Molecular Identification Methods Research Articles

Characterization of the sex determining region and development of a molecular sex identification method in a Salangid fish

BackgroundThe short-snout icefish, Neosalanx brevirostris, a member of the Salangidae family, is an economically important fishery species in China. Understanding the mechanisms underlying sex determination in this species has crucial implications for conservation, ecology and evolution. Meanwhile, there is a shortage of rapid and cost-effective genetic methods for sex identification, which poses challenges in identifying the sex of immature individuals in sex determination mechanism studies and aquaculture breeding applications.ResultsBased on whole genome resequencing data, sex-specific loci and regions were found to be concentrated in a region on chromosome 2. All sex-specific loci exhibited excess heterozygosity in females and complete homozygosity in males. This sex determining region contains seven genes, including cytochrome P450 aromatase CYP19B, which is involved in steroidogenesis and is associated with 24 sex-specific loci and two W-deletions. A haploid female-specific sequence was identified as paralogous to a diploid sequence with a significant length difference, making it suitable for rapid and cost-effective genetic sex identification by traditional PCR and agarose gel electrophoresis, which were further validated in 24 females and 24 males with known phenotypic sexes.ConclusionsOur results confirm that N.brevirostris exhibits a female heterogametic sex determination system (ZZ/ZW), with chromosome 2 identified as the putative sex chromosome containing a relatively small sex determining region (~ 48 Kb). The gene CYP19B is proposed as a candidate sex determining gene. Moreover, the development of PCR based method enables genetic sex identification at any developmental stage, thereby facilitating further studies on sex determination mechanisms and advancing aquaculture breeding applications for this species.

Phenotypic and Molecular Identification of M.Canis

The current study was conducted to compare morphological and molecular identification methods for the fungus M.canis isolated from 42 patients with dermatophytosis who were clinically diagnosed by a dermatologist, after review by a consultant dermatologist and venereologist in Al-Muthanna Governorate at Al-Hussein Teaching Hospital. In the period from January to November 2024, using traditional methods of isolation and laboratory identification, and molecular methods using polymerase chain reaction (PCR) technology.

Isolation and Molecular Identification of Fungal Contamination on the Eggshells of Lepidochelys olivacea L. Collected from Coastal Waters

Background: One of the causes of the decline in the Olive ridley turtle population is the low egg hatching rate due to contamination by pathogenic fungi. Purpose: This study aims to evaluate the results of the isolation and molecular identification of fungal contamination on the eggshells of olive ridley turtles that failed to hatch from three coastal waters in Bali province. Method: Sampling was done using the purposive sampling technique. Samples of failed hatching eggshells from the coast were collected, as many as 2 eggs/semi-natural nest at TCEC. Samples were cultured on PDA media. Macroscopic and molecular identification methods were carried out to determine the species level of fungal isolates. Results: The results showed that 10 fungal isolates were successfully collected. Isolates KL1 and SG1 had white colony surface characteristics, isolates KL4, SY2 and SY3 showed black colonies, and isolates KL2, KL3, SG2, SG3, SY4 had green colonies. Three similar isolates were sent for further molecular identification. The BLASTn results of the nucleotide sequences of isolates SY2 and SG3 showed a similarity to Aspergillus niger strain PHY105 (91%), while fungal isolate KL1 had a similarity to Fusarium solani strain 87, by 98%. Conclusion: This study provides new information about the pathogenic fungi, Fusarium solani strain 87 and Aspergillus niger strain PHY105, which are suspected to be the cause of the hatching failure of olive ridley turtle eggs.

