Mitochondrial ND2 Gene Research Articles

Safety of Intravitreal Gene Therapy for Treatment of Subjects with Leber Hereditary Optic Neuropathy due to Mutations in the Mitochondrial ND4 Gene: The REVEAL Study.

BackgroundLeber hereditary optic neuropathy (LHON) is a maternally inherited mitochondrial disease whose primary clinical manifestation is bilateral visual loss. Only a single therapy, idebenone, is approved in Europe for use in exceptional circumstances and no therapy is currently approved in the USA. LHON remains a disease with a high unmet medical need.ObjectiveThis is a report of an open-label, single-center, dose-escalation study that evaluated the safety and tolerability of lenadogene nolparvovec in 15 subjects with LHON for up to 5 years following a single intravitreal injection at four dose levels.MethodsSubjects were enrolled sequentially in four cohorts followed by an additional cohort at the dose selected, and safety was assessed by an independent data safety monitoring board (DSMB) prior to any dose escalation.ResultsOverall, the treatment was well tolerated during the 5-year follow-up. No serious adverse events were considered related to treatment, no unexpected adverse events occurred, and no grade 3 or 4 Common Terminology Criteria for Adverse Events were reported. Anterior chamber inflammation and vitritis were mostly managed with topical steroids, and ocular inflammation was considered to be dose limiting by the DSMB based on the benefits/risks for the subjects. Analysis of the logarithm of the minimal angle of resolution (LogMAR) visual acuity in both treated and untreated eyes showed clinically relevant and durable improvements compared with baseline. Mean improvements of − 0.44 and − 0.49 LogMAR for treated and untreated eyes, respectively, were noted, with a mean (± standard deviation) final value of LogMAR + 1.96 ± 0.60 and + 1.65 ± 0.34, respectively, at 5 years post-treatment administration. For the six subjects treated with the optimal dose level (9 × 1010 viral genomes [vg]/eye), the mean visual acuity improvement from baseline reached − 0.68 LogMAR for treated eyes and − 0.64 LogMAR for untreated eyes, with a mean final value of LogMAR + 1.77 ± 0.52 and + 1.78 ± 0.34, respectively. While there was a meaningful improvement in visual acuity for REVEAL subjects, the final visual acuity was less favorable than that seen in the two subsequent pivotal phase III studies in which subjects were treated earlier during the course of their disease.ConclusionLenadogene nolparvovec was well tolerated with a good safety profile during 5 years of follow-up and may offer meaningful lasting improvements in vision for this LHON population.Clinical Trial NumberEUDRACT N° 2013-001405-90.

Extensive hybridization between two Andean warbler species with shallow divergence in mtDNA

AbstractStudying processes acting on differentiated populations upon secondary contact, such as hybridization, is important to comprehensively understand how species are formed and maintained over time. However, avian speciation studies in the tropical Andes have largely focused on the role of topographic and ecological barriers promoting divergence in allopatry, seldom examining hybridization and introgression. We describe a hybrid zone involving 2 closely related Andean warblers (Parulidae), the Golden-fronted Redstart (Myioborus ornatus), and the Spectacled Redstart (Myioborus melanocephalus). Geographic ranges of these species abut near the Colombia-Ecuador border and many specimens from the region exhibit intermediate phenotypes, but a formal description of phenotypic variation in the contact zone was heretofore lacking. We collected specimens across a transect encompassing the area where ranges abut and areas where only “pure” parental phenotypes of M. ornatus chrysops and M. melanocephalus ruficoronatus occur. We described variation in plumage traits including patterns of head and ventral coloration and tail markings based on 321 specimens. To describe genetic variation in the contact zone and over a broader phylogeographic context, we used sequences of the mitochondrial ND2 gene for 219 individuals across the transect and the entire range of both species, including all subspecies, from Venezuela to Bolivia. We documented a hybrid zone ~200 km wide based on head coloration, where intermediate plumage phenotypes are most common and “pure” forms do not overlap geographically, consistent with extensive hybridization. Across the range of the M. ornatus–M. melanocephalus complex, mitochondrial genetic structure was shallow, with genetic breaks only coinciding clearly with one topographic feature. Such a low genetic structure is striking given the high diversity in plumage phenotypes and the current taxonomy of the group. Our phenotypic data suggest that barriers to hybridization are not strong, and allow us to postulate hypotheses to be tested using forthcoming genomic data.

