Morphogenic Pathways Research Articles

The ubiquitin ligase Nedd4 regulates craniofacial development by promoting cranial neural crest cell survival and stem-cell like properties

The integration of multiple morphogenic signalling pathways and transcription factor networks is essential to mediate neural crest (NC) cell induction, delamination, survival, stem-cell properties, fate choice and differentiation. Although the transcriptional control of NC development is well documented in mammals, the role of post-transcriptional modifications, and in particular ubiquitination, has not been explored. Here we report an essential role for the ubiquitin ligase Nedd4 in cranial NC cell development. Our analysis of Nedd4−/− embryos identified profound deficiency of cranial NC cells in the absence of structural defects in the neural tube. Nedd4 is expressed in migrating cranial NC cells and was found to positively regulate expression of the NC transcription factors Sox9, Sox10 and FoxD3. We found that in the absence of these factors, a subset of cranial NC cells undergo apoptosis. In accordance with a lack of cranial NC cells, Nedd4−/− embryos have deficiency of the trigeminal ganglia, NC derived bone and malformation of the craniofacial skeleton. Our analyses therefore uncover an essential role for Nedd4 in a subset of cranial NC cells and highlight E3 ubiquitin ligases as a likely point of convergence for multiple NC signalling pathways and transcription factor networks.

SAT0026 Combined inhibition of notch, hedgehog and wnt signaling exerts additive anti-fibrotic effects and reduces toxicity

BackgroundRecent studies demonstrated that the morphogenic pathways Notch, hedgehog (Hh) and Wnt are activated in systemic sclerosis and that inhibition of these morphogen pathways exerted potent anti-fibrotic effects in different...

SP0069 Molecular targets for therapy in systemic sclerosis

Several key-pathways for the aberrant activation of fibroblasts in systemic sclerosis (SSc) have been identified in preclinical studies during the last years. The presentation will summerize recently identified molecular targets...

Vasohibin-1 Expression Is Regulated by Transforming Growth Factor-β/Bone Morphogenic Protein Signaling Pathway Between Tumor-Associated Macrophages and Pancreatic Cancer Cells

Vasohibin-1 has been detected in endothelial cells as an intrinsic angiogenesis inhibitor. Both tumor-associated macrophages (TAMs) and transforming growth factor-β (TGF-β)/bone morphogenic protein (BMP) signaling have been reported to promote angiogenesis in cancer. However, whether vasohibin-1 expression is regulated by TGF-β/BMP signaling between TAMs and cancer cells remains unclear. The expression of TGF-β1, TGF-β2, BMP-4, and BMP-7 in TAMs and the expression of vasohibin-1, vascular endothelial growth factor-A (VEGF-A), and VEGF-C in two pancreatic cancer cell lines (a nonmetastatic cell line Panc-1 and a distant metastatic cell line HPAF-II) were measured by real-time reverse transcription-polymerase chain reaction (RT-PCR). The TGF-β receptor 1 and BMP receptor 1 were inhibited by the inhibitor SB-431542 and LDN193189, respectively. Thereafter, vasohibin-1, VEGF-A, and VEGF-C expression was detected by real-time RT-PCR. We found that the expression of TGF-β1, TGF-β2, BMP-4, and BMP-7 was upregulated in TAMs cocultured with pancreatic cancer cells. Vasohibin-1, VEGF-A, and VEGF-C mRNA expression in pancreatic cancer cells was upregulated by TAMs. Vasohibin-1 expression in pancreatic cancer cells cocultured with TAMs was upregulated significantly when TGF-β receptors or BMP receptors were inhibited, but VEGF-C expression was downregulated. Therefore, Vasohibin-1 expression is regulated by the TGF-β/BMP signaling between TAMs and pancreatic cancer cells. These results might shed a new light on the antiangiogenesis therapy in the pancreatic cancer.