Non-destructive and rapid identification of yeasts by nearinfrared spectroscopy and machine learning

This study aimed to apply near-infrared (NIR) spectroscopy combined with machine learning techniques to identify yeast strains rapidly and practically, comparing the results with traditional molecular identification methods. Yeasts were isolated from the digestive tracts of aquatic mining insects collected in the extreme north of the Western Amazon (Roraima), Brazil, and preserved through cryopreservation and mineral oil methods. Molecular identification involved PCR amplification and sequencing of ribosomal DNA regions. NIR spectroscopy, coupled with multivariate analysis and machine learning algorithms such as principal component analysis (PCA), hierarchical cluster analysis (HCA), k-nearest neighbor (KNN), and soft independent modeling by class analogy (SIMCA), was used to analyze and classify the yeast samples, accurately identified yeast strains at the genus and species levels, achieving 100% accuracy in both the calibration and validation sets. The results indicate that this method provides a rapid, non-destructive, and environmentally friendly alternative to traditional molecular techniques, making it suitable for real-time, in situ analysis with minimal sample manipulation.

Diagnostic and surveillance testing capability for mpox in the EU/EEA, September 2024.

In response to the increasing number of mpox cases caused by monkeypox virus (MPXV) clade I in the African continent and the first reported travel-related clade Ib case of mpox in EU/EEA, the European Centre for Disease Prevention and Control surveyed national capability for detection and characterisation of MPXV in the EU/EEA. The results showed high level of capability for case confirmation by PCR, alongside molecular typing methods for identification of MPXV clades and/or clade I subclades within the EU/EEA.

Species identification and pollination biology of an economically important true halophyte, Salicornia brachiata Roxb.

Members of the genus Salicornia have gained a global attraction due to their ability to thrive under high saline conditions and as potential candidates in saline agriculture. However, it has been a taxonomically challenging genus for decades since the members show plastic responses to extreme environmental conditions and due to incongruences between morphological and molecular identification methods. While only a handful of commercially grown Salicornia species are fully described, most of the species including S. brachiata, a native species in the Indian sub-continent, Myanmar, and Sri Lanka are poorly described. With the potentials in adapting S. brachiata in saline agriculture, the aim of this study was to establish a morphology and DNA barcode-based species delineation system and to study pollination biology for future crop improvement projects. Tentatively identified S. brachiata plant samples were collected from two populations in Sri Lanka and completely described. GenBank lacked authenticated barcode data for S. brachiata except for one chloroplast genome to which the matK sequence obtained in the present study matched with 100 % identity. For the first time, well defined sequences of three barcode regions, ITS, ETS and matK, of S. brachiata were made available for accurate species identification. Reproductive dynamics in different parts of the inflorescence was studied. A facultative xenogamous mating system was recorded for the first time in the genus and while the lower florets in the cladode showed a preference towards outcrossing, the upper florets displayed adaptations for selfing. Data could be effectively utilized in future Salicornia breeding programs.

Isolation of Lactobacillus spp. from Healthy Infants' Feces and Study of their Antibiotic Susceptibility

This study aimed to isolate Lactobacillus spp. bacteria from the feces of healthy newborns and investigate their susceptibility to antibiotic resistance. 120 fecal samples were obtained from infants under 12 months of age and susceptibility was identified using biochemical tests and molecular identification methods. A total of 30 positive isolates, chosen randomly from the 90 positive samples, were selected to conduct a safety assessment. the isolates were analyzed for their hemolytic activity and susceptibility to antibiotics. Using 16S rRNA sequencing, a total of 30 positive isolates were determined to be lactobacillus spp. The results of the antibiotic resistance test indicated that the majority of the isolates showed susceptibility to tetracycline, chloramphenicol, gentamicin, clindamycin, and amoxicillin while demonstrating resistance to vancomycin, nalidixic acid, streptomycin, and amikacin. conclusion: Based on these specific traits, the isolates of Lactobacillus spp. demonstrated favorable qualities as probiotics.