Variations of Mitochondrial ND4 and ND5 Genes and their Association with Temporal Lobe Epilepsy in a Northern Han Chinese Population.

Variations of Mitochondrial ND4 and ND5 Genes and their Association with Temporal Lobe Epilepsy in a Northern Han Chinese Population.

Comparison of Seven Commercial TaqMan Master Mixes and Two Real-Time PCR Platforms Regarding the Rapid Detection of Porcine DNA

A pig-specific real-time PCR assay based on the mitochondrial ND5 gene was developed to detect porcine material in food and other products. To optimize the performance of assay, seven commercial TaqMan master mixes and two real-time PCR platforms (Applied Biosystems StepOnePlus and Bio-rad CFX Connect) were used to evaluate the limit of detection (LOD) as well as the PCR efficiency and specificity. The LODs and PCR efficiencies for the seven master mixes on two platforms were 0.5–5 pg/reaction and 84.96%–108.80%, respectively. Additionally, non-specific amplifications of DNA from other animal samples (human, dog, cow, and chicken) were observed for four master mixes. These results imply that the sensitivity and specificity of a real-time PCR assay may vary depending on master mix and platform used. The best combination of master mix and real-time PCR platform can accurately detect 0.5 pg porcine DNA, with a PCR efficiency of 100.49%.

Alternations in mitochondrial genome in carcinogenesis of HPV positive cervix

ObjectiveIt is well known that mitochondrial dysfunctions are involved in tumorigenesis. A special interest of scientists is mitochondrial ND1 gene (mtND1). Recently detected mutations in the mtND1 can disrupt the normal activity of complex I and affect oxidative phosphorylation, thus leading to increase reactive oxygen species production. This study was undertaken to determine the alternations in the mtND1 and evaluate their association with development of precancerous lesions and cervical cancer. MethodsIn the study 29 cervical cancer, 28 low grade squamous intraepithelial lesion (L-SIL) and 30 high grade squamous intraepithelial lesion (H-SIL) HPV positive fragments tissue were screened for the presence of mtND1 mutations. ResultsOur study showed that mutations in the mtND1 gene were detected in patients with precancerous stage, as well as cervical cancer. We have identified 12 point mutations in 116 analyzed precancerous and cancer samples HPV positive. Most detected missense mutations were previously described, except one (p. M156K) with Grantham value 95. The lower expression of mRNA ND1 was detected in cervical cancer cases and in all samples in which mtND1 mutations were identified. Our analyses revealed that level of ROS production was higher in cervical cancer tissues and all cases characterized by mtND1 mutations. ConclusionsWe hypothesize that mutations in MT-ND1 observed in H-SIL and cancer could activate cervical carcinogenesis by increased ROS production.

Crossing Lydekker's Line: Northern Water Dragons (Tropicagama temporalis) Colonized the Mollucan Islands of Indonesia from New Guinea

Wallace's and Lydekker's Lines both describe important biogeographic barriers in the Indo-Australian Archipelago, with Wallace's Line demarcating the boundary of the Greater Sunda Shelf and Lydekker's Line indicating the edge of the Sahul continental shelf. Despite their similarities, Wallace's Line has been much more heavily studied than has Lydekker's Line, yet provides an interesting system for testing the source of fauna into eastern Wallacea. New collections of Northern Water Dragons, Tropicagama temporalis, from several islands in Maluku, eastern Indonesia now allow for an assessment of the phylogeography of the species and the ability to test if New Guinean or Australian populations served as the source for over-water dispersal across Lydekker's Line into Maluku. We collected specimens from remote islands in eastern Indonesia, sequenced the mitochondrial ND2 gene, and aligned the data to previously sequenced specimens on GenBank. We conducted several phylogenetic and divergence time analyses to investigate the source population and timing of dispersal. We found low genetic diversity among the islands in Maluku, and these samples showed little genetic divergence from New Guinea samples. The New Guinea and Maluku populations diverged less than 1 million years ago (Ma) and together diverged from the Australian population between 2.3 and 4.7 Ma. These results, along with patterns in other taxa, illustrated that, despite Australia's close geographic proximity to many of the islands in southeastern Indonesia, New Guinea has been the more frequent source of Wallacean fauna from Sahul.

