Male Morphological Characters Research Articles

Camel spider trait evolution demonstrates repeated patterns of convergence (Arachnida: Solifugae: Eremobatidae)

Abstract Morphology has long been used to classify and identify living organisms. However, taxonomic descriptions are often limited to qualitative descriptions of size and shape, making identification difficult due to the subjective language used to describe complex shapes. Additionally, for some taxa, there are few reliable qualitative characters available for delimitation that have yet to be tested objectively in a phylogenetic context. Solifugae is one such example. The order, Solifugae, is recognized from the other arachnid orders by the possession of large, powerful jaws or chelicerae. Male cheliceral morphology is the leading diagnostic character system in solifuge systematics and is the basis for much of solifuge current taxonomy. Female chelicerae, on the other hand, are reportedly deeply conserved and much of the species identification is based on female operculum morphology. To elucidate patterns of chelicerae and opercula trait evolution within the solifuge family, Eremobatidae, we used a 2-dimenstional morphological analysis using an Elliptical Fourier approach for closed outlines, in addition to an analysis of traditionally used measures in a phylogenetic context. Using ancestral state reconstruction and ultra-conserved elements, we assessed the taxonomic utility of female cheliceral and opercular morphology, and we evaluated which male morphological characters reflect shared, derived ancestry. Investigation into ubiquitously used character sets, in addition to newly proposed characters herein, illustrates the complex evolution of traits with high levels of convergence. Our results provide taxonomic insight into future, higher level taxonomic revisions of Eremobatidae.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) μm, body width (BW) = 433.73 ±12.84 (343.71-551.61) μm, stylet length = 15.64 ± 1.45 (10.86-28.26) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) μm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) μm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) μm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) μm, BW = 33.60 ± 0.79 (30.21-36.52) μm, stylet length = 23.63 ± 0.78 (20.14-26.37) μm, DGO = 3.04 ± 0.09 (2.69-3.38) μm, spicule length = 25.72 ± 0.57 (23.97-28.33) μm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) μm, BW = 15.14 ± 0.26 (13.91-16.66) μm, stylet length = 13.44 ± 0.29 (10.96-14.60) μm, DGO = 2.13 ± 0.18 (1.22-3.10) μm, tail length = 57.46 ± 4.89 (38.85-101.33) μm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) μm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Three new species of the primitively segmented spider genus Songthela (Mesothelae, Liphistiidae, Heptathelinae) from Hunan Province, China.

Three new species of the primitively segmented spider genus Songthela Ono, 2000 are identified and described from Hunan Province, China, based on morphological characters of males and females: S.anhua Zhang & Xu, sp. nov. (♂♀), S.longhui Zhang & Xu, sp. nov. (♂♀), and S.zhongpo Zhang & Xu, sp. nov. (♂♀). All the new Songthela species belong to the multidentata-group according to male palp and female genital morphology.

Phylogenetic Analysis of the Genus Planaphrodes Hamilton (Hemiptera, Cicadellidae, Aphrodinae) Based on Morphological Characteristics, with Revision of Species from China, Korea and Japan

A morphology-based phylogeny of the Holarctic leafhopper genus Planaphrodes Hamilton is reconstructed for the first time based on 39 discrete male adult morphological characters. The results support the monophyly of Planaphrodes, with the included species forming two monophyletic lineages defined mainly by the number and location of aedeagus processes. The position of Planaphrodes in the Aphrodini was resolved as follows: (Stroggylocephalus + (Anoscopus + (Planaphrodes + Aphrodes))). The fauna of Planaphrodes from China, Japan and Korea are reviewed and six species are recognized, including two new species: P. bifasciatus (Linnaeus), P. sahlbergii (Signoret), P. nigricans (Matsumura), P. laevus (Rey), P. baoxingensis sp. nov. (China: Sichuan) and P. faciems sp. nov. (China: Hubei). Acocephalus alboguttatus Kato, 1933 syn. nov. and Aphrodes daiwenicus Kuoh, 1981 syn. nov. are considered junior synonyms of Planaphrodes sahlbergii (Signoret, 1879). Planaphrodes bella Choe, 1981 is a junior synonym of Planaphrodes nigricans (Matsumura, 1912). A checklist and key to species of Planaphrodes are provided.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) μm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) μm, stylet = 11.11 ± 0.73 (10.05-12.29) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) μm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) μm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) μm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) μm, BW = 28.44 ± 1.18 (26.59-29.83) μm, stylet = 18.27 ± 0.97 (16.57-19.28) μm, DGO = 4.89 ± 0.62 (3.82-5.68) μm, and spicule length = 24.04 ± 1.80 (21.30-26.71) μm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) μm, BW = 13.94 ± 0.70 (12.88-15.34) μm, stylet = 11.82 ± 0.49 (10.96-12.61) μm, DGO = 3.68 ± 0.42 (3.09-4.56) μm, tail length = 55.42 ± 5.81 (46.97-67.03) μm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) μm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