Isolation and identification of fungi causing post-harvest spoiled mango fruits vended in Hanoi, Vietnam

Mango (Mangifera indica L.) is one of the most popular and nutritious fruits cultivated widely in Vietnam. However, under increasingly harsh climate conditions, mangoes are easily susceptible to fungal invasion and spoiled, thereby reducing mango yield. Therefore, this study was carried out to determine the pathogenic fungal strains of mango to provide useful information for finding effective measures to prevent the diseases. Rotten mango fruits were collected from different markets in Hanoi, Vietnam. Three fungal strains (M1, M2 and M3) were isolated from the studied mangoes samples. All strains were demonstrated as fungal agents associated with mango rot through pathogenicity tests. Microscopic observation showed that the mycelium of these fungal strains was branched and septate. M1 strain formed dark-brown conidiophores and conidia produced on conidiophores. M2 strain produced α- and β-conidia, as well as sub-ovoid and brown sclerotia. Whereas the M3 strain could not produce spores. Additionally, this study determined that all three fungal isolates showed the fastest growth on PDA at 30oC. The optimum growth of the M1 and M3 strains was observed at pH 5.0 while the M2 strain grew actively at pH 7.0 and 8.0. All selected strains showed the ability to produce extracellular enzymes, in which the M1 strain synthesized both cellulase and pectinase while the M2 and M3 strain secreted only pectinase. Finally, by molecular identification method, the isolates (M1, M2 and M3) were identified as Aspergillus niger isolate M1, Phomopsis sp. M2, Lasiodiplodia theobromae M3, respectively.

Mitigating the Threat of Invasive Mosquito Species Expansion: A Comprehensive Entomological Surveillance Study on Kastellorizo, a Remote Greek Island.

The expansion of the tiger mosquito, a vector that can transmit diseases such as dengue, chikungunya, and Zika virus, poses a growing threat to global health. This study focuses on the entomological surveillance of Kastellorizo, a remote Greek island affected by its expansion. This research employs a multifaceted approach, combining KAP survey (knowledge, attitude, practices), mosquito collection using adult traps and human landing catches, and morphological and molecular identification methods. Results from questionnaires reveal community awareness and preparedness gaps, emphasizing the need for targeted education. Mosquito collections confirm the presence of the Aedes albopictus, Aedes cretinus, and Culex pipiens mosquitoes, highlighting the importance of surveillance. This study underscores the significance of community engagement in entomological efforts and proposes a citizen science initiative for sustained monitoring. Overall, this research provides essential insights for developing effective mosquito control programs in remote island settings, thereby emphasizing the importance of adopting a One Health approach to mitigate the spread of vector-borne diseases.

A Microcosm Analysis of Species-Specific Responses of Chironomidae on Heavy Metal Pollution in The Nyanza Gulf of Lake Victoria

The Chironomidae family, known as "non-biting midges" in their adult stage and "bloodworms" in their larval stage, consists of diverse dipteran insects inhabiting various global aquatic environments. Despite extensive global research, data on Chironomidae in the polluted Nyanza Gulf of Lake Victoria, Kenya, is scarce, and molecular identification methods have not been explored. This study aimed to quantify heavy metal concentrations in water, sediment, and insect samples and assess their impact on Chironomid species identified using mitochondrial DNA barcoding of the cytochrome oxidase subunit 1 (COI) gene. Analysis of Variance was used to determine if there were any statistically significant differences in heavy metal concentrations across different sample types or locations along the pollution gradient. Chironomids were collected from Nyanza Gulf, focusing on a pollution gradient. Results showed that concentrations of arsenic (As), lead (Pb), and cadmium (Cd) in insect, water, and sediment samples exceeded standard limits, while mercury (Hg) concentrations were within limits. Significant variations (p ≤ 0.05) in Pb levels were observed in water samples, and heavy metal concentrations in sediment samples varied significantly (p ≤ 0.05), with Pb showing the highest variation (p ≤ 0.0001). Insect samples exhibited significant differences (p ≤ 0.0001) in As and Hg contents. Genetic analysis identified two known species: Chironomus transvaalensis at the heavily polluted Kisumu station and Chironomus pseudothummi at the moderately polluted Kendu Bay and Homa Bay stations. Additionally, a unique Chironomus species was found on Ndere Island, a relatively clean site with restricted human activities. Sequence comparisons indicated proximity to global data but also highlighted the evolutionary significance and uniqueness of the identified species. This study demonstrated the potential use of genetic methods in determining Chironomid species diversity, community structure, and abundance in relation to heavy metal concentration. It suggests that heavy metal pollution may act as a selective pressure, driving the evolution of Chironomid species. The study recommends combining genetic approaches with other pollution sources for a comprehensive understanding of using this species in monitoring pollution

