Mouse Adrenal Tumor Research Articles

Modulation of adrenal cell functions by cadmium salts: 2. Sites affected by CdCl2 during unstimulated steroid synthesis.

In previous studies cadmium chloride (CdCl2) nonlethally inhibited Y-1 adrenal mouse adrenal tumour cell 20-dihydroxyprogesterone (20DHP) secretion, affecting unstimulated and stimulated steroidogenic pathway sites differently. We studied CdCl2 effects on unstimulated steroidogenesis using Y-1 cells incubated 0.5 h in medium with or without cadmium (using the concentration that inhibited ACTH-stimulated steroid secretion by 50%). Exogenously added 20-hydroxycholesterol (20OHC), 22(R)-hydroxycholesterol (22OHC), 25-hydroxycholesterol (25OHC), pregnenolone (PREG), or progesterone (PROG) were used to bypass any rate-limited steroidogenic pathway sites that CdCl2 might inhibit. 25OHC is a biologically active nonpathway steroid, while 20OHC, 22OHC, PREG, and PROG are pathway steroids; each increased unstimulated 20DHP secretion nearly 10-fold. Although CdCl2 could not reduce dibutyryl cyclic AMP- (dbcAMP)-stimulated 20DHP secretion significantly, it did significantly reduce basal and 25OHC-induced 20DHP secretion 25% below untreated levels. When 20OHC, 22OHC, PREG, or PROG were incubated with unstimulated Y-1 cells, their synthesis into 20DHP was unaffected by cadmium. dbcAMP bypasses the plasma membrane enzyme complex that synthesizes intracellular cAMP during exogenous ACTH stimulation; dbcAMP was not inhibited by CdCl2. The rate-limited step accelerated by cAMP involves plasma membrane and/or cytoplasmic cholesterol transport to and through outer and inner mitochondrial membranes before the cholesterol is synthesized into pregnenolone by side-chain cleavage enzymes on the inner membrane matrix face. Little is known regarding the mechanisms controlling unstimulated steroidogenesis. Under unstimulated conditions the 25-, 20- and 22(R)-monohydroxyls of cholesterol facilitate plasma membrane, cytoplasm and inner and outer mitochondrial solubility, diffusion and/or transport to bypass rate-limited steps and augment unstimulated steroid synthesis. Since conversion of endogenous mitochondrial cholesterol and 25OHC, but not dbcAMP-mobilized cytoplasmic cholesterol, 20OHC or 22OHC conversion, to 20DHP is inhibited by CdCl2, this suggests that (a) control of mitochondrial cholesterol supplies is independent of the cAMP-regulated mitochondrial steps in the 20DHP steroid synthetic pathway, (b) CdCl2 specifically inhibited endogenous mitochondrial cholesterol and 25OHC utilization, (c) CdCl2 toxicity may affect adrenal, testicular, ovarian, and placental basal steroidogenic functions, and (d) 25OHC may be a useful compound to examine unstimulated steroid synthesis.

Plasma Membrane Cholesterol Is Utilized as Steroidogenic Substrate in Y-1 Mouse Adrenal Tumor Cells and Normal Sheep Adrenal Cells

Previous studies from this laboratory indicate that plasma membrane cholesterol acts as an important source of steroidogenic substrate for MA-10 Leydig tumor cells. The present studies were designed to generalize these findings to other steroidogenic cells and to another species. Studies were performed using the Y-1 murine adrenal tumor cell line and primary cultures of sheep adrenocortical cells. Treating Y-1 cells with the acyl coenzyme A:cholesterol acyltransferase inhibitor, 58-035, caused cellular cholesteryl ester depletion and rendered more apparent the effect of dibutyryl-cAMP to cause cellular free cholesterol depletion. Radioactive 20α-dihydroprogesterone was synthesized by Y-1 cells that had been plasma membrane-labeled with [3H]-cholesterol. Primary sheep adrenal cultures that had been cholesteryl ester-depleted also demonstrated cellular free cholesterol depletion after stimulation with dibutyryl cAMP. Plasma membrane label was converted to steroid hormones in these cells as well. Taken together, these data indicate that the use of plasma cholesterol is not restricted to the MA-10 cells. The present data indicate that both neoplastic mouse adrenal tumor cells and normal sheep adrenal cells utilize plasma membrane cholesterol.

