Mosaic Potyvirus Research Articles

First Report of Natural Infection of Watermelon mosaic virus (WMV) Infecting Bottle Gourd and Snake Melon

Cucurbitaceous crops, one of the main crops of agriculture, are sensitive to many plant viruses. In August 2019, virus-like symptoms were observed on some cucurbit plants grown in private home gardens in Antalya and Denizli provinces (Turkey). A total of 53 leaf samples were sampled from plants with the most symptoms (melon (Cucumis melo L.), watermelon (Citrullus lanatus L.), bottle gourd (Lagenaria siceraria (Molina) Standl.), and snake melon (Cucumis melo var. flexuosus) and tested by Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR) against possible watermelon mosaic potyvirus (WMV) infection. The coat protein gene (CP) specific primer sets amplified a gene product of nearly 820 bp fragment from symptomatic plants. WMV infections were detected in 31 individual cucurbit plants, including 11 melons, 8 watermelons, 7 snake melons and 5 bottle gourds. The presence of viral infection was found only in ornamental squash plants in Antalya province and in all cucurbits sampled in Denizli province. To better comprehend the molecular characteristics of virus isolates, the amplified viral DNA fragments were cloned in a proper prokaryotic plasmid, sequenced by Next Generation Sequencing (NGS) and recorded to GenBank. Bioinformatic analyses using the Basic Local Alignment Search Tool (BLAST) showed that the identified CP gene sequences exhibited significant nucleotide homogeneity, supported by a high nucleotide similarity index with that of other isolates around the world. In addition, Turkish isolates isolated from Antalya and Denizli regions showed approximately 94% nucleotide similarity among themselves. For phylogenetic inference, WMV sequences were subjected to multiple alignments with isolates from different geographic origins of the same viruses. Molecular phylogeny showed that all WMV isolates are closely related to other world WMV isolates at variable rates. WMV is wide host range viruses in cucurbit crops, however, this work is the first scientific report of WMV isolates detected in bottle gourd and snake melon from the South and West Regions of Turkey all over the world.WMV are broad spectrum viruses in cucurbit crops. This work is the first scientific report of Watermelon mosaic potyvirus isolates detected in bottle gourd and snake melon from the South-West Region of Turkey in all over the world.

Iğdir İli Kabakgil Bitkilerinde Bazı Mozaik Hastalıklarının In Siliko ve Moleküler Analizi

Cucumber mosaic cucumovirus (CMV) and Watermelon mosaic potyvirus (WMV) are plant viruses with positive single-stranded RNA genome that infect cucurbits and cause economic losses. Both viruses cause especially mosaic pattern and deformities in leaves, in cucurbit plants. The leaves of 23 melon and 28 watermelon plants showing such symptoms were sampled from different regions of Iğdır province. Samples with and without symptoms were tested by the Reverse Transcription Polymerase Chain Reaction (RT-PCR) using coat protein gene (CP)-specific primers. Polymerization tests amplified DNA fragments of the expected size for CMV and WMV. Some fragments with positive results were purified, bacterial cloned, nucleotide sequences revealed and registered in the GeneBank (NCBI). Sequence analyzes showed that it contained 593 bp and 822 bp for CMV and WMV, corresponding to the partial CP gene. Phylogenetic relationships with isolates from different geographical regions and plant material were investigated for both viruses. The generated phylogenetic tree confirmed that CMV-Iğdır isolate was in Group I and subgroup B, and WMV-Iğdır isolates were in different groups. In addition, coat proteins of virus isolates were characterized by in silico tools.
 In the current study, the presence WMV of and CMV in watermelon and melon was determined for the first time in Iğdır province, and group/subgroup assignments of CMV were revealed.

Agave attenuata and Agave amica, new hosts of Tuberose mild mosaic virus in Mexico.