Taxonomic evaluation of two similar bent-toed geckos Squamata: Gekkonidae: Cyrtodactylus Gray, 1827) from East Java, Indonesia.

The bent-toed geckos of the genus Cyrtodactylus are the most speciose land vertebrates of Southeast Asia (about 300 species so far) and new species continue to be recognized at a rapid rate. Within the last decade three new species were described from Java, Indonesia, C. semiadii, C. petani, and C. klakahensis. The latter two are very similar, except for differences in the precloacal depression in adult males. These two species have relatively close type localities, separated from each other by only about 50 km, and with similar habitat type and elevation. Our study aimed to evaluate the taxonomic status of C. klakahensis and C. petani using both morphological and genetic evidence. These two species are genetically similar, with a genetic divergence of only 1.5 to 1.6%. This divergence is well below the level of typically characterizes sister species of Cyrtodactylus (approximately 4% in the mitochondrial ND2 gene), and is more in line with population variation due to geographic distance. Further examination of specimens, from both type localities, showed no diagnostic morphological characters between the two species. Thus, we conclude that C. klakahensis and C. petani are conspecific, and following article 23 of the ICZN, C. klakahensis is herein considered a junior synonym of C. petani.

A new species of Hemiphyllodactylus (Squamata: Gekkonidae) from Tuyen Quang Province, Vietnam.

A new species of the gekkonid genus Hemiphyllodactylus is described from limestone karst forest of Tuyen Quang Province, northern Vietnam based on morphological differences and molecular divergence. Hemiphyllodactylus nahangensis sp. nov. is distinguished from the remaining congeners by having the unique combination of the following characters: a bisexual taxon; SVL of adults 41.4-43.6 mm; dorsal scale rows 18-23; ventral scale rows 9-13; chin scales bordering mental and first infralabial distinctly enlarged; 22-24 pore-bearing femoral and precloacal scales, in a continuous row, absent in females; digital lamella formula 3-4-5-4 (forefoot) and 4-5-5-5 (hindfoot); cloacal spur single, present in both sexes; dark lateral head stripe indistinct; postsacral mark cream and bearing anteriorly projecting arms. In phylogenetic analyses, the new species is placed in a clade that includes H. dushanensis, H. hongkongensis, H. huishuiensis, H. ngocsonensis and H. zugi. In terms of pairwise genetic distance, the new species is at least 5.9%-6.6% divergent from other congeners based on a fragment of the mitochondrial gene ND2.

A novel m.11406 T > A mutation in mitochondrial ND4 gene causes MELAS syndrome

Pathogenic point mutations of mitochondrial DNA (mtDNA) are associated with a large number of heterogeneous diseases involving multiple systems with which patients may present with a wide range of clinical phenotypes. In this study, we describe a novel heteroplasmic missense mutation, m.11406 T > A, of the ND4 gene encoding the subunit 4 of mitochondrial complex I in a 32-year-old woman with recurrent epileptic seizure, headache and bilateral hearing loss. Skeletal muscle histochemistry demonstrated that approximately 20% of fibers were cytochrome C oxidase (COX) deficient with increased activity of succinate dehydrogenase (SDH). Further investigations in muscle specimens showed significantly reduced level of ND4 protein. It is interesting that the subunits of complex I (ND1 and NDFUB8) and complex IV(CO1) were also remarkably decreased. These findings indicate that ND1, NDFUB8 and CO1 are more susceptible than other subunits to mutations in the mitochondrial ND4 gene.

