Mitochondrial DNA D-loop Sequences Research Articles

Genetic diversity of common carp Cyprinus carpio in the base population of a selective breeding programme in India

A selective breeding program for developing a suitable strain of Cyprinus carpio (Linnaeus, 1758) for inland saline aquaculture in India is in progress. At ICAR-CIFE, various geographical populations of common carp of India, viz. Madhya Pradesh (MP), Haryana (HR), Tripura (TR), Andhra Pradesh (AP), Manipur (MN), and Maharashtra (MH) formed the base population for selective breeding. The present study assesses the genetic diversity of these stocks using truss morphometry and mitochondrial DNA D loop marker analysis. The images of 600 fish were captured and digitized. The landmarks were identified, and an image network was constructed for truss analysis using tpsDig2 and PAST software. The data was subjected to scale transformation and factor analysis using SAS for Academics. The top 3 factors could explain 85.40% of the total variation. The results indicate stock-wise and sex-wise groupings. The mitochondrial DNA (D-loop) sequence analysis was conducted on 169 samples using MEGA6 software. The overall average haplotype and nucleotide diversity of the population were 0.08129 and 0.01134, respectively. Among stocks, the MP stock had a maximum of four haplotypes. The AMOVA results reveal that the stock AP is unique, and the other stocks form a single grouping. The information generated from the present study delineates genetic diversity among stocks and will aid in designing breeding plans.

Genetic diversity of mitochondrial DNA D-loop sequence in Bang Troi chicken breed

Bang Troi chicken (GBT) is a local chicken that is free-gardening raised in Quang Ninh province. A 1,268 bp of mitochondrial DNA (mtDNA) D-loop of 17 Bang Troi chicken individuals was sequenced and analyzed. Comparative multiple sequence alignment revealed 17 base substitutions within 17 Bang Troi chicken individuals. Bang Troi chicken had a relatively high level of genetic diversity, expressed in the number of 13 haplotypes, haplotype diversity of 0.949. The Tajima’s test indicated that the analysed population in balancing selection with a D-value of 2.39. A phylogenetic tree based on 455 bp of hypervariable mtD-loop sequence classified 17 Bang Troi chicken individuals into three clades A, B, and E, which are common groups of Vietnamese and Asia indigenous chickens. This result provides the first genetic information and maternal lineages of Bang Troi chickens and it can support for registration of local chicken breeds.

Uganda chicken genetic resources: II. genetic diversity and population demographic history inferred from mitochondrial DNA D-loop sequences.

The genetic diversity of indigenous chickens, which comprise over 80% of the chicken resources in Uganda, is largely not well-characterized for their genetic contribution. This study assessed the genetic diversity and population structure of the indigenous chicken population in Uganda to serve as an essential component for improvement and conservation strategies. A set of 344 mitochondrial DNA (mtDNA) D-loop sequences among 12 Ugandan chicken populations was evaluated. Twenty-eight polymorphic sites, accounting for 4.26% of the total analyzed loci of 658bp, defined 32 haplotypes. The haplotype diversity (Hd) was 0.437, with a nucleotide diversity (π) of 0.0169, while the average number of nucleotide differences (k) was 0.576, indicating a population that is moderately genetically diverse. Analysis of molecular variance found 98.39% (ρ < 0.01) of the total sequence variation among the chicken haplotypes within populations, 1.08% (ρ < 0.05) among populations, and 0.75% (ρ > 0.05) among populations within regions. This revealed subtle genetic differentiation among the populations, which appeared to be influenced by population fragmentation, probably due to neutral mutation, random genetic drift, and/or balancing selection. All the haplotypes showed affinity exclusively to the haplogroup-E mtDNA phylogeny, with haplotype UGA01 signaling an ancestral haplotype in Uganda. Neutrality tests Tajima's D (-2.320) and Fu's Fs (-51.369), augmented with mismatch distribution to measure signatures of recent historical demographic events, supported a population expansion across the chicken populations. The results show one matrilineal ancestry of Ugandan chickens from a lineage widespread throughout the world that began in the Indian subcontinent. The lack of phylogeographic signals is consistent with recent expansion events with extensive within-country genetic intermixing among haplotypes. Thus, the findings in this study hold the potential to guide conservation strategies and breeding programs in Uganda, given that higher genetic diversity comes from within the chicken population.