Agave attenuata is a Mexican wild plant originally from highlands in the central and occidental mountains of Mexico. This species, known as "swan´s neck agave", is used only as an ornamental plant in public and private gardens. No virus had previously been reported from A. attenuata before this study. In a survey conducted in a commercial greenhouse in Cuautla, Morelos, in 2018, several plants were observed with symptoms of green mosaic and streaks, consistent with a putative viral infection. Sap inoculation from symptomatic A. attenuata plants to herbaceous indicator plants (Nicotiana benthamiana and N. tabacum) failed to produce symptoms in the mechanically inoculated plants. ELISA specific test to CMV, TEV, AMV, TMV and Potyvirus Group (Agdia, Inc.), was positive only for the last one (Chen and Chang, 1998). To determine the identity of the potyvirus involved, total nucleic acid extracts from 100 mg of symptomatic leaves (Trizol reagent; Gibco BRL Life Technologies, England) were used as template in RT-PCR with genus-specific potyvirus primers POT1-POT2, which targeted the variable 5´ terminal half of the coat protein gene of potyviruses (Colinet et al. 1998). The expected 900 bp amplicon was consistently detected in 10 symptomatic A. attenuata plants whereas no PCR products were obtained from 15 asymptomatic A. attenuata plants collected from the "Agaves de México" section at the 'Botanic Garden' of the Instituto de Biología de la UNAM, México. The amplicons were sequenced by the Sanger´s method and the obtained nucleotide (nt) sequences (Acc. No KY190217.1; OP964597-598) and their derived amino acid (aa) sequences were 94.68% to 95.80% similar to an isolate of Tuberose mild mosaic virus (TuMMV; Potyvirus; (Acc. No ON116187.1) characterized from Agave amica in India (Raj et al. 2009). Interestingly, A. amica (formerly Poliantes tuberose) is also a wild Mexican plant that is geographically distributed in the central and south regions of Mexico and is currently being commercially cultivated as an ornamental plant. Plants of A. amica (n=10) showing yellow mild streak were collected from commercial greenhouse and tested positive for TuMMV by RT-PCR and Sanger sequencing (No Acc. OP964599-601 levels) described above. The derived TuMMV sequences from A. attenuata and A. amica were 99-100% similar to each other at the nt/aa level. To exclude the involvement of additional viral agents in the disease, high-throughput sequencing analysis was performed separately for each species of Agave on total RNA extracts from a composite sample of symptomatic leaf tissues using Illumina´s Next Seq 500 platform. Analysis of the obtained 13,260,700 reads (each 75 nt) by the Trinity software, with a total number of sequences of 22,793, resulted in the identification of a single viral contig of 9500 nt for A. attenuata (Acc. No OP964595). Similarly, for A. amica, 27,262,248 reads were obtained, with a total number of sequences of 23,269, resulting in the identification of a single viral contig of 8500 nt (ACC. No OP964602). These contigs showed an identity percentage of 96%/88% and 98%/96% for nucleotides and amino acids, respectively, compared to an isolate of TuMMV from India (Acc. OM293939). Mexico is a center of origin for numerous species of genus Agave which have high economic, social, and ecological impact. TuMMV could be a threat to these plants and potentially to other unknown susceptible crops. To our knowledge, this is the first report of TuMMV in A. attenuata and A. amica in Mexico. REFERENCE Chen, C. C., and Chang, C. A. 1998. Characterization of a potyvirus causing mild mosaic on tuberose. Plant Dis. 82:45-49. Colinet, D., Nguyen, M., Kummert, J., Lepoivre, P., and Xia, F. Z. 1998. Differentiation among potyviruses infecting sweet potato based on genus- and virus-specific reverse transcription polymerase chain reaction. Plant Dis. 82:223-229. Raj, S.K., Snehi, S.K., Kumar, S., Ram, T. and Goel, A.K. 2009. First report of Tuberose mild mosaic potyvirus from tuberose (Polianthes tuberosa L.) in India. Australasian Plant Dis. Notes 4, 93-95.

First report of Watermelon Crinkle Leaf-Associated Virus (WCLaV) -1 and WCLaV-2 infecting straightneck squash in the United States.

Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.

