXR targets, such as fatty acid synthase and sterol regulatory-binding protein-1, was induced by TO901317. TO901317 treatment increased expression of LXRalpha but not that of LXRbeta. Transfection of antisense LXRalpha significantly decreased TO901317-induced target gene expression and lipid droplet accumulation, suggesting a major role of LXRalpha in differentiation of sebocytes. Further, TO901317 decreased the expression of cyclooxygenase-2 and inducible nitric oxide synthase that was induced by lipopolysaccharide treatment. Together, these results indicate that important roles of LXRalpha in differentiation and inflammatory signaling in sebaceous glands. Thus, we suggest that LXR ligands could provide a new class of therapeutic agents for sebaceous gland-associated disorders such as seborrhea and acne.

Downregulation of plasma insulin levels and hepatic PPARγ expression during the first week of caloric restriction in mice

Calorie restriction extends lifespan by decreasing the rate of tumor formation, an effect occurring within 8 weeks of initiating a restricted diet. Our goal was to define how the first weeks of a calorie restricted diet (60% of ad libitum calories) affects putative mediators of the calorie restriction phenotype, focusing on regulators of fatty acid biosynthesis. In C57Bl/6 mice, insulin decreased over 50% ( p < 0.05) during the first week of calorie restriction whereas IGF-1 was unaffected. In the liver, PPARγ mRNA fell to 13% of baseline after 1 week of calorie restriction ( p < 0.05), whereas hepatic SREBP-1c and SIRT1 mRNA levels were unaffected. No changes in abdominal or subcutaneous adipose tissue were observed until after 4 weeks of caloric restriction. We conclude that calorie restriction-induced decreases in insulin and hepatic PPARγ are rapid enough to support a role for these molecules in triggering the initial phase of the calorie restriction phenotype.

Mitochondrial free cholesterol loading sensitizes to TNF- and Fas-mediated steatohepatitis

The etiology of progression from steatosis to steatohepatitis (SH) remains unknown. Using nutritional and genetic models of hepatic steatosis, we show that free cholesterol (FC) loading, but not free fatty acids or triglycerides, sensitizes to TNF- and Fas-induced SH. FC distribution in endoplasmic reticulum (ER) and plasma membrane did not cause ER stress or alter TNF signaling. Rather, mitochondrial FC loading accounted for the hepatocellular sensitivity to TNF due to mitochondrial glutathione (mGSH) depletion. Selective mGSH depletion in primary hepatocytes recapitulated the susceptibility to TNF and Fas seen in FC-loaded hepatocytes; its repletion rescued FC-loaded livers from TNF-mediated SH. Moreover, hepatocytes from mice lacking NPC1, a late endosomal cholesterol trafficking protein, or from obese ob/ob mice, exhibited mitochondrial FC accumulation, mGSH depletion, and susceptibility to TNF. Thus, we propose a critical role for mitochondrial FC loading in precipitating SH, by sensitizing hepatocytes to TNF and Fas through mGSH depletion.

Effect of insulin on transcription of lipogenic and lipolytic-related genes and lipid metabolism in primary porcine adipocytes

AbstractPrimary adipocytes from subcutaneous adipose tissue samples obtained from 7-day-old Yorkshire×Landrace crossbreed piglets were exposed to 0–400 nmol/l of insulin for 48 h. The accumulated triglyceride was measured through Oil Red O staining and the cumulative glycerol released was determined to assess lipolytic activity in adipocytes. Transcription levels of sterol regulatory element binding protein (SREBP)-1c, carbohydrate response element binding protein (ChREBP), acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FAS), and hormone-sensitive lipase (HSL) were assessed using reverse transcriptase-polymerase chain reaction (RT-PCR). The results showed that ChREBP and ACC1 mRNA levels were not influenced by insulin alone under low glucose (5 nmol/l). FAS mRNA level was markedly stimulated by all doses of insulin except 200 nmol/l, and SREBP-1c mRNA level increased with 100–300 nmol/l insulin. High insulin doses (300 and 400 nmol/l) increased the HSL mRNA level as well as lipolytic activity.