Genetic Sex and Origin Identification Suggests Differential Migration of Male and Female Atlantic Bluefin Tuna (Thunnus thynnus) in the Northeast Atlantic

ABSTRACTKnowledge about sex‐specific difference in life‐history traits—like growth, mortality, or behavior—is of key importance for management and conservation as these parameters are essential for predictive modeling of population sustainability. We applied a newly developed molecular sex identification method, in combination with a SNP (single nucleotide polymorphism) panel for inferring the population of origin, for more than 300 large Atlantic bluefin tuna (ABFT) collected over several years from newly reclaimed feeding grounds in the Northeast Atlantic. The vast majority (95%) of individuals were genetically assigned to the eastern Atlantic population, which migrates between spawning grounds in the Mediterranean and feeding grounds in the Northeast Atlantic. We found a consistent pattern of a male bias among the eastern Atlantic individuals, with a 4‐year mean of 63% males (59%–65%). Males were most prominent within the smallest (< 230 cm) and largest (> 250 cm) length classes, while the sex ratio was close to 1:1 for intermediate sizes (230–250 cm). The results from this new, widely applicable, and noninvasive approach suggests differential occupancy or migration timing of ABFT males and females, which cannot be explained alone by sex‐specific differences in growth. Our findings are corroborated by previous traditional studies of sex ratios in dead ABFT from the Atlantic, the Mediterranean, and the Gulf of Mexico. In concert with observed differences in growth and mortality rates between the sexes, these findings should be recognized in order to sustainably manage the resource, maintain productivity, and conserve diversity within the species.

Fish eggs in the diet of White Sea cod Gadus morhua marisalbi (Gadiformes: Gadidae): species identification using DNA-based methods

Trophic relationships reflect the peculiarities of the functioning of communities of aquatic organisms and analysis of their structure and dynamics can be used to improve fisheries management and assess the state of marine ecosystems. Populations at the margins of the species' range have particular adaptations, including feeding habits, to extreme conditions, which makes them a convenient model object for studying the possible consequences of ecosystem changes under the influence of global factors. The cod Gadus morhua marisalbi Derjugin, 1920 permanently inhabits the coastal waters of the subarctic White Sea, located at the northeastern margin of the geographic range of the Atlantic cod G. morhua Linnaeus, 1758. This coastal cod population strongly depends on the local environmental conditions and available food resources during the summer feeding period. In addition to the main food organisms (fish, polychaetes, crustaceans), the eggs of fish spawning in shallow coastal areas in summer are also important in the diet of cod at this time. According to published data, fish eggs found in significant quantities and most often in the stomachs of cod belonged to threespine stickleback and lumpfish, but this has not been confirmed by any experimental research. Besides, the possible presence of herring eggs in the diet of cod remains unproven due to the difficulties of its visual identification. In this work, we used molecular genetic methods for species identification of fish eggs found in cod stomachs. At the first stage, the species identification of DNA isolated from eggs was done using two sets of species-specific primers: the first which we designed for the mitochondrial COI gene of stickleback, cod, and herring, and the second, published for a microsatellite locus of herring. At the second stage, the species identity of DNA extracted from fish eggs was checked using DNA barcoding. The results showed that cod stomachs contained herring and stickleback eggs, and in a number of cases we found the co-occurrence of eggs of these species. Of the 29 DNA preparations studied, fourteen were successfully amplified with microsatellite primers for herring, and thirteen amplified with primers for stickleback. Interannual differences in the occurrence of herring eggs in samples were insignificant, while the frequency of occurrence of stickleback eggs in 2018 was higher than in 2017. Our analysis did not reveal significant intra-annual differences between the observed and theoretically expected number of cases of simultaneous occurrences of herring and stickleback eggs. The high frequency of occurrence of herring and stickleback eggs in cod stomachs revealed in this study indicates the importance of these components in the diet of cod and provides new knowledge on the trophic role of cod as a key species in the White Sea ecosystem. Analysis of available data on the spatial and temporal diet patterns of coastal White Sea cod shows that fish eggs can significantly contribute to the total amount of food consumed by this species during the summer.