Bean Common Mosaic Potyvirus (BCMV) Characterized from Bean (Phaseolus vulgaris L.) Crops Affected by Mosaic Disease in Denizli Province, Türkiye

Bean (Phaseolus vulgaris L.) is one of the world's oldest crops with both financial and nutritional importance. Bean common mosaic potyvirus (BCMV) is one of the prevalent viral agents that affect beans across the globe. Determining the presence of the agent in the relevant region is critical for minimizing crop losses by implementing appropriate preventive and control measures. In this study, 73 bean leaf samples were collected from bean-growing areas in the Denizli province of Türkiye in 2022. The samples were screened for the presence of viral agents using Polymerase Chain Reaction (PCR) with specific primers targeting the polypeptide gene. 26 of the bean samples were found to be positive for BCMV. The coat protein gene sequences of two randomly selected positive isolates were sequenced and deposited in the GenBank with accession numbers OQ910196 and OQ910197. The nucleotide sequences of isolates were found to have high similarity with those of isolates identified in various regions of the world. Phylogenetic analysis indicated that these isolates from Denizli, Türkiye were closely related to other Turkish isolates. However, since some Turkish isolates in the cluster associated with the Denizli isolates were identified as belonging to the US-5 or NL-6 strain, the current sequences may be related to these strains. Further research is necessary to identify the exact strain of the Denizli isolates, which could be achieved through the use of a strain differentiation set.

Structural insights into the RNA interaction with Yam bean Mosaic virus (coat protein) from Pachyrhizus erosus using bioinformatics approach.

Plants are constantly threatened by a virus infection, i.e., Potyviruses, the second largest genus of plant viruses which results in several million-dollar losses in various essential crops globally. Yam bean (Pachyrhizus erosus) is considered to be one of the essential tuberous legume crops holding a great potential source of starch. Yam Bean Mosaic Virus (YBMV) of Potyvirus group belonging to the family potyviridae affects Yam bean and several angiosperms both in the tropical and sub-tropical regions causing large economical losses in crops. In this study, we attempted to understand the sequence-structure relationship and mode of RNA binding mechanism in YBMV CP using in silico integrative modeling and all-atoms molecular dynamics (MD) simulations. The assembly of coat protein (CP) subunits from YBMV and the plausible mode of RNA binding were compared with the experimental structure of CP from Watermelon mosaic virus potyvirus (5ODV). The transmembrane helix region is present in the YBMV CP sequence ranging from 76 to 91 amino acids. Like the close structural-homolog, 24 CPs monomeric sub-units formed YBMV a conserved fold. Our computational study showed that ARG124, ARG155, and TYR151 orient towards the inner side of the virion, while, THR122, GLN125, SER92, ASP94 reside towards the outer side of the virion. Despite sharing very low sequence similarity with CPs from other plant viruses, the strongly conserved residues Ser, Arg, and Asp within the RNA binding pocket of YBMV CP indicate the presence of a highly conserved RNA binding site in CPs from different families. Using several bioinformatics tools and comprehensive analysis from MD simulation, our study has provided novel insights into the RNA binding mechanism in YBMV CP. Thus, we anticipate that our findings from this study will be useful for the development of new therapeutic agents against the pathogen, paving the way for researchers to better control this destructive plant virus.

The recombinogenic history of turnip mosaic potyvirus reveals its introduction to Japan in the 19th century.

Characterizing the detailed spatial and temporal dynamics of plant pathogens can provide valuable information for crop protection strategies. However, the epidemiological characteristics and evolutionary trajectories of pathogens can differ markedly from one country to another. The most widespread and important virus of brassica vegetables, turnip mosaic virus (TuMV), causes serious plant diseases in Japan. We collected 317 isolates of TuMV from Raphanus and Brassica plants throughout Japan over nearly five decades. Genomic sequences from these isolates were combined with published sequences. We identified a total of eighty-eight independent recombination events in Japanese TuMV genomes and found eighty-two recombination-type patterns in Japan. We assessed the evolution of TuMV through space and time using whole and partial genome sequences of both nonrecombinants and recombinants. Our results suggest that TuMV was introduced into Japan after the country emerged from its isolationist policy (1639–1854) in the Edo period and then dispersed to other parts of Japan in the 20th century. The results of our analyses reveal the complex structure of the TuMV population in Japan and emphasize the importance of identifying recombination events in the genome. Our study also provides an example of surveying the epidemiology of a virus that is highly recombinogenic.