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Trans-10,cis-12 Conjugated linoleic acid inhibits lipoprotein lipase but increases the activity of lipogenic enzymes in adipose tissue from hamsters fed an atherogenic diet

The aim of the present work was to investigate the effects of trans-10,cis-12 conjugated linoleic acid (CLA) on the activity and expression of lipogenic enzymes and lipoprotein lipase (LPL), as well as on the expression of transcriptional factors controlling these enzymes, in adipose tissue from hamsters, and to evaluate the involvement of these changes in the body fat-reducing effect of this CLA isomer. Thirty male hamsters were divided into three groups and fed atherogenic diets supplemented with 0 (linoleic group), 5 or 10 g trans-10,cis-12 CLA/kg diet, for 6 weeks. Body and adipose tissue weights, food intake and serum insulin were measured. Total and heparin-releasable LPL and lipogenic enzyme activities (acetyl-CoA carboxylase (ACC); fatty acid synthase (FAS); glucose-6-phosphate dehydrogenase (G6PDH); and malic enzyme (ME)) were assessed. ACC, FAS, LPL, sterol regulatory element-binding proteins (SREBP-1a), SREBP-1c and PPARgamma mRNA levels were also determined by real-time PCR. CLA did not modify food intake, body weight and serum insulin level. CLA feeding reduced adipose tissue weight, LPL activity and expression, and increased lipogenic enzyme activities, despite a significant reduction in ACC and FAS mRNA levels. The expression of the three transcriptional factors analysed (SREBP-1a, SREBP-1c and PPARgamma) was also reduced. These results appear to provide a framework for partially understanding the reduction in body fat induced by CLA. Inhibition of LPL activity seems to be an important mechanism underlying body fat reduction in hamsters. Further research is needed to better characterize the effects of CLA on lipogenesis and the role of these effects in CLA action.

Assessment of Adipokine Expression and Mitochondrial Toxicity in HIV Patients With Lipoatrophy on Stavudine- and Zidovudine-Containing Regimens

Despite evidence for the role of adipokines such as adiponectin in the metabolic toxicities of protease inhibitor (PI)-treated patients, little is known about their role in nucleoside reverse transcriptase inhibitor (NRTI)-induced lipoatrophy (LA). We analyzed the relations between mitochondrial toxicity, adipokine expression, and clinical LA in peripheral blood mononuclear cells (PBMCs) and adipose samples from individuals treated with stavudine (d4T) or zidovudine (ZDV) in comparison to patients undergoing highly active antiretroviral therapy (HAART) as well as HIV-negative individuals. In this cross-sectional analysis, we studied 18 PI-naive HIV-infected patients with LA treated with d4T (d4T+LA+ [n = 12]) or zidovudine (ZDV+LA+ [n = 6]) in comparison to HAART-treated patients with (HAART+LA+ [n = 8]) and without (HAART+LA- [n = 8]) LA as well as HIV-negative controls (n = 12). Adipose samples were assessed for protein and/or messenger RNA (mRNA) levels of adiponectin, tumor necrosis factor-alpha (TNFalpha), interleukin (IL)-6, and sterol regulatory element-binding protein (SREBP) 1a/c in all groups, whereas adipose and PBMC samples from the d4T+LA+, ZDV+LA+, and HIV-negative subgroups were assessed for mitochondrial DNA (mtDNA) depletion and cytochrome c-oxidase (COX) II/COX IV ratios. There was no change in mtDNA levels in adipose or PBMC samples in NRTI-treated patients with LA, although patients treated with d4T had reduced COX II/COX IV ratios in adipose and PBMC samples. Adipose tissue adiponectin mRNA and plasma levels were reduced in the d4T- and ZDV-treated patients regardless of the use of PIs. Tissue SREBP1c mRNA levels were also significantly reduced in both NRTI groups when compared with the HIV-negative controls. Significant reductions in SREBP1c levels were also evident with the HAART+LA+ group when compared with HAART+LA- controls. Patients with LA on d4T-based regimens show evidence of mitochondrial respiratory chain dysfunction, whereas the d4T- and ZDV-based regimens also demonstrated reduced SREBP1c and adiponectin levels, findings that have previously been shown with PIs.