Post-Embryonic Transcriptomes of the Prawn Macrobrachium rosenbergii: Multigenic Succession through Metamorphosis

Like many metazoans, the freshwater prawn Macrobrachium rosenbergii begins its post-embryonic life with a set of morphologically distinct planktonic larval stages, followed by a benthic post-larval stage during which the maturing organism differs from the larvae both ecologically and physiologically. Understanding of the molecular basis underlying morphogenesis in crustaceans is limited to the observation that methyl farnesoate, the non-epoxidated form of the insect juvenile hormone, acts as the active crustacean juvenoid. Molt steroids were also linked to morphogenesis and several other molecular pathways, such as Hedgehog and Wnt, are known to underlie morphogenesis in all metazoans examined and, as such, are thought to do the same in crustaceans. Using next generation sequencing, we deep-sequenced the transcriptomes of several larval and post-larval stages. De novo assembly, followed by bioinformatics analysis, revealed that many novel transcripts are over-expressed in either larvae- or post-larvae-stage prawn, shedding light on the molecular basis underlying M. rosenbergii metamorphosis. Fast larval molting rates and periodic morphological changes were reflected in over-expression of transcripts annotated to the cell cycle, DNA replication and morphogenic pathways (i.e., Hedgehog and Wnt). Further characterization of transcripts assigned to morphogenic pathways by real-time RT-PCR reconfirmed their over-expression in larvae, albeit with a more complex expression pattern when examined in the individual developmental stages. The expression level of an orthologue of cytochrome P450, 15A1, known to epoxidize methyl farnesoate in insects, was increased in the late larval and early post-larval stages, in accordance with the role of methyl farnesoate in crustacean metamorphosis. This study exemplifies the applicability of a high-throughput sequencing approach for studying complex traits, including metamorphosis, providing new insight into this unexplored area of crustacean research.

Wnt Signaling Regulates Intermediate Precursor Production in the Postnatal Dentate Gyrus by Regulating Cxcr4 Expression

Previous studies have examined the role of diverse signaling pathways in dentate neurogenesis, but how these signaling pathways are integrated remains unknown. Using mice that allow genetic manipulation of type 1 radial progenitors in the dentate, we show that forced induction of Wnt signaling leads to expansion of the intermediate progenitor cell (IPC) pool while selective activation of Sonic hedgehog (Shh) signaling drives neurogenesis without significant expansion of IPCs. Thus, both Wnt and Shh signaling are proneurogenic, but they act in distinct manners when their signaling is forced in subgranular zone radial progenitors. We examined potential targets of the Wnt pathway in these cells and found that Cxcr4 is a direct target of Lef1 in dentate gyrus progenitors and that loss of Cxcr4 in postnatal neurogenesis decreases the production of IPCs. This suggests that Wnt activation of dentate gyrus progenitors induces Cxcl12 signaling by regulating receptor expression. This study provides evidence that distinct morphogenic pathways have notably different roles in regulating ongoing dentate neurogenesis.

Morphogen Pathways in Systemic Sclerosis

The morphogen pathways Wnt, hedgehog, and Notch are key regulators of organ development and tissue homeostasis. In adults, the tightly regulated activity of morphogen pathways is essential for cell renewal and tissue regeneration. Loss of control and persistent activation of morphogen pathways, however, can lead to a variety of diseases, including malignancy and fibrotic disorders. In recent years, pathological activation of Wnt, hedgehog, and Notch pathways have been described in systemic sclerosis (SSc) and other fibrotic diseases. Experimental models reveal that morphogen pathways drive fibroblast activation and collagen release. In these model systems, genetic or pharmacological blockade of morphogen pathways inhibits collagen release and reduces experimental fibrosis. Importantly, inhibitors for Wnt, hedgehog, and Notch are already in clinical evaluation, thereby emphasizing the translational implications of these findings. Further experimental studies, however, should deepen our knowledge before initiating clinical trials with inhibitors of morphogen pathways.