Defects in plant immunity modulate the rates and patterns of RNA virus evolution.

It is assumed that host genetic variability for susceptibility to infection conditions virus evolution. Differences in host susceptibility can drive a virus to diversify into strains that track different defense alleles (e.g. antigenic diversity) or to infect only the most susceptible genotypes. Here, we have studied how variability in host defenses determines the evolutionary fate of a plant RNA virus. We performed evolution experiments with Turnip mosaic potyvirus in Arabidopsis thaliana mutants that had disruptions in infection-response signaling pathways or in genes whose products are essential for potyvirus infection. Plant genotypes were classified into five phenogroups according to their response to infection. We found that evolution proceeded faster in more restrictive hosts than in more permissive ones. Most of the phenotypic differences shown by the ancestral virus across host genotypes were removed after evolution, suggesting the combined action of selection and chance. When all evolved viral lineages were tested in all plant genotypes used in the experiments, we found compelling evidences that the most restrictive plant genotypes selected for more generalist viruses, while more permissive genotypes selected for more specialist viruses. Sequencing the genomes of the evolved viral lineages, we found that selection targeted the multifunctional genome-linked protein VPg in most host genotypes. Overall, this work illustrates how different host defenses modulate the rates and extent of virus evolution.

The effectiveness of the bacteria Rhizobium leguminosarum against bean yellow mosaic (BYMV) potyvirus infecting faba bean (Vicia faba L.) Plants.

The effectiveness of the bacteria Rhizobium leguminosarum against bean yellow mosaic (BYMV) potyvirus infecting faba bean (Vicia faba L.) Plants.

Genomic Epidemiology and Evolution of Scallion Mosaic Potyvirus From Asymptomatic Wild Japanese Garlic.

Scallion mosaic virus (ScaMV) belongs to the turnip mosaic virus phylogenetic group of potyvirus and is known to infect domestic scallion plants (Allium chinense) in China and wild Japanese garlic (Allium macrostemon Bunge) in Japan. Wild Japanese garlic plants showing asymptomatic leaves were collected from different sites in Japan during 2012–2015. We found that 73 wild Japanese garlic plants out of 277 collected plants were infected with ScaMV, identified by partial genomic nucleotide sequences of the amplified RT-PCR products using potyvirus-specific primer pairs. Sixty-three ScaMV isolates were then chosen, and those full genomic sequences were determined. We carried out evolutionary analyses of the complete polyprotein-coding sequences and four non-recombinogenic regions of partial genomic sequences. We found that 80% of ScaMV samples have recombination-like genome structure and identified 12 recombination-type patterns in the genomes of the Japanese ScaMV isolates. Furthermore, we found two non-recombinant-type patterns in the Japanese population. Because the wild plants and weeds may often serve as reservoirs of viruses, it is important to study providing the exploratory investigation before emergence in the domestic plants. This is possibly the first epidemiological and evolutionary study of a virus from asymptomatic wild plants.

Interspecific Recombination Between Zucchini Tigre Mosaic Virus and Papaya Ringspot Virus Infecting Cucurbits in China.

Recombination drives evolution of single-stranded RNA viruses and contributes to virus adaptation to new hosts and environmental conditions. Intraspecific recombinants are common in potyviruses, the largest family of single-stranded RNA viruses, whereas interspecific recombinants are rare. Here, we report an interspecific recombination event between papaya ringspot potyvirus (PRSV) and zucchini tigre mosaic potyvirus (ZTMV), two potyviruses infecting cucurbit crops and sharing similar biological characteristics and close phylogenetic relationship. The PRSV-ZTMV recombinants were detected through small RNA sequencing of viruses infecting cucurbit samples from Guangxi and Henan provinces of China. The complete nucleotide (nt) sequences of the interspecific recombinant viruses were determined using overlapping RT-PCR. Multiple sequence alignment, recombination detection analysis and phylogenetic analysis confirmed the interspecific recombination event, and revealed an additional intraspecific recombination event among ZTMV populations in China. The symptoms and host ranges of two interspecific recombinant isolates, KF8 and CX1, were determined through experimental characterization using cDNA infectious clones. Surveys in 2017 and 2018 indicated that the incidences of the interspecific recombinant virus were 16 and 19.4%, respectively, in cucurbits in Kaifeng of Henan province. The identified interspecific recombinant virus between PRSV and ZTMV and the novel recombination pattern with the recombination site in HC-pro in potyvirid provide insights into the prevalence and evolution of ZTMV and PRSV in cucurbits.