Effects on cultured mammalian cells of myotoxin III, a phospholipase A 2 isolated from Bothrops asper (terciopelo) venom

Myotoxin III (MT-III), a myotoxic phospholipase A 2 from Bothrops asper, was studied with respect to interactions with cultured mammalian cells and red blood cells. Tests of the cytopathogenic effect of MT-III on different cell lines indicated that rat skeletal muscle L6 myoblasts were more sensitive to the toxin than chinese hamster ovary cells, human lung fibroblasts, mouse adrenal tumour cells and rat intestinal epithelial cells. Specific plasma-membrane permeabilization was assayed as release of a cytosolic [ 3H]uridine nucleotide marker from toxin-treated L6 cells. A dose- and time-related membrane permeabilization was induced at 37°C, but not at 0°C. A half-maximal effect was obtained after 20 min. 30 μg/ml MT-III induced 50% marker release in 1 h, and the effect was not reversed by post-incubation for up to 48 h in toxin-free medium. The membrane permeabilization in L6 cells did not seem to require cellular internalisation of the toxin. The catalytic site of the toxin was inactivated by alkylation with p-bromophenacyl bromide (BPB). This treatment abolished the toxin's specific PLA 2 activity, as assayed in vitro, and reduced the PLA 2 activity on the myoblast membrane by more than 95%, as measured by release of [ 14C]arachidonic acid from prelabelled cells. However, the membrane-permeabilizing effect (release of cytosolic marker) was reduced only by 70% upon modification with BPB. We also report that MT-III is not directly haemolytic, and one reason for this is the inability of the toxin to associate with the membranes of human or mouse erythrocytes. Taken together, the data suggest that MT-III at 37°C binds to and penetrates the plasma membrane of cultured myoblasts, thereby inducing a rapid, direct and irreversible membrane permeabilization. This effect apparently depends in part on the PLA 2 activity of the toxin and in part on a molecular region which is separate from the catalytic site.

Modulation of adrenal cell functions by cadmium salts. 1. Cadmium chloride effects on basal and ACTH-stimulated steroidogenesis.

Cultured Y-1 mouse adrenal tumor cells, which secrete 20-alpha-hydroxy-4-pregnen-3-one (20-DHP), were used to investigate the acute nonlethal effects of incremental cadmium chloride (CdCl2) concentrations on basal and maximally stimulated steroid secretion. In addition, cumulative CdCl2 effects during 4-hr incubations, effect reversibility, and viability were determined. Cells were incubated in 1 ml serum-free Eagle's Minimal Essential Medium (FMEM) with or without 0.5 IU (ca. 1.5 microM) adrenocorticotropin (ACTH) in the presence or absence of CdCl2. Following incubation, cell viability was quantitated using trypan blue exclusion. The 20-DHP secreted into the experimental incubation medium was measured by radioimmunoassay. CdCl2 levels of 10.0 micrograms/ml or greater significantly inhibited basal 30 min steroid secretion in a dose-dependent manner; ACTH-stimulated steroid secretion was significantly inhibited by levels 5.0 micrograms/ml or greater. At least 80% of all control and stimulated cells in the presence or absence of cadmium ions excluded trypan blue. The reduction in ACTH-stimulated steroid secretion was greater than the reduction in basal steroid secretion at any cadmium concentration level. The CdCl2 concentration that reduced stimulated steroid hormone secretion by 50% (IC50) was 45.0 micrograms/ml. Exposing Y-1 cells to either 5.0, 10.0, 45.0 or 500.0 micrograms CdCl2/ml FMEM for periods ranging from 0.5 to 4 hr inhibited ACTH-stimulated steroid secretion in a time-dependent manner. After 30 min exposure to 10.0, 45.0 or 500.0 micrograms CdCl2/ml FMEM with or without ACTH, cadmium inhibition was irreversible. When 5.0 micrograms CdCl2/ml was used, basal and stimulated inhibition was reversible by reincubating in medium containing ACTH alone. The relatively greater cadmium effects on ACTH stimulated steroidogenesis might suggest that cadmium modulated the rate-limited transducing system between the ACTH plasma membrane receptor complex and cholesterol side-chain cleaving mitochondrial enzymes. However, cadmium influences on basal secretion indicated effects on the non-rate-limited steroidogenic pathway.