Questioning inbreeding: Could outbreeding affect productivity in the North African catfish in Thailand?

The North African catfish (Clarias gariepinus) is a significant species in aquaculture, which is crucial for ensuring food and nutrition security. Their high adaptability to diverse environments has led to an increase in the number of farms that are available for their production. However, long-term closed breeding adversely affects their reproductive performance, leading to a decrease in production efficiency. This is possibly caused by inbreeding depression. To investigate the root cause of this issue, the genetic diversity of captive North African catfish populations was assessed in this study. Microsatellite genotyping and mitochondrial DNA D-loop sequencing were applied to 136 catfish specimens, collected from three populations captured for breeding in Thailand. Interestingly, extremely low inbreeding coefficients were obtained within each population, and distinct genetic diversity was observed among the three populations, indicating that their genetic origins are markedly different. This suggests that outbreeding depression by genetic admixture among currently captured populations of different origins may account for the low productivity of the North African catfish in Thailand. Genetic improvement of the North African catfish populations is required by introducing new populations whose origins are clearly known. This strategy should be systematically integrated into breeding programs to establish an ideal founder stock for selective breeding.

Phylogenetic evolution of Egyptian goat breeds “Capra hircus” based on Mitochondrial DNA D-loop sequence.

Phylogenetic evolution of Egyptian goat breeds “Capra hircus” based on Mitochondrial DNA D-loop sequence.

Genetic admixture and diversity in Thai domestic chickens revealed through analysis of Lao Pa Koi fighting cocks.

Lao Pa Koi (LPK) chicken is a popular fighting breed in Thailand, prized for (its unique characteristics acquired by selective breeding), and a valuable model for exploring the genetic diversity and admixture of red junglefowls and domestic chickens. In this study, genetic structure and diversity of LPK chicken were assessed using 28 microsatellite markers and mitochondrial DNA (mtDNA) D-loop sequences, and the findings were compared to a gene pool library from "The Siam Chicken Bioresource Project". High genetic variability was observed in LPK chickens using mtDNA D-loop haplotype analysis, and six haplotypes were identified. Microsatellite data revealed 182 alleles, with an average of 6.5 alleles per locus. These results confirmed the occurrence of genetic admixture of red junglefowl and Thai domestic chickens in LPK chicken breed. A maximum entropy modeling approach was used to analyze the spatial suitability and to assess the adaptive evolution of LPK chickens in diverse local environments. The model identified 82.52% of the area studied as unsuitable, and 9.34%, 7.11%, and 2.02% of the area indicated moderate, low, and high suitability, respectively. The highest contribution rate to land suitability for LPK chickens was found at an elevation of 100-250 m, suggesting the importance of elevation for their potential distribution. The results of this study provide valuable insights into the genetic origin of LPK chicken breed and identify resources for future genetic improvement.

Genetic Diversity and Maternal Phylogenetic Relationships among Populations and Strains of Arabian Show Horses.

Genetic diversity and phylogenetic relationships within the Arabian show horse populations are of particular interest to breeders worldwide. Using the complete mitochondrial DNA D-loop sequence (916 pb), this study aimed (i) to understand the genetic relationship between three populations, the Desert-Bred (DB), a subset of the Kingdom of Saudi Arabia (KSA), United Arab Emirates (UAE) and Bahrain (BAH), the Straight Egyptian (EG) and the Polish bloodline (PL), and (ii) to assess the accuracy of the traditional strain classification system based on maternal lines, as stated by the Bedouin culture. To that end, we collected 211 hair samples from stud farms renowned for breeding Arabian show horses from Nejd KSA, Bahrain, Egypt, Qatar, Morocco, UAE, and Poland. The phylogenetic and network analyses of the whole mitochondrial DNA D-loop sequence highlighted a great genetic diversity among the Arabian horse populations, in which about 75% of variance was assigned to populations and 25% to strains. The discriminant analysis of principal components illustrated a relative distinction between those populations. A clear subdivision between traditional strains was found in PL, in contrast to the situation of DB and EG populations. However, several Polish horse individuals could not be traced back to the Bedouin tribes by historical documentation and were shown to differ genetically from other studied Bedouin strains, hence motivating extended investigations.