Morphogen pathways as molecular targets for the treatment of fibrosis in systemic sclerosis

Wnt-, Hedgehog- and Notch-signaling cascades are morphogen pathways that play crucial roles in development and tissue homeostasis. While morphogen pathways are tightly regulated at multiple levels, inappropriate activation of Wnt, Hedgehog and Notch signaling has been implicated into the pathogenesis of various diseases. In particular, Wnt, Hedgehog and Notch signaling have emerged as central players in the pathogenesis of fibrotic diseases. Here, we will review the pro-fibrotic effects of Wnt, Hedgehog and Notch signaling in systemic sclerosis (SSc), prototypical systemic fibrotic disease. Wnt, Hedgehog and Notch pathways are activated in SSc. They potently stimulate fibroblasts to differentiate into myofibroblasts and to release collagen and other extracellular matrix components. Genetic or pharmacological inhibition of morphogen pathways effectively prevents experimental fibrosis in different preclinical models and induces regression of pre-established fibrosis. As several inhibitors of Wnt, Hedgehog and Notch have recently been developed with first ones being already approved for clinical trials, morphogen pathways maybe a novel approach for the treatment of fibrosis.

Establishing epithelial glandular polarity: interlinked roles for ARF6, Rac1, and the matrix microenvironment

Epithelial cysts comprise the structural units of the glandular epithelium. Although glandular inversion in epithelial tumors is thought to be a potential mechanism for the establishment of metastatic disease, little is known about the morphogenic cues and signaling pathways that govern glandular polarity and organization. Using organotypic cultures of Madin-Darby canine kidney cells in reconstituted basement membrane, we show that cellular depletion of the small GTP-binding protein ARF6 promotes the formation of inverted cysts, wherein the apical cell membrane faces the cyst exterior, and the basal domain faces the central lumen, while individual cell polarity is maintained. These cysts are also defective in interactions with laminin at the cyst-matrix interface. This inversion of glandular orientation is accompanied by Rac1 inactivation during early cystogenesis, and temporal activation of Rac1 is sufficient to recover the normal cyst phenotype. In an unnatural collagen I microenvironment, ARF6-depleted, inverted epithelial cysts exhibit some loss of cell polarity, a marked increase in Rho activation and Rac1 inactivation, and striking rearrangement of the surrounding collagen I matrix. These studies demonstrate the importance of ARF6 as a critical determinant of glandular orientation and the matrix environment in dictating structural organization of epithelial cysts.

Pre-procambial cells are niches for pluripotent and totipotent stem-like cells for organogenesis and somatic embryogenesis in the peach palm: a histological study

The direct induction of adventitious buds and somatic embryos from explants is a morphogenetic process that is under the influence of exogenous plant growth regulators and its interactions with endogenous phytohormones. We performed an in vitro histological analysis in peach palm (Bactris gasipaes Kunth) shoot apexes and determined that the positioning of competent cells and their interaction with neighboring cells, under the influence of combinations of exogenously applied growth regulators (NAA/BAP and NAA/TDZ), allows the pre-procambial cells (PPCs) to act in different morphogenic pathways to establish niche competent cells. It is likely that there has been a habituation phenomenon during the regeneration and development of the microplants. This includes promoting the tillering of primary or secondary buds due to culturing in the absence of NAA/BAP or NAA/TDZ after a period in the presence of these growth regulators. Histological analyses determined that the adventitious roots were derived from the dedifferentiation of the parenchymal cells located in the basal region of the adventitious buds, with the establishment of rooting pole, due to an auxin gradient. Furthermore, histological and histochemical analyses allowed us to characterize how the PPCs provide niches for multipotent, pluripotent and totipotent stem-like cells for vascular differentiation, organogenesis and somatic embryogenesis in the peach palm. The histological and histochemical analyses also allowed us to detect the unicellular or multicellular origin of somatic embryogenesis. Therefore, our results indicate that the use of growth regulators in microplants can lead to habituation and to different morphogenic pathways leading to potential niche establishment, depending on the positioning of the competent cells and their interaction with neighboring cells. Our results indicate that the use of growth regulators in microplants can lead to habituation and to different morphogenic pathways leading to potential niche establishment, depending on the positioning of the competent cells and their interaction with neighboring cells.