Deciphering the Plastome and Molecular Identities of Six Medicinal "Doukou" Species.

The genus Amomum includes over 111 species, 6 of which are widely utilized as medicinal plants and have already undergone taxonomic revision. Due to their morphological similarities, the presence of counterfeit and substandard products remains a challenge. Accurate plant identification is, therefore, essential to address these issues. This study utilized 11 newly sequenced samples and extensive NCBI data to perform molecular identification of the six medicinal "Doukou" species. The plastomes of these species exhibited a typical quadripartite structure with a conserved gene content. However, independent variation shifts of the SC/IR boundaries existed between and within species. The comprehensive set of genetic sequences, including ITS, ITS1, ITS2, complete plastomes, matK, rbcL, psbA-trnH, and ycf1, showed varying discrimination of the six "Doukou" species based on both distance and phylogenetic tree methods. Among these, the ITS, ITS1, and complete plastome sequences demonstrated the highest identification success rate (3/6), followed by ycf1 (2/6), and then ITS2, matK, and psbA-trnH (1/6). In contrast, rbcL failed to identify any species. This research established a basis for a reliable molecular identification method for medicinal "Doukou" plants to protect wild plant resources, promote the sustainable use of medicinal plants, and restrict the exploitation of these resources.

Development of molecular sex identification method for Asian palm civet (Paradoxurus hermaphroditus) and Small Indian civet (Viverricula indica): a step towards forensic identification

Civet coffee and perfume are premium products in demand worldwide. Consequently, the civet population is threatened by several factors (e.g., the rapidly growing trend of civets being removed from the wild and held in captivity), raising concerns about civet welfare and conservation. In light of this, our aim was to develop a molecular sex identification method for the Asian palm civet (Paradoxurus Hermaphroditus) and the Small Indian civet (Viverricula Indica). We collected five Asian palm civet tissue samples (two male, one female, and two of unknown sex) and one female Small Indian civet from the repository, Advanced Institute for Wildlife Conservation (AIWC). DNA was extracted from all tissue samples using the DNeasy Blood and Tissue Kit. For sex identification, we optimized the PCR conditions to amplify partial fragments of sex-determining region Y (Sry) and the zinc finger X (Zfx) genes using DNA from two male Asian palm civet samples. The PCR amplicons were examined on a 2% agarose gel, and two male civets showed one distinct band at 250 bp (for Sry) and another at 120 bp (for Zfx). To confirm this finding, the PCR amplicons (Sry and Zfx genes) from one male sample were sequenced and % similarity and nucleotide pairwise analysis were calculated. The Sry and Zfx sequences showed 96.99% (for Sry) and 97.78% (Zfx) similarity to the masked palm civet, the only species in the families Paradoxurinae or Viverridae for which sequence data was publicly available. These results confirmed that the optimized PCR conditions are suitable for amplifying the Sry and Zfx genes in the Asian palm civet, which will be helpful for sex identification. Subsequently, we used this optimized method for the sex identification of three Asian palm civets and one Small Indian civet sample obtained from the repository, AIWC. Additionally, we used the method for identification of sex in a seized civet tissue sample received for forensic analysis. This report is the first to focus on developing a method for identifying the sex of Asian palm civets and Small Indian civets. This method will be helpful for researchers working on the ecology and conservation of civet population.