Redescription of the giant Southeast Asian millipede Spirobolusmacrurus Pocock, 1893 and its assignment to the new genus Macrurobolus gen. nov. (Diplopoda, Spirobolida, Pachybolidae).

A new genus of the millipede family Pachybolidae from Southeast Asia is described: Macrurobolusgen. nov., with Spirobolusmacrurus Pocock, 1893 as type species. This latter species is DNA barcoded (COI) and redescribed based on male morphological characters, which hitherto were unknown. The new genus differs from other pachybolid genera by having (1) the preanal ring process long and protruding beyond the anal valves and (2) the anterior gonopod telopodite distally abruptly narrowed, forming an extremely long, slender, elevated process curved caudad. Given that Macrurobolusgen. nov. is a monotypic genus, it is aphyletic and thus requires further taxonomic revision.

Divergence and correlated evolution of male wing spot and courtship display between Drosophila nepalensis and D. trilutea.

Male-specific wing spots are usually associated with wing displays in the courtship behavior of Drosophila and may play important roles in sexual selection. Two closely related species, D. nepalensis and D. trilutea, differ in wing spots and scissoring behavior. Here, we compare male morphological characters, pigmentation intensity of male wing spots, wing-scissoring behavior, courtship songs, and reproductive isolation between 2 species. F1 fertile females and sterile males result from the cross between females of D. nepalensis and males of D. trilutea. The pigmentation of wing spots is significantly weaker in D. trilutea than in D. nepalensis and the F1 hybrid. Males scissor both wings in front of the female during courtship, with a posture spreading wings more widely, and at a faster frequency in D. nepalensis than in D. trilutea and the F1s. Males of D. trilutea vibrate wings to produce 2 types (A and B) of pulse songs, whereas D. nepalensis and the F1s sing only type B songs. The incidence of wing vibration and scissoring during courtship suggests that wing vibration is essential but scissoring is a facultative courtship element for successful mating in both species. The association between the darker wing spots with more elaborate scissoring might be the consequence of correlated evolution of these traits in D. nepalensis; however, D. trilutea retains wing scissoring during courtship despite having weaker pigmentation of wing spots. The genetic architecture of 2 traits differs in the F1s, consistent with maternal or sex-linked effects for spots but nonadditive effects for scissoring.

Delimitation of the segmented trapdoor spider genus Luthela gen. nov., with comments on the genus Sinothela from northern China (Araneae, Mesothelae, Liphistiidae).

A new genus of the primitively segmented trapdoor spiders, which is endemic to the north of China, is described, Luthela gen. nov., and the status of Sinothela Haupt, 2003 and Sinothela sinensis (Bishop Crosby, 1932) is discussed and both are treated as nomina dubia. The new genus Luthela gen. nov. is erected based on morphology and molecular data of the type species Luthela yiyuan sp. nov. A taxonomic revision of the new genus is given. Three Sinothela species are transferred to the new genus, L. luotianensis comb. nov. and L. schensiensis comb. nov. are redescribed using our newly collected specimens, include L. heyangensis comb. nov. as a junior synonym of L. schensiensis comb. nov., and describe six new species based on both male and female morphological characters: L. badong sp. nov., L. dengfeng sp. nov., L. handan sp. nov., L. taian sp. nov., L. yiyuan sp. nov., and L. yuncheng sp. nov.

New and little known species of moth flies (Diptera: Psychodidae: Psychodinae) from Nicaragua

The male of a new species Arisemus venustus sp. n. from Nicaragua, the Cerro Musun Natural Reserve, is described. A. atrasetus (Rapp, 1945) and Platyplastinx tango Quate et Brown, 2004 (Diptera: Psychodidae: Psychodinae) from Nicaragua are redescribed and illustrated on the basis of male morphological characters.