The role of the cytoskeleton in the regulation of steroidogenesis

The slow step in steroid synthesis involves the transport of cholesterol from lipid droplets in the cytoplasm to the first enzyme in the pathway—the cytochrome P450 that converts cholesterol to pregnenolone ( P450scc) which is located in the inner mitochondrial membrane. ACTH stimulates this intracellular transport of cholesterol in adrenal cells (Y-1 mouse adrenal tumour cells and cultured bovine fasciculata cells) and this effect of the trophic hormone is inhibited by cytochalasins, by anti-actin antibodies and DNase I suggesting that the response to ACTH requires a pool of monomeric (G-) actin that can be polymerized to F-actin. Recent studies have shown that lipid droplets and mitochondria of adrenal cells are both attached to intermediate filaments. Moreover ACTH reorganizes the cytoskeleton and changes the shape of the cell. These observations suggest a mechanism for transport of cholesterol that involves reorganization and contraction of actin microfilaments which may, in turn, cause movement of droplets and mitochondria together through their common attachment to intermediate filaments.

Intermediate filaments and steroidogenesis in adrenal Y-1 cells: acrylamide stimulation of steroid production.

The possible role of intermediate filaments in steroidogenesis was investigated in Y-1 mouse adrenal tumor cells by treatment with acrylamide, which is thought to disrupt intermediate filaments without directly affecting microtubules or microfilaments. Treatment of cells with 5 mM acrylamide increases steroidogenesis after a lag period of 4-6 h and induces rounding of the cells at approximately the same time. The effect of acrylamide on steroidogenesis is not cAMP mediated and occurs before pregnenolone formation. DNA synthesis is inhibited, while protein synthesis is not. Acrylamide does not affect polymerization/depolymerization of microtubules in vitro. Acrylamide stimulation of steroidogenesis is additive with that produced by either colchicine or ACTH, implying that acrylamide, ACTH, and colchicine act at different rate-limiting steps in steroidogenesis. In addition, acrylamide stimulation is additive with that of forskolin. Pretreatment of cells with taxol, an agent that specifically promotes microtubule polymerization, decreases acrylamide-stimulated (as well as colchicine or ACTH-stimulated) steroidogenesis, implying that there must also be some shared elements in the stimulating pathways. We hypothesize that regulation of steroidogenesis in the Y-1 cell depends on 1) disruption of a vimentin or tubulin coat surrounding lipid droplets and 2) possible functional shortening of the distance between cholesterol droplets and the mitochondrion. However, because of interactions between cytoplasmic fibers, it is currently impossible to say whether interruption of any one of them is a direct or indirect stimulus of steroidogenesis.

Cytotoxicity and Antibiotic Resistance Profiles of Aeromonas hydrophila Isolates From a Broiler Processing Operation

The cytotoxicity and antibiotic resistance profiles of Aeromonas hydrophila isolates recovered from broiler carcasses and chill water samples taken from a Georgia processing plant were determined. Carcasses were sampled at pre- and post-evisceration locations, immediately after immersion chilling, and after being boxed, iced and refrigerated for 48 h. Grab samples of chill water were randomly selected for A. hydrophila recovery. Resistance of isolates to nine antibiotics was determined with the Bauer disc diffusion method (i.e., to ampicillin, cephalothin, streptomycin, kanamycin, chloramphenicol, naladixic acid, tetracycline, neomycin, and gentamicin). Multiple antibiotic resistance occurred in 46.2% of 119 isolates. The majority of the multiple antibiotic-resistant isolates (76.4%) were resistant only to ampicillin and cephalothin. The remaining multiple antibiotic-resistant isolates (23.6%) were resistant to various combinations of 2, 3, or 4 antibiotics, most of which were recovered from carcasses immediately after evisceration. Cytotoxin activity was detected in 63.8% of all isolates using the Y-1 mouse adrenal tumor cell line. Cytotoxin positive isolates were recovered from all sampling locations including chill water. The highest cytotoxicity titers were shown among isolates recovered from carcasses immediately after evisceration. These data suggest bird fecal contamination as an important source of A. hydrophila in broilers and broiler processing plants rather than environmental contamination.