S-15261, a new anti-hyperglycemic agent, reduces hepatic glucose production through direct and insulin-sensitizing effects

S-15261 is a new oral anti-hyperglycemic agent that increases insulin sensitivity in various insulin-resistant animal models. The aim of this study was to determine the short- and long-term effects of S-15261 and its metabolites (S–15511 and Y-415) on fatty acid and glucose metabolism in hepatocytes isolated from 24-h starved rats. During short-term exposure (1 h) neither S-15261 nor its metabolites affected fatty acid oxidation whatever the concentration used. By contrast, S-15261 and its two metabolites reduced the rates of glucose production from lactate/pyruvate and dihydroxyacetone. Using crossover plot analysis, it was shown that Y-415 reduced hepatic gluconeogenesis upstream the formation of dihydroxyacetone phosphate. After 48 h in culture, S-15261 and its two metabolites reduced the rates of glucose production from lactate/pyruvate secondarily to a decrease in PEPCK and Glc-6-Pase mRNA levels. A part of these effects on gene expression could be due to a drug-induced reduction in PGC-1 gene expression. When hepatocytes were cultured in the presence of a submaximal concentration of insulin (10 −9 M), S-15261, through its metabolite S-15511, enhanced insulin sensitivity both on gene expression (PEPCK, Glc-6-Pase, PGC-1) and on gluconeogenesis. Furthermore, S-15261 and S-15511 induced the expression of GK and FAS genes as the result of an increased in SREBP-1c mRNA levels. Finally, S-15511 enhanced the stimulatory effect of insulin on GK mRNA level through an additional increase in SREBP-1c gene expression. In conclusion, this work reveals that S-15261 via its metabolites reduces hepatic glucose production through direct and insulin-sensitizing effects on genes encoding regulatory proteins of hepatic glucose metabolism.

Regulation of SREBP-1 expression and transcriptional action on HKII and FAS genes during fasting and refeeding in rat tissues

The sterol regulatory element binding protein 1 (SREBP-1) is regarded as a major factor involved in the nutritional regulation of lipogenesis. The aim of the present work was to demonstrate its involvement in the response of key genes of glucose and lipid metabolism in liver, adipose tissue, and skeletal muscle during fasting and refeeding. The regulation of hexokinase-2 (HKII) was investigated as a marker of the glucose metabolic pathway and that of FAS was investigated as a marker of the lipogenic pathway. The in vivo association of SREBP-1 with the promoter regions of these genes was determined in the different tissues using chromatin immunoprecipitation assays. Fasting decreased, and refeeding restored, FAS and HKII mRNA and protein levels in each tissue. The concomitant measurement of SREBP-1a and SREBP-1c mRNA levels, of mature SREBP-1 protein abundance in nuclear extracts, and of SREBP-1 interaction with target promoters led to the conclusion that SREBP-1 plays a major role in the response of FAS and HKII genes to nutritional regulation in rodents. These data elucidate the important role of SREBP-1 not only in the regulation of lipid metabolism but also of glucose metabolism and energy homeostasis.

Diversity of SREBP-1 gene expression in rat adipose tissue depots in response to refeeding after food restriction

The SREBP-1c mRNA level and precursor (microsomal) form of SREBP-1 abundance were significantly higher in epididymal and perirenal than in subcutaneous white adipose tissue of control rats. Moreover, the SREBP-1c mRNA level and an amount of precursor form of SREBP-1 were significantly higher in the epididymal and perirenal white adipose tissue of rats maintained on restricted diet and refed ad libitum for 48 h as compared to the control animals. No significant effects of food restriction/refeeding on SREBP-1c mRNA level and an amount of precursor form of SREBP-1 were found in subcutaneous white adipose tissue. The mature (nuclear) form of SREBP-1 was significantly increased in the epididymal, perirenal and subcutaneous white adipose tissue of the food restricted/refed animals. The activity, protein level and the mRNA abundance of malic enzyme (one of the target genes for SREBP-1) increased significantly in the epididymal, perirenal and subcutaneous white adipose tissue of the food restricted/refed rats as compared to the control animals, however the increase in perirenal and epididymal was higher than in the subcutaneous white adipose tissue. The results presented suggest that SREBP-1c is differently expressed in various rat white adipose tissue depots both under basal (control) and dieting conditions.