Development of a Viral RdRp-Assisted Gene Silencing System and Its Application in the Identification of Host Factors of Plant (+)RNA Virus.

Gene silencing induced by hairpin RNA or virus infection expression is one of the major tools in genetics studies in plants. However, when dealing with essential genes, virus-induced gene silencing (VIGS) and transgenic expression of hairpin RNA could lead to plant death, while transient expression of hairpin RNA in leaves is often less competent in downregulating target gene mRNA levels. Here, we developed a transient double-stranded RNA (dsRNA) expression system assisted by a modified viral RNA-dependent RNA polymerase (RdRp) in plant leaves. We show that this system is more effective in inducing gene silencing than the intron-spliced hairpin RNA expression. Furthermore, by using this system, we tested the role of the early secretory pathway during infection of Soybean mosaic potyvirus (SMV). We found that key components of the coat protein complex II vesicles are required for the multiplication of SMV. Overall, this dsRNA-based gene silencing system is effective in downregulating plant gene expression and can be used to identify host genes involved in plant-virus interactions.

DETECTION, BIOLOGICAL AND MOLECULAR CHARACTERIZATION OF SOME VIRUSES TRANSMITTED BY EDIBLE LEGUMINOUS SEEDS

Bu çalışma, 2017 yılında Türkiye’nin farklı illerindeki üreticilerden ve firmalardan temin edilen bakla, bezelye, mercimek ve nohut tohum örneklerinde Alfalfa mosaic alfamovirus (AMV), Bean yellow mosaic potyvirus (BpYMV), Cucumber mosaic cucumovirus (CMV) ve Pea seed-borne mosaic potyvirus (PSbMV) virüslerinin bulunma durumunun belirlenmesi ve tespit edilen virüslerin biyolojik ve moleküler karakterizasyonunun yapılması amacıyla gerçekleştirilmiştir.
 Tohum örneklerinde virüslerin saptanmasında, DAS-ELISA ve RT-PCR yöntemleri kullanılmıştır. Tespit edilen virüsler mekanik inokulasyonla test bitkilerine taşınarak biyolojik karakterizasyonu yapılmıştır. Daha sonra RT-PCR yöntemiyle çoğaltılan virüslerin CP gen bölgelerinin dizi analizleri yapılarak, MEGA programı vasıtasıyla dünya izolatlarıyla karşılaştırılmalı olarak filogenetik analizi gerçekleştirilmiştir.
 Bakla, mercimek ve nohut tohum örneklerinde virüslere rastlanırken, bezelye tohumlarında herhangi bir virüse rastlanmamıştır. Baklada PSbMV, Nohutta BYMV, CMV ve PSbMV virüsleri ülkemizde ilk kez belirlenmiştir. Biyolojik karakterizasyon çalışmalarında, AMV, BYMV, CMV ve PSbMV izolatları dünya izolatlarıyla farklılıklar ve benzerlikler göstermiştir. Ayrıca, dünya izolatlarıyla yüksek oranda nükleotit ve aminoasit benzerliği tespit edilmiştir.