P0029GLUCOSYLCERAMIDE SYNTHASE INHIBITION PRESERVES MITOCHONDRIAL FUNCTION AND REDUCES REACTIVE OXYGEN DAMAGE IN THE JCK MOUSE MODEL OF POLYCYSTIC KIDNEY DISEASE

Abstract Background and Aims Polycystic kidney disease (PKD) is characterized by the formation and progressive growth of renal cysts ultimately leading to end-stage renal disease (ESRD). Previous work has shown that treatment of PKD mouse models with a glucosylceramide synthase inhibitor (GCSi) inhibits glycosphingolipid metabolism and blocks disease progression. Clinical trials to determine the efficacy of GCSi treatment for ADPKD are currently ongoing. ADPKD patient kidneys, as well as kidneys from in vivo mouse models of PKD, display defects in mitochondrial morphology and function, leading to reactive oxygen species (ROS) generation. Functional defects include decreased fatty acid oxidation and increased glycolysis that can promote cellular proliferation. To determine if glucosylceramide synthase inhibition ameliorates mitochondrial dysfunction, we assessed the impact of GCSi treatment on mitochondrial formation and function in the jck mouse model of PKD. Method Twenty-six-day old WT or jck mice were treated with vehicle or 60 mg/kg GCSi (Genz667161) in feed for 38 days prior to tissue harvest. Kidney mRNA expression was measured using RT-PCR. Kidney protein levels were measured by western blot. Mitochondrial DNA content was measured using real-time PCR. Oxidized DNA was detected by immunohistochemistry using anti-8OHdG antibodies. Oxidized proteins were measured using the Oxyblot system (manufacturer). Results Reduced cystogenesis following GCSi treatment was associated with preserved mitochondrial number in jck mice as evidenced by increased levels of mitochondrial DNA, increased mitochondrial proteins (Tom20, VDAC, SirT3, and MT-Co1), and elevated mRNA expression (Nd3, Cox3, and Atp8). Stabilization of mitochondrial number was accompanied by activation of pathways that promote mitochondrial biogenesis, including increased PGC1α protein and Ppargc1a and Tfam1. Downregulation of several antioxidant genes (Gpx6, Gstk1, Prdx3, and Sod2) were observed in untreated jck samples. Consistent with this, levels of oxidized DNA and oxidized proteins were increased in untreated jck samples. Treatment with GCSi partially reversed the downregulation of antioxidant genes and decreased the levels of oxidized DNA and proteins to near WT levels in jck tissues. We then compared the jck model to tissues derived from ADPKD patients. Western blots demonstrate a reduction in electron transport chain (CxI-CxV) and mitochondrial outer-membrane markers in both untreated jck and ADPKD samples compared to controls. Similarly, the mitochondrial genes Nd1, Nd2, Cox2, and Atp6 were reduced in untreated jck kidneys and ADPKD samples relative to controls. As previously mentioned, we observed a generalized loss of antioxidant gene expression in untreated jck kidneys. Consistent with this, there were increased levels of both oxidized DNA and oxidized protein in untreated jck samples; this increase in DNA and protein oxidation was mirrored in ADPKD patient samples. Conclusion Mitochondrial number and function were reduced in both untreated jck mouse kidneys and human ADPKD samples. Increased oxidative stress, as evidenced by increased levels of oxidized DNA and proteins, is evident in both jck and ADPKD tissues. In vivo treatment with a GCSi effectively reversed the observed increase in oxidative stress and inhibited disease progression in the jck model of ADPKD. Our data demonstrate that reduced kidney cyst growth following GCSi treatment is associated with preserved mitochondrial formation and function.

The southernmost record and an update of the geographical range of the Atlantic chupare, Styracura schmardae (Chondrichthyes: Myliobatiformes).

The present study established the southernmost distribution range for the Chupare stingray Styracura schmardae based on a specimen caught on the easternmost portion of Ceará State, northeastern Brazil. Identification was based on diagnostic morphological characters and molecular data (sequence of the mitochondrial DNA gene nd2; 1046 bp). This record expands the known distribution range for this species by more than 1200 km and confirms that S. schmardae is distributed in more than one biogeographical province. SIGNIFICANCE STATEMENT: There are few records of the Atlantic Chupare stingray for Brazil and most of them are associated with the Amazon River mouth. New records indicate that this species is also present in the South Atlantic portion of the Brazilian coast. Apparently having a low abundance throughout its range, these new records increase the range of occurrence of this species.