Cilia - the prodigal organelle

Cilia - the prodigal organelle

Buschke-Ollendorff syndrome associated with hypertrophic scar formation: a possible role for LEMD3 mutation

Funding sources: none. Conflicts of interest: none declared. Madam, Buschke–Ollendorff syndrome (BOS; OMIM 166700) is a rare autosomal dominant condition characterized by the development of multiple connective tissue naevi in association with osteopoikilosis and occasionally melorheostosis.1 The clinical expression of this syndrome is quite variable; skin and skeletal lesions may arise independently in affected family members.2 BOS results from loss‐of‐function mutations in the LEMD3 gene, which encodes a potent negative regulator of transforming growth factor (TGF)‐β and bone morphogenic protein signalling pathways;1 the pathogenetic role played by LEMD3 defects in BOS is not fully understood. We report a Japanese family with BOS associated with hypertrophic scar (HS) after traumatic injury. A 5‐year‐old boy presented with asymptomatic multiple cutaneous nodules on his trunk. The lesions had gradually increased in number since they were first noticed on his lower back when he was 5 months old. On physical examination, multiple flesh‐coloured round or oval cutaneous plaques were noted on his abdomen (Fig. 1a) and lower back (Fig. 1b). The lesions were asymmetrically distributed and covered by normal‐appearing skin. There were firm, nodular hypertrophic lesions on his left knee (Fig. 1d) and glabella. These lesions were reported to have arisen after traumatic injury. Lesional skin biopsy from the lower back of the proband revealed increased levels of collagen in the dermis extending into the subcutaneous fat (Fig. 1c). Notably, HS formed at the biopsy incision as it healed. Physical examination of the other family members demonstrated that the proband’s father and elder sister had, to a lesser extent, similar skin plaques on their lower backs, presenting as connective tissue naevi, whereas the mother had no significant skin involvement. Hypertrophic skin lesions at sites of injury, reportedly less elevated than ∼10 years before, were seen on the upper left arm of the father (Fig. 1e) and the right knee of the sister. Neither the collagenous naevi nor the HS lesions followed known cutaneous segments such as Blaschko’s lines. X‐rays of the long bones and pelvis revealed osteopoikilosis, which was distributed symmetrically, in the father (Fig. 1f), but not in the proband. In the affected family members, routine laboratory examinations were within normal limits. Based on these findings, we made a diagnosis of BOS associated with HS. Reverse transcription–polymerase chain reaction (RT‐PCR) was performed as follows: the partial cDNA of LEMD3, spanning exons 5–9, was RT‐PCR amplified from total RNA extracted from peripheral blood leucocytes using an RNeasy extraction kit (Qiagen, Hilden, Germany). Reverse transcription with 0·25 μg of total RNA was carried out using the reverse transcriptase ReverTra Ace™ (Toyobo, Osaka, Japan). First‐strand cDNAs were synthesized by incubation for 10 min at 30 °C, 20 min at 42 °C, 5 min at 99 °C, and 5 min at 4 °C. cDNA for exons 5–9 was PCR amplified using the following specific primers: forward 5′‐TTGGAATAAGGTGTGTTGGT‐3′; reverse 5′‐CTCATTAGCAGCAAGGAAGT‐3′.

18 Parathyroid hormone receptor 1 knockdown induces localised aortic occlusion by down regulating notch signalling in zebrafish

RationaleAortic formation occurs via a recently defined morphogenic pathway. Hedgehog (Hh) signalling induces vascular endothelial growth factor (VEGF) expression, which in turn induces Notch signalling leading to correct aortic formation....

To Swim or Float?

Quorum-sensing signaling triggers a morphogenic pathway enabling bacteria to produce gas vesicles to move by adaptive flotation.