Recent research progress of soil nematode ecology in China.

Soil nematodes are a crucial component of belowground ecosystems. Soil nematode ecology, the studies of community distribution, structural composition, ecological functions, and interaction mechanisms with environment, has always been a hot spot in soil biology research. We systematically elaborated soil nematodes' high diversity and various diet, their advantages as bioindicator and model organisms, and their roles in biological control, ecological functions and soil health. Then, we reviewed the research progress of soil nematode ecology in China, including molecular biology identification methods, responses to global changes, food web structure and function, aboveground and belowground diversity relationship, and large-scale diversity pattern. We put forward the development trend of soil nematology, focusing on the high-throughput sequencing technology in nematode identification and quantification, the necessity of establishing a universal analysis platform to promote soil nematode research, and the importance of strengthening large-scale soil nematode survey.

Exploring oral bacterial compositional network in two oral disease groups using a convergent approach of NGS-molecular diagnostics.

Since most of the commonly known oral diseases are explained in link with balance of microbial community, an accurate bacterial taxonomy profiling for determining bacterial compositional network is essential. However, compared to intestinal microbiome, research data pool related to oral microbiome is small, and general 16S rRNA screening method has a taxonomy misclassification issue in confirming complex bacterial composition at the species level. Present study aimed to explore bacterial compositional networks at the species level within saliva of 39 oral disease patients (Dental Caries group: n = 26 and Periodontitis group: n = 13) through comparison with public Korean-specific healthy oral microbiome data. Here, we applied comprehensive molecular diagnostics based on qRT-PCR and Sanger sequencing methods to complement the technical limitations of NGS-based 16S V3-V4 amplicon sequencing technology. As a result of microbiome profiling at the genus level, relative frequencies of many nitrate-reducing bacteria within each oral disease group were found to be significantly low compared to the healthy group. In addition, the molecular diagnostics-based bacterial identification method allowed the determination of the correct taxonomy of screened primary colonizers (Streptococcus and Actinomyces unclassification clusters) for each oral disease. Finally, as with the results of microbiome profiling at the genus level, many core-species classified within the saliva of each oral disease group were also related to nitrate-reduction, and it was estimated that various pathogens associated with each disease formed a bacterial network with the core-species. Our study introduced a novel approach that can compensate for the difficulty of identifying an accurate bacterial compositional network at the species level due to unclear taxonomy classification by using the convergent approach of NGS-molecular diagnostics. Ultimately, we suggest that our experimental approach and results could be potential reference materials for researchers who intend to prevent oral disease by determining the correlation between oral health and bacterial compositional network according to the changes in the relative frequency for nitrate-reducing species.

Leptoglossus occidentalis Heidemann, 1910 (Hemiptera Coreidae) in Türkiye Its distribution, life cycle, and fungal associations

In this study, the distribution, life cycle and associations with fungi of the alien invasive species Leptoglossus occidentalis Heidemann, 1910 (Hemiptera: Coreidae) in Türkiye were investigated. During the study between 2019 and 2021, we found that the pest has spread almost all over Türkiye. We recorded the presence of the species in 35 provinces. The biological data obtained in the study were divided into ecologically similar sub-regions (Ankara-Çankırı-Kırşehir, Artvin, Isparta-Burdur, Izmir-Aydın-Manisa-Muğla-Antalya) in order to reveal the life cycle of the species. Additionally, host plant and insect samples were examined for the presence of Diplodia sapinea (Fr.) Fuckel (pine shoot blight agent) and entomopathogenic fungi species through morphological and molecular identification methods. Consequently, we found that L. occidentalis has two generations in Türkiye. Timing of the first flight was in early May-mid June and the second generation was from mid-July to late August. Although D. sapinea was detected in some of the sampled host plant tissues, it could not be isolated from L. occidentalis individuals. Accordingly, we did not find any evidence that L. occidentalis vectors D. sapinea although the insect and the fungus cooccurs in sampling areas. On the other hand, its vector potential cannot be ruled out especially during rainy periods. This potential remains as a hypothesis for future studies. Although we detected 25 fungal species isolated from L. occidentalis adults, none of them were entomopathogenic fungal species.