Taxonomic notes on owlflies from Pakistan (Neuroptera: Myrmeleontidae: Ascalaphinae).

Taxonomic notes are presented on the former Ascalaphidae (owlflies), now subfamily Ascalaphinae of the family Myrmeleontidae from Pakistan. An updated checklist of new records is provided that accounts for all known 15 genera and 22 species from Pakistan, excluding the species of the tribe Palparini. Geographical distribution maps and an updated identification key to all known genera and species from Pakistan are also given. We synonymized two monotypic genera, Horischema Mészáros Ábrahám, 2003 and Perissoschema Mészáros Ábrahám, 2003 both as junior synonyms of Ogcogaster Westwood, 1847 based on very similar male genitalia and external morphological characters. Moreover, Perissoschema evae Mészáros Ábrahám, 2003 is treated as a junior synonym of Ogcogaster segmentator Westwood, 1847. We recorded three genera for the first time from Pakistan, i.e., Acheron Lefèbvre, 1842, Glyptobasis McLachlan, 1873, and Suphalomitus van der Weele, 1909. To more completely resolve the generic or specific status of those poorly known species from Pakistan, broader sampling throughout the country is needed.

DNA barcoding of Austrian snow scorpionflies (Mecoptera, Boreidae) reveals potential cryptic diversity in Boreus westwoodi.

BackgroundSnow scorpionflies (genus Boreus) belong to a family of Mecoptera, Boreidae, that has been vastly neglected by entomological researchers due to their shift in seasonality to the winter months. Their activity during this time is regarded as a strategy for predator avoidance and regular sightings on snow fields suggest that this also facilitates dispersal. However, many aspects about snow scorpionflies, especially systematics, taxonomy, distribution of species, phylogenetics and phylogeography have remained fairly unexplored until today. In this study, we fill some of these gaps by generating a reference DNA barcode database for Austrian snow scorpionflies in the frame of the Austrian Barcode of Life initiative and by characterising morphological diversity in the study region.MethodsInitial species assignment of all 67 specimens was based on male morphological characters previously reported to differ between Boreus species and, for females, the shape of the ovipositor. DNA barcoding of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene was carried out for all 67 samples and served as a basis for BIN assignment, genetic distance calculations, as well as alternative species delimitation analyses (ABGD, GMYC, bGMYC, bPTP) and a statistical parsimony network to infer phylogenetic relationships among individual samples/sampling sites.ResultsMorphological investigations suggested the presence of both Boreus hyemalis and Boreus westwoodi in Austria. DNA barcoding also separated the two species, but resulted in several divergent clades, the paraphyly of B. westwoodi in Austria, and high levels of phylogeographic structure on a small geographic scale. Even though the different molecular species delimitation methods disagreed on the exact number of species, they unequivocally suggested the presence of more than the traditionally recognized two Boreus species in Austria, thus indicating potential cryptic species within the genus Boreus in general and especially in B. westwoodi.

A new species of Zalepidota Rübsaamen, 1908 (Diptera, Cecidomyiidae) on Piper vicosanum (Piperaceae), an endemic plant to Brazil

Zalepidota distincta sp. nov. (Diptera, Cecidomyiidae) is described based on male, female, pupa and larva morphological characters. The new species induces galls on Piper vicosanum (Piperaceae), an endemic plant to Brazil. Types (mounted on slides) were deposited in the Entomological Collection of the Museu Nacional/Universidade Federal do Rio de Janeiro. Illustrations of the most relevant morphological characters are provided. The new species has some morphological characters that differ from those of the genus diagnosis. Therefore, the concept of Zalepidota was broadened.