Inferring the invasion mechanisms of the red swamp crayfish in China using mitochondrial DNA sequences

The red swamp crayfish, Procambarus clarkii, is a native species in north-eastern Mexico and south-central USA. P. clarkii was introduced to China in 1929 and has been used as an aquaculture species in China since 1983. It currently exists in most of the provinces of China, but threatens local fish, crustaceans, aquatic plants and local freshwater ecosystems. We examined the genetic variation in partial mitochondrial ND2 gene of 831 individuals collected from 25 P. clarkii populations in 13 provinces of China to infer the expansion pathways and mechanisms. Six haplotypes were detected. All six haplotypes appeared in four populations in Nanjing and a population located near Nanjing whereas only 1–5 of the six haplotypes were present in other populations. These data suggest that the populations in Nanjing are probably the source of all other populations in China. There were no significant relationships between geographic distances and genetic distances in 25 populations, whereas significant relationship was found in four populations in Qinhuai River covering 50 km in Nanjing. These data suggest that the expansion mainly be human-mediated in large scale, and active disposal or non-anthropogenic passive dispersal might have played an important role in expansion at a smaller scale. In some places far away from Nanjing, several haplotypes existed, suggested multiple introduction events may have happened. Although aquaculture of this species could bring huge economic benefit, its potential to negatively affect native biota and entire ecosystems should not be ignored.

Acanthosaura aurantiacrista (Squamata: Agamidae), a new long horn lizard from northern Thailand.

BackgroundIn Thailand, five species of Acanthosaura have been recorded so far, including Acanthosaura armata from the southern region, A. cardamomensis from the eastern region, A. crucigera from the western region, A. lepidogaster from the northern region and A. phuketensis from the Phuket Island and south-western region. However, comprehensive studies of diversity patterns and distribution of Acanthosaura are still lacking in some areas and need further information for designating areas of special conservation importance and nature protection planning in Thailand.New informationAcanthosaura aurantiacrista is a new species of long-horned lizard of the genus Acanthosaura from northern Thailand. It is distinguished from all other species of Acanthosaura by a dagger-like nuchal spine with yellowish-orange colouration in females, bright yellow colouration in males and a combination of other morphological characters: a greater tail length to snout-vent length ratio; a larger postorbital spine, nuchal spine, dorsal spine and occipital spine compared to its head length; a smaller diastema to snout-vent length ratio; a greater number of subdigital lamellae on the fourth finger and fourth toe; and a larger gular pouch than other Acanthosaura species. Analysis of mitochondrial ND2 gene sequences revealed a sister clade between the A. aurantiacrista lineage and the A. crucigera lineage with a 100% probability of divergence, according to Bayesian analysis and strong support value for Maximum Likelihood analysis. The pairwise distance ranged from 13.8-15.0% between A. aurantiacrista and A. cardamomensis, 10.9-14.5% between A. aurantiacrista and A. crucigera and 0-1.2% amongst A. aurantiacrista populations. The discovery of this lizard increases the known endemic herpetological diversity and underscores the importance of conservation in the mountain rainforest region of northern Thailand.

Validation of a mitochondrial RNA therapeutic strategy using fibroblasts from a Leigh syndrome patient with a mutation in the mitochondrial ND3 gene

We report on the validation of a mitochondrial gene therapeutic strategy using fibroblasts from a Leigh syndrome patient by the mitochondrial delivery of therapeutic mRNA. The treatment involves delivering normal ND3 protein-encoding mRNA as a therapeutic RNA to mitochondria of the fibroblasts from a patient with a T10158C mutation in the mtDNA coding the ND3 protein, a component of the mitochondrial respiratory chain complex I. The treatment involved the use of a liposome-based carrier (a MITO-Porter) for delivering therapeutic RNA to mitochondria via membrane fusion. The results confirmed that the mitochondrial transfection of therapeutic RNA by the MITO-Porter system resulted in a decrease in the levels of mutant RNA in mitochondria of diseased cells based on reverse transcription quantitative PCR. An evaluation of mitochondrial respiratory activity by respirometry also showed that transfection using the MITO-Porter resulted in an increase in maximal mitochondrial respiratory activity in the diseased cells.