Softening of Processed Plant Virus Infected Cucumis sativus L. Fruits

Texture softening of pickled cucumbers does not meet consumers’ quality expectations and leads to economic losses. The factor(s) triggering this phenomenon is still unknown. We investigated the importance of plant viruses such as Cucumber green mottle mosaic tobamovirus (CGMMV) and Zucchini yellow mosaic potyvirus (ZYMV) in the context of softening of pickles. Cucumber plants (Cucumis sativus) were infected by mechanical inoculation, grown under greenhouse conditions and tested positive for the viral infection by ELISA. The severity of virus infection was reflected in yield and symptom expression. Histological and morphological alterations were observed. All fruits were pasteurized, separately stored in jars and subjected to texture measurements after four, six and 12 months. CGMMV-infections were asymptomatic or caused mild symptoms on leaves and fruit, and texture quality was comparable to control. At the same time, fruits of ZYMV-infected plants showed severe symptoms like deformations and discoloration, as well as a reduction in firmness and crunchiness after pasteurization. In addition, histological alterations were detected in such fruits, possibly causing textural changes. We conclude that plant viruses could have a considerable influence on the firmness and crunchiness of pickled cucumbers after pasteurization. It is possible that the severity of symptom expression has an influence on texture properties.

An efficient papaya leaf distortion mosaic potyvirus vector for virus-induced gene silencing in papaya

Papaya (Carica papaya L.) is regarded as an excellent model for genomic studies of tropical trees because of its short generation time and its small genome that has been sequenced. However, functional genomic studies in papaya depend on laborious genetic transformations because no rapid tools exist for this species. Here, we developed a highly efficient virus-induced gene silencing (VIGS) vector for use in papaya by modifying an artificially attenuated infectious clone of papaya leaf distortion mosaic virus (PLDMV; genus: Potyvirus), PLDMV-E, into a stable Nimble Cloning (NC)-based PLDMV vector, pPLDMV-NC, in Escherichia coli. The target fragments for gene silencing can easily be cloned into pPLDMV-NC without multiple digestion and ligation steps. Using this PLDMV VIGS system, we silenced and characterized five endogenous genes in papaya, including two common VIGS marker genes, namely, phytoene desaturase, Mg-chelatase H subunit, putative GIBBERELLIN (GA)-INSENSITIVE DWARF1A and 1B encoding GA receptors; and the cytochrome P450 gene CYP83B1, which encodes a key enzyme involved in benzylglucosinolate biosynthesis. The results demonstrate that our newly developed PLDMV VIGS vector is a rapid and convenient tool for functional genomic studies in papaya.

A genome-wide association study identifies Arabidopsis thaliana genes that contribute to differences in the outcome of infection with two Turnip mosaic potyvirus strains that differ in their evolutionary history and degree of host specialization.

Viruses lie in a continuum between generalism and specialism depending on their ability to infect more or less hosts. While generalists are able to successfully infect a wide variety of hosts, specialists are limited to one or a few. Even though generalists seem to gain an advantage due to their wide host range, they usually pay a pleiotropic fitness cost within each host. On the contrary, a specialist has maximal fitness within its own host. A relevant yet poorly explored question is whether viruses differ in the way they interact with their hosts’ gene expression depending on their degree of specialization. Using a genome-wide association study approach, we have identified host genes whose expression depends on whether hosts were infected with more or less specialized viral strains. Four hundred fifty natural accessions of Arabidopsis thaliana were inoculated with Turnip mosaic potyvirus strains with different past evolutionary histories and that shown different degrees of specialization. Three disease-related traits were measured and associated with different sets of host genes for each strain. The genetic architectures of these traits differed among viral strains and, in the case of the more specialized virus, also varied along the duration of infection. While most of the mapped loci were strain specific, one shared locus was mapped for both strains, a disease-resistance TIR-NBS-LRR class protein. Likewise, only putative cysteine-rich receptor-like protein kinases were involved in all three traits. The impact on disease progress of 10 selected genes was validated by studying the infection phenotypes of loss-of-function mutant plants. Nine of these mutants have altered the disease progress and/or symptoms intensity between both strains. Compared to wild-type plants six had an effect on both viral strains, three had an effect only on the more specialized, and two were significant during infection with the less specialized.