Thai Local Chicken Breeds, Chee Fah and Fah Luang, Originated from Chinese Black-Boned Chicken with Introgression of Red Junglefowl and Domestic Chicken Breeds

Knowledge of the genetic characteristics, origin, and local adaptation of chickens is essential to identify the traits required for chicken breeding programs. Chee Fah and Fah Luang are black-boned chicken breeds reared in Chiang Rai, Thailand. Chickens are an important part of the local economy and socio-culture; however, the genetic diversity, characteristics, and origins of these two breeds have been poorly studied. Here, we investigated the genetic diversity, gene pool, and origin of the Chee Fah and Fah Luang chickens using mitochondrial DNA D-loop (mtDNA D-loop) sequencing and microsatellite genotyping, as well as habitat suitability analysis using maximum entropy modeling. The MtDNA D-loop sequencing and microsatellite genotype analyses indicated that the Chee Fah and Fah Luang chickens shared haplogroups A, B, and CD with Chinese black-boned chickens. Gene pool analysis revealed that the Chee Fah and Fah Luang chickens have distinct genetic patterns compared to Thai domestic chickens and red junglefowl. Some gene pools of red junglefowl and other Thai domestic chickens were observed within the Chee Fah and Fah Luang chicken gene pool structures, suggesting genetic exchange. The data indicate that the Chee Fah and Fah Luang chickens originated from Chinese indigenous black-boned chicken breeds and experienced crossbreeding/hybridization and introgression with red junglefowl and other domestic breeds during domestication. Interestingly, the Chee Fah and Fah Luang chickens from Chiang Rai shared the same allelic gene pool, which was not shared with the Chee Fah and Fah Luang chickens from Mae Hong Son, suggesting at least two gene pool origins in the Chee Fah and Fah Luang chicken populations. Alternatively, different gene pools in the Chee Fah and Fah Luang chickens from different localities might be caused by differences in environmental factors, especially elevation.

Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria

This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.

The mitochondrial DNA diversity of captive ruffed lemurs (Vareciaspp.): implications for conservation

AbstractRuffed lemurs (Varecia variegataandVarecia rubra) are categorized as Critically Endangered on the IUCN Red List, and genetic studies are needed for assessing the conservation value of captive populations. Using 280 mitochondrial DNA (mtDNA) D-loop sequences, we studied the genetic diversity and structure of captive ruffed lemurs in Madagascar, Europe and North America. We found 10 new haplotypes: one from the European captiveV. rubrapopulation, three from captiveV. variegata subcincta(one from Europe and two from Madagascar) and six from other captiveV. variegatain Madagascar. We found low mtDNA genetic diversity in the European and North American captive populations ofV. variegata. Several founder individuals shared the same mtDNA haplotype and therefore should not be assumed to be unrelated founders when making breeding recommendations. The captive population in Madagascar has high genetic diversity, including haplotypes not yet identified in wild populations. We determined the probable geographical provenance of founders of captive populations by comparison with previous studies; all reported haplotypes from captive ruffed lemurs were identical to or clustered with haplotypes from wild populations located north of the Mangoro River in Madagascar. Effective conservation strategies for wild populations, with potentially unidentified genetic diversity, should still be considered the priority for conserving ruffed lemurs. However, our results illustrate that the captive population in Madagascar has conservation value as a source of potential release stock for reintroduction or reinforcement projects and that cross-regional transfers within the global captive population could increase the genetic diversity and therefore the conservation value of each regional population.

Mitochondrial DNA D-Loop Amplification and Sequencing for Species Differentiation in Milk.

Adulteration of dairy products, mainly through the substitution of high-quality milk for lower-quality milk, results in the production of low-value products, raising health, social, and economic concerns. As such, the development of methods to ensure dairy products' safety and quality is of great concern for governments and consumers. Although several methods have been developed for species differentiation in dairy products, their application and the establishment of reliable molecular markers for authentication purposes still need to be improved. In this chapter, we describe a low-cost, sensitive, fast, and reliable PCR-based method for mitochondrial D-loop DNA amplification for efficient detection of cattle milk in binary mixtures with sheep milk, thereby allowing the authentication of processed dairy products.