The lipid kinase PI4KIIIβ and the eEF1A2 oncogene co-operate to disrupt three-dimensional in vitro acinar morphogenesis

The study of in vitro morphogenesis is fundamental to understanding neoplasia since the dysregulation of morphogenic pathways that create multi-cellular organisms is a common hallmark of oncogenesis. The in vitro culture of human breast epithelial cells on reconstituted basement membranes recapitulate some features of in vivo breast development, including the formation of a three-dimensional structure termed an acinus. Importantly, the capacity to disrupt in vitro acinar morphogenesis is a common property of human breast oncogenes. In this report, we find that phosphatidylinositol 4-kinase IIIβ (PI4KIIIβ), a lipid kinase that phosphorylates phosphatidylinositol (PI) to PI(4)P, disrupts in vitro mammary acinar formation. The PI4KIIIβ protein localizes to the basal surface of acini created by human MCF10A cells and ectopic expression of PI4KIIIβ induces multi-acinar devlopment. Furthermore, expression of an oncogenic PI4KIIIβ activator, eEF1A2 (eukaryotic elongation factor 1 alpha 2), phenocopies the PI4KIIIβ multi-acinar phenotype. Ectopic expression of PI4KIIIβ or eEF1A2 alters the localization of PI(4)P and PI(4,5)P 2 within acini, indicating the importance of these lipids in acinar development. Our work shows that PI4KIIIβ, eEF1A2 and PI(4)P likely play an important role in mammary neoplasia and acinar development.

Phenotypic Reversion of Invasive Neurofibromin-Deficient Schwannoma by FTS: Ras Inhibition Reduces BMP4/Erk/Smad Signaling

Neurofibromin-deficient (Nf1(-/-)) malignant peripheral nerve sheath tumors (MPNST) are highly invasive, refractory to chemotherapy, and characterized by overactivated Ras. Ras activates mitogenic pathways and regulates morphogenic programs--such as those induced by bone morphogenetic proteins (BMP) and TGF-β. The role of such a cross-talk in determining the phenotype and transformation potential of MPNSTs is unknown. Here, we used MPNST cell lines and selective Ras inhibition with S-trans,trans-farnesylthiosalicylic-acid (FTS; salirasib) in conjunction with specific inhibitors of TGF-β and BMP signaling. FTS perturbed signaling of BMP4 and TGF-β1 to Smad-dependent and Erk-dependent pathways. Furthermore, FTS inhibited motility and spreading, reduced the gelatinase secretion, eliminated the expression and activation of regulators of cell-matrix interaction, and altered gene expression. These phenomena are indicative of a phenotypic reversion of NF1-deficient cells by FTS. Inhibition of BMP4 and TGF-β by noggin and SB-431542, respectively, mimicked the FTS-mediated effects on adhesion, spreading, and cell morphology. This strongly suggests that a cross-talk among TGF-β superfamily ligands and Ras plays a significant role in the transformation of NF1(-/-) MPNSTs. Our results support the therapeutic potential of FTS, in conjuncture with BMP and TGF-β pathway inhibitors, toward the inhibition of mitogenic and morphogenic signaling pathways and the alleviation of NF1 symptoms.

Sortilin Associates with Transforming Growth Factor-β Family Proteins to Enhance Lysosome-mediated Degradation

Transforming growth factor (TGF)-β family proteins are synthesized as precursors that are cleaved to generate an active ligand. Previous studies suggest that TGF-β activity can be controlled by lysosomal degradation of both precursor proteins and ligands, but how these soluble proteins are trafficked to the lysosome is incompletely understood. The current studies show that sortilin selectively co-immunoprecipitates with the cleaved prodomain and/or precursor form of TGF-β family members. Furthermore, sortilin co-localizes with, and enhances accumulation of a nodal family member in the Golgi. Co-expression of sortilin with TGF-β family members leads to decreased accumulation of precursor proteins and cleavage products and this is attenuated by lysosomal, but not proteosomal inhibitors. In Xenopus embryos, overexpression of sortilin leads to a decrease in phospho-Smad2 levels and phenocopies loss of nodal signaling. Conversely, down-regulation of sortilin expression in HeLa cells leads to an up-regulation of endogenous bone morphogenic protein pathway activation, as indicated by an increase in phospho-Smad1/5/8 levels. Our results suggest that sortilin negatively regulates TGF-β signaling by diverting trafficking of precursor proteins to the lysosome during transit through the biosynthetic pathway.