Attachment of steroidogenic lipid droplets to intermediate filaments in adrenal cells.

Light microscopy of living and extracted adrenal cells (Y-1 mouse adrenal tumour cells and cultured bovine fasciculata cells), using Nomarski optics and fluorescence with nile red to stain lipid, revealed in both cell types that lipid droplets remain attached to intermediate filaments when the cells are extracted to prepare these structures. Electron microscopy of thin sections shows the presence of lipid droplets in both cell types. The droplets differ in appearance but are, in both cases, surrounded by a complete capsule 5 nm wide. The droplets in Y-1 cells include those associated with lysosomes and crystalline structures in addition to typical rounded forms. Only the latter type is seen in bovine fasciculata. Intermediate filaments apparently ending in droplets can also be seen. Immunoelectron microscopy with anti-vimentin and Protein A conjugated to gold particles together with measurement of the diameter of these structures identifies them as intermediate filaments. When adrenal cells are permeabilised and extracted under mild or severe conditions using Triton X-100, thin sections showed that lipid droplets remain associated with the cytoskeleton and in particular intermediate filaments. Extraction under mild and severe conditions cleared the cell contents, revealing attachment of intermediate filaments to lipid droplets with greater clarity than in unextracted cells, i.e. homogenised cells or cells subjected to lysis. Such attachment was unequivocally demonstrated in stereo pairs. These observations support our earlier studies showing attachment of droplets to intermediate filaments, which suggests a role for these filaments in intracellular transport of cholesterol.

Endozepine/diazepam binding inhibitor in adrenocortical and Leydig cell lines: Absence of hormonal regulation

One of the many effects which have been attributed to the peptide endozepine/diazepam binding inhibitor (Ep/DBI) is the stimulation of adrenocortical and testicular Leydig cell mitochondrial steroidogenesis. We have used two cell lines (Y-1 mouse adrenal cell tumour and MA-10 mouse Leydig cell tumour), both of which exhibit hormone stimulated steroid production, to investigate the role of Ep/DBI in acute hormone stimulated steroidogenesis. The time course of incorporation of 35S-translabel into Ep/DBI and its turnover rate when the isotope was removed were examined. Cell samples were extracted and separated on Sep-Pak C 18 columns and analysed using sodium dodecyl sulphate-poly-acrylamide gel electrophoresis (SDS-PAGE) and immunoblot analysis followed by fluorography as well as by direct scintillation counting. This allowed us to estimate the in vivo half-life of Ep/DBI and also to investigate the hormonal dependence of the peptide. Data presented here suggest that (i) Ep/DBI levels are not regulated by trophic hormones in these steroidogenic cell lines, and (ii) that the peptide has a relatively long half-life (> 3 h), a finding incompatible with suggestions of it having a rapid turnover. Therefore, it seems unlikely that control of Ep/DBI steroidogenic effects is via hormonal modulation of the peptide levels.