Genetic Diversity of Mitochondrial DNA (mtDNA) D-Loop Sequences in Six Improved Tropically Adapted Chicken Breeds (iTABs) in Imo State, Nigeria

The improved tropically adapted chicken breeds (iTABs) are low-input-high-output chickens suitable for smallholder poultry (SHP). Six iTABs (Fulani, FUNAAB Alpha, Kuroiler, Noiler, Sasso and Shika Brown) were introduced, and were raised under semi-intensive management system and tested under the African Chicken Genetic Gains project in Nigeria. The objective of this study was to evaluate the genetic diversity of these iTABs tested in Imo State Nigeria using mitochondrial DNA (mtDNA), Blood samples were collected from 77 chickens belonging to these six populations of iTABs in the ratio (12:12:14:13:13:13), for Noiler, FUNAAB Alpha, Shika Brown, Kuroiler, Sasso and Fulani chickens, respectively. Genomic DNA was extracted from seventy-seven birds randomly selected from the six iTABs. A 450-bp mtDNA D-loop region was sequenced. The highest (H=5) and the lowest (H=2) number of haplotypes were found within Noiler, and Shika Brown/Fulani, respectively. Among the six populations, haplotype and nucleotide diversity was 0.558±0.063 and 0.0064±0.0013, respectively. A total of 8 haplotypes were identified from 15 polymorphic sites. These haplotypes clustered into three clades with 87.89% of the total maternal genetic variations occurring within population. Fulani and Shika Brown had the least (0.000) genetic distance. Tajima’s D was negative among populations and within Noiler, Kuroiler, Sasso and Fulani populations but was only statistically significant within the Noiler population. Diversity indices of this study revealed that mtDNA polymorphism was on the average both within populations and among populations. The results indicate the existence of two distinct maternal lineages from Southeast Asia, south central and Southeast China evenly distributed among the iTABs. The average genetic diversity observed within population can be utilized for the long-term genetic improvement and stabilization of the breeds.

Genetic diversity of Banat Naked Neck, indigenous chicken breed from Serbia, inferred from mitochondrial DNA D-loop sequence and microsatellite markers

Banat Naked Neck is the most important indigenous breed of chickens in Serbia. Marginalized until recently, it is becoming increasingly popular due to its adaptability and good productivity in alternative production systems. However, its history and the current breeding model pose challenges for breed preservation and future improvement. This study aimed to assess the genetic diversity and structure of four subpopulations of Banat Naked Neck from different districts in Serbia (West Backa, North Banat, South Banat and Kolubara) using D-loop mitochondrial DNA sequences and a set of 30 microsatellite markers. Seven haplotypes in the phylogenetic analysis of D-loop mitochondrial DNA suggested maternal origin related to the Indian subcontinent, while haplotype and nucleotide diversity averaged 0.731 ± 0.053 and 0.0067 ± 0.0018, respectively. Microsatellite genotyping showed an average detected number of alleles per locus of 5.129 ± 0.237, while the observed and expected heterozygosity averaged 0.560 ± 0.018 and 0.631 ± 0.014, respectively. Genetic differentiation estimated through FST was 0.051 (p < .001). Two clusters in STRUCTURE analysis showed possible separation of two older subpopulations (South Banat and Kolubara) from the two more recent ones (West Backa and North Banat). This first comprehensive study of genetic diversity serves as the basis for future preservation, use and improvement of the Banat Naked Neck breed.

Analysis of the mtDNA D-loop Region Casts New Light on Philippine Red Junglefowl Phylogeny and Relationships to Other Junglefowl Species in Asia.