Molecular characterisation of Pea seed borne mosaic poytvirus associated with apical rosette in field pea (Pisum sativum L.) in India

Symptoms of apical rosette were seen in field pea grown as winter season crop in India. Symptomatic leaves were processed for the identification of associated virus. The primers pair (PSbMV-F/PSbMV-R) targeting part of NIb gene of Pea seed borne mosaic potyvirus (PSbMV) was used in RT-PCR. The targeted fragment was successfully amplified cloned and sequenced. Sequencing of amplicons revealed it to be 795 bp long and identical to each other and hence only one was deposited to the NCBI database. Blast results of sequence showed it to be a portion of NIb region of the PSbMV and had 100–88.5% nt similarity with known isolates of the PSbMV. Phylogenetic analysis revealed that all the PSbMV isolates used group together. However, the PSbMV-IN:Knp isolate sub-clustered with the known PSbMV isolates of pathotype 1. This is the first report of the characterisation of an Indian isolate of PSbMV based on genomic sequence.

Detection of Bean yellow mosaic potyvirus in infected faba bean plants (Vicia faba L.) from Northern Egypt

The Bean yellow mosaic potyvirus (BYMV) was isolated from naturally infected faba bean plants (Vicia faba L.) showing different symptoms of mosaic, mottle, and vein clearing, grown at certain locations of El Beheira governorate, Egypt, during the growing seasons from 2018- 2019. BYMV isolate was transmitted by Acyrthosiphon pisum, Aphis faba, A. nerii Boyer, Brevicoryne brassicae and Dactynotus sonchi L. in non-persistent manner. The virus was partially purified using polyethylene glycol PEG 6000, and differential centrifugation. The ratio of A 260/280 was 1.47. Whereas, the ratio of A max/min was 0.93. Concentration of the virus in the preparation was estimated using an extinction coefficient of E260 0.1% = 2.8 Yield of purified virus was about 14.8 mg/100g fresh weight of leaves of Vicia faba. Antiserum titer was determined by indirect enzyme linked immunosorbent assay (ELISA). Positive ELISA values were obtained up to dilutions of 1: 256000. The virus was detected by indirect ELISA in infected sap at 8 and 16 days after inoculation and by tissue blot immunoassay (TBIA) and dot blot immunoassay (DBIA) on nitrocellulose membrane after the same period. The unused face of the processed nitrocellulose membrane already printed with plant tissues revealed that both faces of nitrocellulose membrane and old processed nitrocellulose membrane could be used as solid carriers in TBIA, for detection of BYMV in infected leaves.

Viruses in cucurbit seeds from on-line mail-order providers

Seeds of three important cucurbit species (cucumber, melon and zucchini) were obtained through on-line mail-order providers and tested for selected viruses of biosecurity and agronomic concern. One or more of the targeted viruses were detected in 23 of the 31 seed lots tested. The quarantine pest melon necrotic spot virus was detected by ELISA in melon seeds. Multiple instances of contamination with the quarantine pest cucumber green mottle mosaic virus were also detected, and its presence in seeds of all three plant species was confirmed by inoculation and re-isolation from indicator plants. Cucumber mosaic virus, squash mosaic virus and potyviruses were repeatedly detected, and instances of insect pest and plant trash contamination were also observed. Seeds imported into Australia from some on-line sources have potential to introduce organisms of biosecurity concern.

Genomic analysis of the brassica pathogen turnip mosaic potyvirus reveals its spread along the former trade routes of the Silk Road

Plant pathogens have agricultural impacts on a global scale and resolving the timing and route of their spread can aid crop protection and inform control strategies. However, the evolutionary and phylogeographic history of plant pathogens in Eurasia remains largely unknown because of the difficulties in sampling across such a large landmass. Here, we show that turnip mosaic potyvirus (TuMV), a significant pathogen of brassica crops, spread from west to east across Eurasia from about the 17th century CE. We used a Bayesian phylogenetic approach to analyze 579 whole genome sequences and up to 713 partial sequences of TuMV, including 122 previously unknown genome sequences from isolates that we collected over the past five decades. Our phylogeographic and molecular clock analyses showed that TuMV isolates of the Asian-Brassica/Raphanus (BR) and basal-BR groups and world-Brassica3 (B3) subgroup spread from the center of emergence to the rest of Eurasia in relation to the host plants grown in each country. The migration pathways of TuMV have retraced some of the major historical trade arteries in Eurasia, a network that formed the Silk Road, and the regional variation of the virus is partly characterized by different type patterns of recombinants. Our study presents a complex and detailed picture of the timescale and major transmission routes of an important plant pathogen.