Conditional Activin Receptor Type 1B (Acvr1b) Knockout Mice Reveal Hair Loss Abnormality

The in vivo functions of the activin A receptor type 1b (Acvr1b) have been difficult to study because Acvr1b(-/-) mice die during embryogenesis. To investigate the roles of Acvr1b in the epithelial tissues, we created mice with a conditional disruption of Acvr1b (Acvr1b(flox/flox)) and crossed them with K14-Cre mice. Acvr1b(flox/flox); K14-Cre mice displayed various degrees of hairlessness at postnatal day 5, and the phenotype is exacerbated by age. Histological analyses showed that those hair follicles that developed during morphogenesis were later disrupted by delays in hair cycle reentry. Failure in cycling of the hair follicles and regrowth of the hair shaft and the inner root sheath resulted in subsequent severe hair loss. Apart from previous reports of other members of the transforming growth factor-β/activin/bone morphogenic protein pathways, we demonstrate a specialized role for Acvr1b in hair cycling in addition to hair follicle development. Acvr1b(flox/flox); K14-Cre mice also had a thicker epidermis than did wild-type mice, which resulted from persistent proliferation of skin epithelial cells; however, no tumor formation was observed by 18 months of age. Our analysis of this Acvr1b knockout mouse line provides direct genetic evidence that Acvr1b signaling is required for both hair follicle development and cycling.

A Prickly Subject: Apoptotic Regulation by Hedgehog Morphogens

Morphogens, as intercellular signalling proteins, provide a non-cell-autonomous mechanism to impart positional information to cells and govern essential cellular processes such as apoptosis. Individual morphogen pathways utilise diverse strategies to regulate the assembly and activity of the pro-apoptotic multi-protein complexes 阂 namely the apoptosome and the death-inducing signalling complex (DISC). This review aims to highlight the apoptotic regulatory mechanisms utilised by the Hedgehog (HH) morphogen pathway 阂 with particular emphasis on a novel Caspase-9 activating complex and the utilisation of a pro-apoptotic autocrine-signalling loop.

Medicarpin, a legume phytoalexin, stimulates osteoblast differentiation and promotes peak bone mass achievement in rats: evidence for estrogen receptor β-mediated osteogenic action of medicarpin

Dietary isoflavones including genistein and daidzein have been shown to have favorable bone conserving effects during estrogen deficiency in experimental animals and humans. We have evaluated osteogenic effect of medicarpin (Med); a phytoalexin that is structurally related to isoflavones and is found in dietary legumes. Med stimulated osteoblast differentiation and mineralization at as low as 10−10 M. Studies with signal transduction inhibitors demonstrated involvement of a p38 mitogen activated protein kinase-ER-bone morphogenic protein-2 pathway in mediating Med action in osteoblasts. Co-activator interaction studies demonstrated that Med acted as an estrogen receptor (ER) agonist; however, in contrast to 17β-estradiol, Med had no uterine estrogenicity and blocked proliferation of MCF-7 cells. Med increased protein levels of ERβ in osteoblasts. Selective knockdown of ERα and ERβ in osteoblasts established that osteogenic action of Med is ERβ-dependent. Female Sprague–Dawley (weaning) rats were administered Med at 1.0- and 10.0 mg.kg−1 doses by gavage for 30 days along with vehicle control. Med treatment resulted in increased formation of osteoporgenitor cells in the bone marrow and osteoid formation (mineralization surface, mineral apposition/bone formation rates) compared with vehicle group. In addition, Med increased cortical thickness and bone biomechanical strength. In pharmacokinetic studies, Med exhibited oral bioavailability of 22.34% and did not produce equol. Together, our results demonstrate Med stimulates osteoblast differentiation likely via ERβ, promotes achievement of peak bone mass, and is devoid of uterine estrogenicity. In addition, given its excellent oral bioavailability, Med can be potential osteogenic agent.