A new species of Dixonius (Squamata: Gekkonidae) from the karst forest of Khammouane Province, central Laos

A new species of Dixonius is described on the basis of three specimens from the karst forests around Thakhek town, Khammouane Province, Laos. The new species from Laos can be distinguished from other species of Dixonius based on molecular and morphological divergences. It is characterized by a maximum SVL of 55.4 mm; 20-23 longitudinal rows of dorsal tubercles at mid-body; 23-24 longitudinal rows of ventrals across the abdomen; 8-10 supralabials, 7 or 8 in mid-orbital position; 7 or 8 infralabials; 8 precloacal pores in male; the male without femoral pores; precloacal and femoral pores absent in females; uniformly pebble brown dorsum. In phylogenetic analyses, the new species is shown to be the sister taxon to two undescribed taxa from Thailand but differs by at least 8.6% in genetic pairwise distance from the latter based on the complete sequences of the mitochondrial ND2 gene with partial or complete sequences of six adjacent tRNAs. This is the ninth known species of Dixonius, and the second recorded species from Laos.

Simultaneous detection of pork and wild boar meat in chicken sausages using the combination of a single primer and real-time polymerase chain reaction (qPCR)

The identification of meat species in food products and pharmaceuticals is vital to minimize food adulteration practices. Due to its specificity, polymerase chain reaction (PCR)-based methods are the most commonly reported methods for detection of food adulterants. This study was aimed to evaluate the use of real-time PCR with a species-specific primer to identify two non-halal types of meat, namely pork and wild boar meat (WBM), in chicken sausages. The primer was designed using online software PrimerQuest from NCBI (National Center for Biotechnology Information) to target the mitochondrial ND1 gene of Sus scrofa domestica . The annealing temperature (Ta) of the primer used during real-time PCR analysis was optimized to achieve the highest response fluorescence unit at the lowest cycles. Real-time PCR using the primers of NK-ND1-Ssc1 (Forward: 5’ AAAGGACCCAACGTTGTAGG 3’ and Reverse: 5’ TAGTGCTAGGGATAAGGCTAGG 3’) was validated with several parameters, namely specificity, the limit of detection for sensitivity, linearity, efficiency, and repeatability. The optimum annealing temperature of NK-ND1-Ssc1 was 58.1 o C. The sensitivity evaluation revealed that the limits of detection (LoD) of pork and WBM in reference sausage samples containing 100% pork and WBM were 500 pg and 50 pg, respectively, which correspond to 0.3% meat in sausage products. The efficiency values of real-time PCR amplification were 93.1% and 94.8% for pork and WBM with coefficient variations of 0.2884% and 0.4998%, respectively. The validated method was subsequently applied to analyze the commercial samples, and among the twelve (12) samples evaluated, there was one sample positive of containing non-halal meat (pork or WBM). Real-time PCR using species-specific primers, e.g., NK-ND1-Ssc1, is specific and sensitive; therefore, this method can be used as an alternative technique for authentication of halal meat.

Four new Burmese species of Hemiphyllodactylus Bleeker (Squamata: Gekkonidae) from distantly related parapatric clades from the Shan Plateau and Salween Basin.

An integrative taxonomic analysis based on morphology, color pattern, and the mitochondrial gene ND2 recovered four new species of Hemiphyllodactylus Bleeker that are endemic to the Shan Plateau or Salween Basin in eastern Myanmar. Hemiphyllodactylus ngwelwini sp. nov. from the Shan Plateau is part of the earlier described "eastern Myanmar clade" renamed herein as the north lineage and H. kyaiktiyoensis sp. nov. and H. pinlaungensis sp. nov. of the Shan Plateau and H. zwegabinensis sp. nov. of the Salween Basin compose an entirely new Burmese clade herein referred to as the south lineage. Although the north and south lineages come within 46 km of one another on the Shan Plateau, they are not sister lineages but sequentially separated by two lineages from Yunnan, China and another from northwestern Thailand. Hemiphyllodactylus zwegabinensis sp. nov. is the first species of this genus to be recorded from the Salween Basin and is known only from a wind-blown cloud forest on the top of the insular, karstic mountain Zwegabin in Kayin State. All other Burmese species except for H. typus, are endemic to the various localities throughout the Shan Plateau. These four new species bring the total number of Hemiphyllodactylus in Myanmar to at least 10 which is certainly an extreme underestimate of the diversity of this genus given that we discover new species at every upland locality we survey.