Red junglefowl (RJF) is considered the ancestor of domestic chickens. However, the possible maternal origin, genetic diversity, and subspecies classification of the Philippine (PH) RJF remains uncertain. In this study, the complete mitochondrial DNA (mtDNA) D-loop sequence of 55 PH RJFs collected from the mountainous areas of Occidental Mindoro, Palawan, Agusan del Norte, Capiz, Leyte, Iloilo, and Guimaras were analyzed and compared with chicken reference sequences. Phylogenetic analysis revealed multiple maternal origins of the PH RJFs based on haplogroups D, E, and Y classification. This was supported by PH RJFs and RJFs from other Asian countries sharing a clade. A median-joining network also revealed the haplotype sharing of the PH RJFs and Indonesian RJF, demonstrating common maternal ancestry. High haplotype and nucleotide diversity were also observed at all sampling sites. Analysis of molecular variance indicated that the principal molecular variance existed within populations (81.23%) rather than among populations (18.77%). A population neutrality test and Bayesian skyline plot (BSP) analysis elucidated the RJF maternal effective population size expansion in the Philippines that possibly started approximately 2,800-3,000 years ago. The co-existence of Gallus gallus bankiva and Gallus gallus gallus in the Philippines was also verified. The haplotype sharing of the current RJF samples with commercial chickens suggested the need to formulate conservation programs that would protect the RJFs in the Philippines.

Mitochondrial DNA D-loop sequence analysis reveals high variation and multiple maternal origins of indigenous Tanzanian goat populations.

The Small East African (SEA) goat are widely distributed in different agro‐ecological zones of Tanzania. We report the genetic diversity, maternal origin, and phylogenetic relationship among the 12 Tanzanian indigenous goat populations, namely Fipa, Songwe, Tanga, Pwani, Iringa, Newala, Lindi, Gogo, Pare, Maasai, Sukuma, and Ujiji, based on the mitochondrial DNA (mtDNA) D‐loop. High haplotype (H d = 0.9619–0.9945) and nucleotide (π = 0.0120–0.0162) diversities were observed from a total of 389 haplotypes. The majority of the haplotypes (n = 334) belonged to Haplogroup A which was consistent with the global scenario on the genetic pattern of maternal origin of all goat breeds in the world. Haplogroup G comprised of 45 haplotypes drawn from all populations except the Ujiji goat population while Haplogroup B with 10 haplotypes was dominated by Ujiji goats (41%). Tanzanian goats shared four haplotypes with the Kenyan goats and two with goats from South Africa, Namibia, and Mozambique. There was no sharing of haplotypes observed between individuals from Tanzanian goat populations with individuals from North or West Africa. The indigenous goats in Tanzania have high genetic diversity defined by 389 haplotypes and multiple maternal origins of haplogroup A, B, and G. There is a lot of intermixing and high genetic variation within populations which represent an abundant resource for selective breeding in the different agro‐ecological regions of the country.

Вариабельность последовательности D-петли митохондриальной ДНК у лошадей забайкальской породы.

The Zabaikalskaya horse is an indigenous breed of horses from Siberia with diverse use. It is characterized by endurance and good adaptability to year-round herd maintenance in the harsh conditions of the Baikal steppes. To determine the genetic characteristics of the maternal lineage of the Zabaikalskaya horse breed based on mitochondrial DNA polymorphisms, we collected hair samples from 31 horses belonging to breeding farms in the Trans-Baikal Territory. Analysis of the 530 bp sequence of the mtDNA D-loop was performed using the maximum composite likelihood (MCL) model in combination with bootstrap analysis. When studying the polymorphism of the hypervariable region of the mtDNA D- loop in Zabaikalskaya horses, we identif ied 31 haplotypes representing 8 haplogroups: B, C, G, H, L, M, Q and R according to modern classif ication. The sequenced fragment of the D-loop from nucleotide position 15471 to 16000 contained 17 polymorphic sites, mainly represented by the A→G, G→A and T→C transitions. The haplogroups Q (25.81 %), B (19.35 %), G (16.13 %) and H (12.90 %) were prevailing in the mtDNA structure of this breed. Genetic analysis of the mitochondrial genome of the Zabaikalskaya horse revealed a high level of diversity of haplotypes and haplogroups, which are typical for the horse populations of Eurasia.

A genomic perspective on an old question: Salmo trouts or Salmo trutta (Teleostei: Salmonidae)?