Regulated expression of cytochrome P-450scc (cholesterol-side-chain cleavage enzyme) in cultured cell lines detected by antibody against bacterially expressed human protein

The first step in the synthesis of steroids is catalysed by cytochrome P-450ssc (cholesterol-side-chain cleavage enzyme). We have investigated the synthesis of this enzyme in three cultured cell lines at the protein and hormone secretion levels. Hormone levels were measured by an enzyme immunoassay using a monoclonal antibody against progesterone. The protein level was detected using polyclonal antibodies directed against a P-450scc fusion protein overproduced in Escherichia coli. Utilizing a bacteriophage T7 promoter expression system, a large amount of human P-450scc fusion protein was produced and easily purified. P-450scc was synthesized in the mouse adrenal tumour cell line Y1 and human choriocarcinoma cell line JEG-3, but not in monkey kidney cell line COS-1. The production of P-450scc in Y1 and JEG-3 cells was stimulated by 8-bromo cyclic AMP, the effect of which was not observed until 6 h after induction and was more pronounced at 24 h. Y1 and JEG-3 cells exhibited a difference in progesterone secretion after induction.

Comparative acyl specificities for transfer and selective uptake of high density lipoprotein cholesteryl esters

This study compares the specificities of selective uptake and transfer mediated by plasma cholesteryl ester transfer protein (CETP) for various species of cholesteryl esters in high density lipoproteins (HDL). [3H]Cholesterol was esterified with a series of variable chain length saturated acids and a series of variably unsaturated 18-carbon acids. These were incorporated into synthetic HDL particles along with 125I-labeled apoA-I as a tracer of HDL particles and [14C]cholesteryl oleate as an internal standard for normalization between preparations. Selective uptake by Y1-BS1 mouse adrenal cortical tumor cells was most extensively studied, but uptake by human HepG2 hepatoma cells and fibroblasts of human, rat, and rabbit origin were also examined. Acyl chain specificities for selective uptake and for CETP-mediated transfer were conversely related; selective uptake by all cell types decreased with increasing acyl chain length and increased with the extent of unsaturation of C18 chains. In contrast, CETP-mediated transfer increased with acyl chain length, and decreased with unsaturation of C18 chains. The specificities of human and rabbit CETP were also compared, and were found to differ little. Associated experiments showed that HDL-associated triglycerides, traced by [3H]glyceryl trioleyl ether, were selectively taken up but at a lesser rate than cholesteryl esters. The mechanism of this uptake appears to be the same as for selective uptake of cholesteryl esters.

Structures of regulatory regions in the human cytochrome P‐450scc (desmolase) gene

The mechanism of regulatory expression of human cytochrome P-450scc gene by cAMP was investigated in a transient expression system using Y-1 cells (mouse adrenal tumor cell line) and a chimeric DNA composed of the structural gene for bacterial chloramphenicol acetyltransferase and the 5' flanking upstream sequence of the cytochrome P-450scc (cholesterol desmolase) gene which was revealed to contain a DNA element(s) responsive to cAMP [Inoue, H. et al. (1988) Eur. J. Biochem. 171, 435-440]. Introduction of deletions and point mutations in the upstream regulatory sequence demonstrated that three regions were mainly required for response to cAMP. These regions contained a short similar sequence. All of them have a 5-bp motif GTCAT (or ATGAC) in common, and have at least two motifs which conserve four out of five base pairs of the consensus sequence of the cAMP-responsive element (CRE), CGTCA (or TGACG). They are all apparently necessary for regulation by cAMP. Gel mobility shift assays suggested that a binding factor(s) to these regions was present in the nuclear extracts of Y-1 cells and adrenal cortex tissues and appeared to be different from the somatostatin CRE-binding protein. Deletion analysis also suggested that the region around -44 was essential to the basal transcriptional activity. This region shows some similarity to the CTF NF-1 binding site [Johnson and McKnight (1989) Annu. Rev. Biochem. 58, 799-839].