Observations on the relationships of some Sundaic passerine taxa (Aves: Passeriformes) previously unavailable for molecular phylogenetic study

To help resolve phylogenetic and phylogeographic relationships of Southeast Asian birds, we have collected specimens in Borneo, Sumatra, and Java for phylogenetic and morphological study. Here, we compare mitochondrial ND2 gene sequences from some of these new specimens to sequences obtained in previous studies to shed light on genealogical relationships in nine passerine clades: Erythropitta venusta/granatina/ussheri (pittas); Dicrurus hottentottus (drongos); Alophoixus bulbuls; Napothera, Turdinus and Pellorneum babblers; Anthipes flycatchers; Brachypteryx shortwings; and Myophonus whistling thrushes. These comparisons resolve or shed substantial light on taxonomic problems in pittas, Alophoixus, Napothera, Dicrurus, Brachypteryx, and Myophonus, and they confirm assumed (but previously unquantified) genetic relationships within Turdinus and Anthipes. The resulting trees also allow us to (1) suggest improved taxonomic arrangements in several groups, (2) confirm the rediscovery of a “lost” species within Napothera, and (3) provide the basis for the description of a new subspecies of Alophoixus.

The spatio-temporal features of chicken mitochondrial ND2 gene heteroplasmy and the effects of nutrition factors on this gene

Mitochondrial heterogeneity is the presence of two or more types of mitochondrial (mt)DNA in the same individual/tissue/cell. It is closely related to animal health and disease. ND2 is a protein-coding gene in mtDNA, which participates in mitochondrial respiratory chain and oxidative phosphorylation. In previous studies, we observed that the mt.A5703T and mt.T5727G sites in the ND2 gene were the heteroplasmic variation sites. We used pyrophosphate sequencing technology to examine chicken mt.A5703T and mt.T5727G heteroplasmic sites in the ND2 gene, in different tissues and at different development stages in chickens. We also investigated whether nutritional factors could affect the mt.A5703T and mt.T5727G heteroplasmy. Our results showed that chicken mt.A5703T and mt.T5727G heteroplasmy had clear spatio-temporal specificities, which varied between tissues/development stages. The mtDNA heterogeneity was relatively stable upon nutrition intervention, 30% dietary energy restriction (from 18 to 48 days old) and different types of dietary fats (at 5% concentration, from 1 to 42 days old) did not change the breast muscle heteroplasmy of broilers at the mt.A5703T and mt.T5727G sites. In addition, multiple potential heteroplasmic sites were detected by clone sequencing in the ND2 region, which potentially reflected abundant heteroplasmy in the chicken mitochondrial genome. These results provide an important reference for further research on heteroplasmy in chicken mitochondria.

The determination of meat species by PCR-RFLP method using mitochondrial ND4 gene in pastırma, a traditional dry cured meat product

Pastirma is a high value, traditional, dry cured, and edible coated meat product. For economic and sociocultural reasons, it is important to know which meat species are used in pastirma. The present study aims to carry out the determination of the meat species in pastirma. A total of 144 pastirma samples were collected from different stores. After genomic DNA isolation, the total DNAs obtained were subjected to polymerase chain reaction (PCR) using specially designed novel primers amplifying the mitochondrial ND4 (MTND4) gene region, specific for cattle (Bos taurus), water buffalo (Bubalus bubalis), horse (Equus caballus), and donkey (Equus asinus) species. For the identification of the meat species, gel purified 952 bp PCR products were digested with fast digest SaqAI restriction enzymes selected based on preliminary in silico analyses. The results of the present study revealed that all of the pastirma samples were made from cattle meat. Cross-reactions and false-positive identifications are serious problems in routine determination of the meat species in food control laboratories. It is important to perform fast, inexpensive determination with high sensitivity and specificity for the identification of meat species. This study has shown that meat species can be detected with high specificity in products such as pastirma, which uses large pieces of meat cuts.