Classical and Molecular Methods of Identification as well as Estimating Nematodes: A Comparative Review

Changing climatic scenarios accompanied with harsh ecological conditions are forcing various groups of organisms to evolve and adapt in different dimensions. Predominantly in the field of agriculture and crop science, several categories of new pests along with diseases are emerging voraciously causing havoc and causing panic-stricken situations for the farmers. Among the pests, nematode is one of the unnoticed categories contributing significantly to economic loss to the farmers. Due to monotonous crop protection practices in some of the areas as well as drastic changes in the environmental factors, new species of nematode are evolving and attacking economically important crop species. For that, we have to understand the pattern of feeding, oviposition site, life cycle, host searching behaviour, parasitic stages and susceptible host stage for attacking in order to form proper management practices. For understanding its mechanisms and behaviour, our prime concern will be its identification and taxonomic classification by various conventional as well as molecular approaches. Molecular approaches are turning out to be a useful and vigorous tool for the identification of the phylum Nematoda replacing conventional ones.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) μm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) μm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) μm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) μm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) μm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) μm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) μm, BW = 28.24 ± 2.38 (25.93-30.55) μm, ST = 20.23 ± 0.78 (19.42-21.04) μm, DGO = 4.89 ± 0.44 (4.56-5.22) μm, spicule length = 28.98 ± 1.68 (26.94-31.02) μm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) μm, BW = 15.09 ± 1.47 (12.02-16.82) μm, ST = 12.74 ± 0.61(11.46-13.84) μm, DGO = 2.58 ± 0.59 (1.61-3.7) μm, tail length= 74.15 ± 13.73 (50.92-95.09) μm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) μm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Symphytum genus—from traditional medicine to modern uses: an update on phytochemistry, pharmacological activity, and safety

AbstractWith around 34 recognized species, Symphytum genus (comfrey) has a noteworthy position within the Boraginaceae family. Comfrey species have been empirically used since ancient times as wound-healing and skin-regenerating agents in ulcers, wounds, bone fractures, and rheumatic complaints. This review aims to provide a thorough examination of recent scientific advances and challenges within the Symphytum genus, covering data published between 2013 and 2023. It delivers an updated overview of the taxonomy, ethnopharmacological uses, chemical composition, and pharmacological activities of the genus. Special emphasis is put on molecular identification methods for species taxonomy, emerging extraction technologies for comfrey phytochemicals, metabolomics techniques for mapping chemical complexity, modern bioassay platforms revealing its poly-pharmacology, formulation strategies, and remediation approaches for removal of toxic pyrrolizidine alkaloids (PAs). For instance, recent metabolomic studies employing advanced spectro-chromatographic techniques have revealed a diverse chemical composition of comfrey plants, including polysaccharides, allantoin, benzoic and cinnamic acid derivatives, flavonoids, fatty acids, and unsaturated necine-structure-based PAs. The mechanisms underlying their anti-inflammatory, analgesic, wound-healing, anti-irritant, and osteo-regenerative properties were targeted in modern pharmacological setups. Thus, key compounds like allantoin, rosmarinic acid, globoidnans A and B, rabdosiin, and comfreyn A, have been identified as significant contributors to the anti-inflammatory and wound-healing effects of Symphytum-derived preparations. Despite their well-established clinical use, concerns about PAs-induced toxicity have prompted the development of novel PA remediation strategies, enabling the production of comfrey extracts with enhanced safety profiles that can meet the regulatory standards imposed by authorities.