The role of intermediate filaments in adrenal steroidogenesis

Cholesterol is stored in adrenal cells as ester in lipid droplets, which are transported to mitochondria to provide a substrate for steroid hormone synthesis. Using mouse adrenal tumour cells (Y-1), we show here that approximately 33% of the adrenal cell cholesterol ester is bound tightly to intermediate filaments while the rest is either loosely attached or free in the cytosol. Specific binding of droplets to intermediate filaments was demonstrated by immunofluorescence and electron microscopy. Immunofluorescence was based upon Nile Red to stain lipid and antibodies to vimentin, actin and tubulin. Electron microscopy, including immunoelectron microscopy with protein A conjugated to gold particles (5 nm), was used to examine whole mounts of cytoskeletons and intermediate filaments. Immunofluorescence reveals that bound droplets are surrounded by a capsule containing vimentin and can be removed from the filaments by extraction with ethanol or 6 M urea. Negative staining of the urea extracts revealed isolated droplets. To the extent that cholesterol ester is the storage form of steroidogenic cholesterol, the knowledge that lipid droplets containing such esters are attached to intermediate filaments may prove important in unravelling the complex process of the transport of cholesterol to mitochondria.

Novel cAMP Regulatory Elements in the Promoter Region of Bovine P-450(11β) Gene11

In order to elucidate the cAMP regulatory elements in the promoter region of bovine P-450(11 beta) genes, we analyzed the promoter region using chloramphenicol acetyltransferase (CAT) gene as the reporter. Various deletion plasmids were constructed using the promoter region of CB11 beta-7, which is one of the two normal genes. Examination of the effects of Bt2cAMP on the CAT activities of mouse adrenal tumor cells (Y-1 cells) transfected with these deletion plasmids suggested that two elements named Ad3 and Ad4 play major roles in the induction by cAMP. Ad3(AAGATAAGGCACCCATCCATCTT) is located at -306 bp to -284 bp and Ad4 (CCAAGGTC) is located at -331 bp to -324 bp in the promoter region of the P-450(11 beta) gene. Deletions of both Ad3 and Ad4 resulted in a large decrease of the induction ratio from 9- to 3-fold. Coexistence of Ad3 and Ad4 is essential for their function, because any mutations introduced into either one of them resulted in a decrease of the cAMP induction ratio. These two elements are highly conserved among bovine, mouse, and human P-450(11 beta) genes and have no similarity with known cAMP regulatory elements. DNase I footprint analysis indicated that factors which specifically bind to the two elements exist in the nuclear extract of bovine adrenal cortex cells. Ad3 and Ad4 showed different patterns in gel shift analysis using probes which contained Ad3 or Ad4 sequence, suggesting their interaction with different nuclear factors. We also found two other protected regions by DNase I footprint analysis of the promoter regions of P-450(11 beta) gene, and named them Ad5 and Ad6.(ABSTRACT TRUNCATED AT 250 WORDS)

Tissue-specific enhancer of the human multidrug-resistance (MDR1) gene.

Identification of cis-regulatory sequences is a first step in analyzing the regulation of the human multidrug-resistant 1 (MDR1) gene which encodes the 170-kilodalton membrane P-glycoprotein in normal tissues and tumor cells. We have studied several overlapping genomic clones containing the 5'-flanking region of the gene. These clones span about 30 kilobases (kb) of contiguous DNA containing 10 kb of the gene and 20 kb of the 5'-flanking sequence. The nucleotide sequence of the first exon and the 2 kb preceding the exon were determined. DNA sequences containing the 5'-flanking regions were linked to the chloramphenicol acetyltransferase (CAT) gene. For transient CAT assay, we have employed six cell lines, including human cancer KB, vincristine-resistant VJ-300 derived from KB, mouse adrenal tumor Y-1, African green monkey kidney CV-1, mouse fibroblast NIH3T3, and human adrenal carcinoma SW-13 cells. Promoter activity was very weak regardless of the length of the promoter region in mouse adrenal tumor Y-1 and monkey kidney CV-1 cells, in which endogenous P-glycoprotein was expressed. Introduction of a 700-base genomic DNA fragment from a site located at 10 kb far upstream of the initiation site increased the transcription of the CAT gene in Y-1, CV-1, and SW-13 cells. However, no significant increase in the CAT activity could be observed in NIH3T3, KB, and VJ-300 cells. This fragment markedly augmented the expression of the CAT gene regardless of orientation or position, and it acted in a cell type-specific manner even with heterogenous promoters. Our present study suggests that the 700-base pair fragment may carry a tissue-specific transcriptional enhancer that is active in at least some adrenal and kidney-derived cell lines.