Synonymisation of the male-based ant genus

Although molecular data have proven indispensable in confidently resolving the phylogeny of many clades across the tree of life, these data may be inaccessible for certain taxa. The resolution of taxonomy in the ant subfamily Leptanillinae is made problematic by the absence of DNA sequence data for leptanilline taxa that are known only from male specimens, including the monotypic genus Phaulomyrma Wheeler & Wheeler. Focusing upon the considerable diversity of undescribed male leptanilline morphospecies, the phylogeny of 35 putative morphospecies sampled from across the Leptanillinae, plus an outgroup, is inferred from 11 nuclear loci and 41 discrete male morphological characters using a Bayesian total-evidence framework, with Phaulomyrma represented by morphological data only. Based upon the results of this analysis Phaulomyrma is synonymised with Leptanilla Emery, and male-based diagnoses for Leptanilla that are grounded in phylogeny are provided, under both broad and narrow circumscriptions of that genus. This demonstrates the potential utility of a total-evidence approach in inferring the phylogeny of rare extant taxa for which molecular data are unavailable and begins a long-overdue systematic revision of the Leptanillinae that is focused on male material.

Redescription of Armillipora Quate (Diptera: Psychodidae: Psychodinae) with a new species from Bolivia.

The former monotypic genus Armillipora Quate, known only from Costa Rica and Panama, is redescribed, including the type species A. selvica Quate, this time collected on the Caribbean side of Nicaragua, RAAN department, and illustrated based on male morphological characters. The male of a new species, A. suapiensis sp. nov., from Bolivia, La Paz department, is described here and also figured.

The Mosquitoes of Prešov Town (Slovakia) – a pilot study

Abstract Mosquitoes and in particular their impact on human life and health are often the subject of applied research. Nevertheless, at present, basic research in this area, especially in cities seems to be neglected. This paper aims to bridge, at least in part, the gap in the knowledge of mosquito fauna at the local level and summarizes results of mosquitoes research in the Prešov town based on male morphological characters. In total, the presence of eight species of mosquitoes was confirmed in the study area (literary data and new records) which represents 15 % of the Slovak mosquito biodiversity.

Reevaluation of species richness in Winnertzia (Diptera, Cecidomyiidae, Winnertziinae), with descriptions of 37 new species from Sweden, Peru and Australia

Tentative studies of Malaise trap samples from different geographic regions and habitats indicate unanimously that Winnertzia, a genus of mycophagous gall midges (Cecidomyiidae), is exceptionally speciose, but hard data in proof of that were previously unavailable. A taxonomic inventory of mycophagous cecidomyiids in Sweden has now revealed that, of 751 species found in total, 93 are Winnertzia. A preliminary census in 2013 had identified only 26 different Winnertzia in Sweden. Two factors are responsible for this increment: the inclusion of large amounts of fresh material to study and the application of a narrower species concept. The latter results from the reevaluation of male morphological characters in the light of COI sequence (DNA barcoding) data. With the inclusion of 37 new Winnertzia described here, the genus now contains 136 extant species. New Winnertzia discovered in Sweden are described here under the following names: W. acutistylus sp. nov., W. angustistylus sp. nov., W. arctostylus sp. nov., W. bicolor sp. nov., W. brachytarsus sp. nov., W. dentata sp. nov., W. egregia sp. nov., W. ekdalensis sp. nov., W. fraxinophila sp. nov., W. grytsjoenensis sp. nov., W. hamatula sp. nov., W. hemisphaerica sp. nov., W. imbecilla sp. nov., W. incisa sp. nov., W. inornata sp. nov., W. lapponica sp. nov., W. lobata sp. nov., W. longicoxa sp. nov., W. normalis sp. nov., W. oelandica sp. nov., W. ombergensis sp. nov., W. parvidens sp. nov., W. pilosistylus sp. nov., W. pratensis sp. nov., W. pustulatula sp. nov., W. quercinophila sp. nov., W. rickebasta sp. nov., W. ruliki sp. nov., W. serri sp. nov., W. setosa sp. nov., W. silvestris sp. nov., W. smalandensis sp. nov., W. sundini sp. nov., W. tumidoides sp. nov., and W. upplandensis sp. nov. Additionally, W. panguana sp. nov. is the first Winnertzia described from the Neotropical region (Peru), and W. warraensis sp. nov. is the first member of the genus described from the Australasian region (Tasmania). Parwinnertzia Felt, 1920 syn. nov. is revealed to be a junior synonym of Winnertzia Rondani, 1860, implying the recombinations of Winnertzia notmani (Felt) comb. nov. and Winnertzia italiana (Mamaev Zaitzev) comb. nov. The intrageneric classification of Winnertzia is reviewed and developed further, with the W. setosa group introduced for species whose gonostylar claw is conspicuously long and exposed, and whose gonocoxal emargination is bordered by dense, large setae. Winnertzia feralis Mamaev, revived here from synonymy with W. tridens Panelius, and W. fusca Kieffer are new faunistic records in Sweden. Swedish records published in the past of W. brachypalpa Mamaev and W. pravdini Mamaeva Mamaev rest on misidentifications, and both species are deleted from the Swedish checklist.