Further characterization of the inhibitory effect of monensin on adrenal steroidogenesis

We have previously reported that treatment of cultured mouse adrenal tumor cells with 0.6-1.2 μ M monensin, a monovalent carboxylic ionophore, results in disruption of the organized structure of the Golgi complex. This is associated with an inhibition of adrenocorticotropic hormone (ACTH) or dibutyryl cAMP-stimulated steroidogenesis and impairment of mitochondrial cholesterol side-chain cleavage activity. The present report describes further investigations regarding possible mechanisms for the inhibition. Monensin inhibits both synthesis of fluorogenic steroids and incorporation of [ 14C]acetate into the end-product steroid 11β,20α-dihydroxy-4-pregnen-3-one. Supplementation of monensin-treated cells with 25-hydroxycholesterol, a readily available substrate for steroidogenesis, does not reverse the inhibitory effect on the reaction. The incorporation of l-[ 35S]methionine into trichloroacetic acid precipitable proteins in the isolated mitochondria of monensin-treated cells is inhibited approximately by 40%, whereas the inhibitory effect on the proteins in the cell homogenate is marginal. These findings suggest that a deficiency of newly synthesized proteins in mitochondria, rather than the availability of the substrate cholesterol, may be the primary factor causing impairment of steroidogenesis.

CAMP-dependent transcription of the human CYP21B (P-450C21) gene requires a cis-regulatory element distinct from the consensus cAMP-regulatory element.

By utilizing chimeric genes constructed from 5'-flanking sequences of the human CYP21B (P-450C21) gene and reporter genes (chloramphenicol acetyltransferase or rabbit beta-globin), a 34-nucleotide sequence has been found to be required for cAMP-dependent transcription. This sequence (-129/-96 base pairs) shows no homology to that of the consensus (CRE) cAMP-regulatory element. Gel retardation analysis shows that a protein-DNA complex is formed between this DNA sequence and nuclear proteins from mouse adrenal Y1 tumor cells or bovine adrenal cortical cells or human fetal adrenal tissue and that formation of this complex cannot be competed by DNA containing the consensus CRE sequence. Even though cAMP-enhanced accumulation of P-450C21 mRNA in primary cultures of bovine adrenocortical cells is inhibited by the protein synthesis inhibitor, cycloheximide, reporter gene transcription enhanced by the cAMP-responsive -129/-96-base pair fragment of the human CYP21B gene is not. We conclude that cAMP-dependent transcription of the human P-450C21 gene (CYP21B), an event required for maintenance of optimal steroidogenic capacity in the adrenal cortex, involves a stable transcription factor(s) distinct from the CRE-binding protein. Furthermore the cAMP-dependent cis-regulatory element of the human P-450C21 gene is distinct from those found associated with the other steroid hydroxylase genes, 17 alpha-hydroxylase cytochrome P-450, cholesterol side chain cleavage cytochrome P-450, and 11 beta-hydroxylase cytochrome P-450, suggesting that each of these genes may require its own set of specific transcription factors for cAMP-dependent regulation.

17 β-Hydroxysteroid oxidoreductases of human fetal and adult tissues: Immunological cross-reactivity with an anti-human placental cytosolic 17 β-hydroxysteroid oxidoreductase antibody