Taxonomic revision of Telemidae (Arachnida, Araneae) from East and Southeast Asia.

Species of the spider family Telemidae Fage, 1913 from East and Southeast Asia are revised. Four new genera are erected: Mekonglema Zhao & Li, gen. nov. with the type species Mekonglema bailang Zhao & Li, sp. nov. (♂♀, Yunnan, China), Siamlema Zhao & Li, gen. nov. with the type species Siamlema changhai Zhao & Li, sp. nov. (♂♀, southern Thailand), Sundalema Zhao & Li, gen. nov. with the type species Sundalema bonjol Zhao & Li, sp. nov. (♂♀, Sumatra), and Zhuanlema Zhao & Li, gen. nov. with the type species Zhuanlema peteri Zhao & Li, sp. nov. (♂♀, northern Laos). Eight additional new species are described: Mekonglema kaorao Zhao & Li, sp. nov. (♂♀, northern Laos), M. walayaku Zhao & Li, sp. nov. (♂♀, Yunnan, China), M. yan Zhao & Li, sp. nov. (♂♀, Yunnan, China), Pinelema daguaiwan Zhao & Li, sp. nov. (♂♀, Guangxi, China), P. shiba Zhao & Li, sp. nov. (♂♀, Guangxi, China), P. tham Zhao & Li, sp. nov. (♂♀, northern Laos), Siamlema suea Zhao & Li, sp. nov. (♂♀, southern Thailand), and Sundalema khaorakkiat Zhao & Li, sp. nov. (♂♀, southern Thailand). Thirty species are transferred from the genus Telema Simon, 1882 to the genera Pinelema Wang & Li, 2012, Sundalemagen. nov., and Telemofila Wunderlich, 1995. Seychellia xinpingi Lin & Li, 2008 is transferred to Mekonglemagen. nov. as M. xinpingicomb. nov. Furthermore, the genus Pinelema is divided into seven species groups based on male morphological characters.

A new species and new distribution records of Zercon C. L. Koch from Iran (Acari: Zerconidae)

A new species of the family Zerconidae, Zercon persicus sp. n., is described based on female and male morphological characters. It was collected in West Azarbaijan province (northwestern Iran). Idiosomal chaetotaxy, poroidotaxy and related notations are illustrated. The similarities and differences between the related species within the genus are discussed. Records of some other Zercon species from the province are given for the first time.http://www.zoobank.org/urn:lsid:zoobank.org:pub:3D1122C7-2B86-40D2-974E-EE69035A2413

The first record of Amaurobius C.L. Koch, 1837 (Araneae, Amaurobiidae) from China, with description of two new species.

Two new species of Amaurobius from China, A. songi sp. nov. and A. spinatus sp. nov. are described on morphological characters of males and females. They are generally very similar to all known Amaurobius species from India, Europe and North America but differ in some details of the copulatory organs. The two species represent the first record of Amaurobius in China.

Sperm morphology, sperm motility and paternity success in the bluethroat (Luscinia svecica).

Postcopulatory sexual selection may select for male primary sexual characteristics like sperm morphology and sperm motility, through sperm competition or cryptic female choice. However, how such characteristics influence male fertilization success remains poorly understood. In this study, we investigate possible correlations between sperm characteristics and paternity success in the socially monogamous bluethroat (Luscinia svecica svecica), predicting that sperm length and sperm swimming speed is positively correlated with paternity success. In total, 25% (15/61) of broods contained extra-pair offspring and 10% (33/315) of the offspring were sired by extra-pair males. Paternity success did not correlate significantly with sperm morphology or any aspects of sperm motility. Furthermore, sperm morphology and sperm motility did not correlate significantly with male morphological characters that previously have been shown to be associated with paternity success. Thus, the sperm characteristics investigated here do not appear to be strong predictors of paternity success in bluethroats.