To determine whether the immunological determinants of human placental 17 beta-hydroxysteroid oxidoreductase (17 beta-HSOR) were present in 17 beta-HSORs of tissues of the human fetus and adult and of various non-human cells maintained in culture, western immunoblot analysis was conducted by use of a polyclonal antibody directed against determinants of the placental cytosolic enzyme. Tissues and cells were evaluated for the presence of immunocross-reactive proteins with a relative molecular mass (Mr) similar to that of placental 17 beta-HSOR (approximately 34,000). By use of homogenates of human fetal tissues, immunostaining of 17 beta-HSORs of Mr approximately 34 kDa was detected in trophoblast, fetal adrenal neocortex, fetal zone of the adrenal gland, liver, intestine, kidney, brain, lung, skin, heart, spleen, pancreas, chorion laeve, and, occasionally, amnion. Immunostaining at Mr approximately 34 kDa also was demonstrated by use of cytosolic preparations of fetal tissues and, in some cases, by use of unwashed microsomal fractions; this protein was either absent or present in almost undetectable amounts in washed microsomes, except for placenta and fetal brain. Immunostaining at approximately 34 kDa was demonstrated occasionally in decidua of pregnant women by use of homogenates, but was not detected in endometrium or myometrium of non-pregnant women, testis of an adult man, mouse and rat Leydig tumour cells, mouse and rat adrenal tumour cells, and normal bovine adrenocortical cells.

Transcriptional regulation of the bovine CYP17 (P-450(17)alpha) gene. Identification of two cAMP regulatory regions lacking the consensus cAMP-responsive element (CRE).

Regions within the 5'-flanking sequence of the bovine CYP17 (P-450(17)alpha) gene which are required for cAMP-dependent regulation of transcription have been localized by transient transfection of chimeric reporter gene constructs into mouse adrenal tumor Y1 cells. Two sequences have been found which individually confer cAMP responsiveness to reporter genes; they are located at -243/-225 and -80/-40 base pairs (bp). Obvious sequence homology between these two regions is not apparent. Gel shift competition analysis indicates that nuclear protein(s) binding to the -243/-225-bp region can be competed for by the addition of a double-stranded oligonucleotide containing a consensus cAMP-responsive element (CRE) from the human chorionic gonadotropin alpha gene, whereas addition of this CRE does not abolish protein-DNA complexes formed with fragments containing the -80/-40-bp sequence. Gel shift and Southwestern analysis indicate that the -243/-225-bp region of the P-450(17)alpha gene and the CRE both bind a 47-kDa protein and that the CRE binds additional proteins (43 and 68 kDa) not apparently recognized by the -243/-225-bp sequence. Thus cAMP-dependent regulation of the bovine P-450(17)alpha gene appears to involve two independent cis-regulatory regions, neither of which contains a consensus CRE. Based on protein binding analysis, one of these regions (that including -80/-40 bp) is distinct from the consensus CRE while the other (that containing -243/-225 bp) may be related to the consensus CRE.

Characterization of the promoter/regulatory region of the bovine CYP11A (P-450scc) gene. Basal and cAMP-dependent expression.

The promoter/regulatory region of the bovine CYP11A (P-450scc) gene was cloned from a bovine genomic library. One major start site of transcription was identified by primer extension analysis with a minor start site four nucleotides further upstream. A putative TATA box is located at position -31, and at position -68 resides a putative binding site for the transcription factor Sp1. Transient transfection of chimeric reporter gene constructs into mouse adrenal tumor Y1 cells was used to locate regions within the P-450scc 5'-flanking sequences that are important for basal and cAMP-dependent transcription of the reporter genes. While cAMP-dependent accumulation of mRNA derived from expression of the endogenous bovine P-450scc gene can be inhibited by protein synthesis inhibitors, transcription of reporter gene constructs containing the promoter/regulatory region of the P-450scc gene is not affected by cycloheximide following transient transfection of Y1 cells or primary bovine adrenocortical cells. Basal expression of these constructs as well as cAMP responsiveness is reduced upon deletion of sequences between -186 and -101, further deletion to -50 leading to loss of virtually all the remaining cAMP responsiveness. The sequence between -183 and -83 alone will direct both basal and cAMP-enhanced transcription when fused to a heterologous promoter and is equally active in either the correct or reverse orientation. No homology to the consensus cAMP-responsive element (CRE) or AP-2 binding site is found in this region whereas an activator protein 1-like sequence is found at position -116. It is concluded that the cAMP responsiveness of P-450scc gene expression is mediated by sequences different from canonical consensus regulatory elements. Whether or not there are sequences conferring cAMP responsiveness which are common both to P-450scc and the other steroidogenic P-450 genes remains to be established.