There are particular challenges in defining the taxonomic status of recently radiated groups due to the low level of phylogenetic signal. Members of the Salmo trutta species-complex, which mostly evolved during and following the Pleistocene, show high morphological and ecological diversity that, along with their very wide geographic distribution, have led to morphological description of 47 extant nominal species. However, many of these species have not been supported by previous phylogenetic studies, which could be partly due to lack of significant genetic differences among them, the limited resolution offered by molecular methods previously used, as well as the often local scale of these studies. The development of next-generation sequencing (NGS) and related analytical tools have enhanced our ability to address such challenging questions. In this study, Genotyping-by-Sequencing (GBS) of 15,169 filtered SNPs and mitochondrial DNA (mtDNA) D-loop sequences were combined to assess the phylogenetic relationships among 166 brown trouts representing 21 described species and three undescribed groups collected from 84 localities throughout their natural distribution in Europe, west Asia, and North Africa. The data were analysed using different clustering algorithms (admixture analysis and discriminant analysis of principal components-DAPC), a Bayes Factor Delimitation (BFD) test, species tree reconstruction, gene flow tests (three- and four-population tests), and Rogue taxa identification tests. Genomic contributions of the Atlantic lineage brown trout were found in all major sea basins excluding the North African and Aral Sea basins, suggesting introgressive hybridization of native brown trouts driven by stocking using strains of the Atlantic lineage. After removing the phylogenetic noise caused by the Atlantic brown trout, admixture clusters and DAPC clustering based on GBS data, respectively, resolved 11 and 13 clusters among the previously described brown trout species, which were also supported by BFD test results. Our results suggest that natural hybridization between different brown trout lineages has probably played an important role in the origin of several of the putative species, including S. marmoratus, S. carpio, S. farioides, S. pellegrini, S. caspius (in the Kura River drainage) and Salmo sp. in the Danube River basin. Overall, our results support a multi-species taxonomy for brown trouts. They also resolve some species in the Adriatic-Mediterranean and Black Sea drainages as members of very closely related genomic clusters that may need taxonomic revision. However, any final conclusions pertaining to the taxonomy of the brown trout complex should be based on an integrative approach combining genomic, morphological, and ecological data. To avoid challenges in taxonomy and conservation of species complexes like brown trouts, it is suggested to describe species based on genomic clusters of populations instead of describing species based only on morphologically differentiated single type populations.

Mitochondrial DNA diversity and demographic history of Black-boned chickens in China

Black-boned chickens (Gallus domesticus, herein abbreviated BBCs) are well known for their unique appearance and medicinal properties and have a long breeding history in China. However, the genetic diversity and demographic history of BBCs remain unclear. In this study, we analyzed 844 mitochondrial DNA D-loop sequences, including 346 de novo sequences and 498 previously published sequences from 20 BBC breeds. We detected a generally high level of genetic diversity among the BBCs, with average haplotype and nucleotide diversities of 0.917 ± 0.0049 and 0.01422, respectively. Nucleotide diversity was highest in populations from Southwest China (0.01549 ± 0.00026), particularly in Yunnan Province (0.01624 ± 0.00025). Significant genetic divergence was detected between most breeds, particularly between Yunnan chickens and those from all other provinces. Haplogroups F and G had the highest levels of genetic diversity and were restricted to Southwest China, particularly Yunnan Province. Based on neutrality tests and mismatch distribution analyses, we did not obtain evidence for rapid population expansions and observed similar demographic histories in BBCs and local non-BBCs. Our results suggest that Chinese BBCs have complex breeding histories and may be selected in situ from local domestic chickens. These results improve our understanding of the genetic heritage and breeding histories of these desirable chickens.

Genetic variation of Nigerian cattle inferred from maternal and paternal genetic markers.

The African cattle provide unique genetic resources shaped up by both diverse tropical environmental conditions and human activities, the assessment of their genetic diversity will shade light on the mechanism of their remarkable adaptive capacities. We therefore analyzed the genetic diversity of cattle samples from Nigeria using both maternal and paternal DNA markers. Nigerian cattle can be assigned to 80 haplotypes based on the mitochondrial DNA (mtDNA) D-loop sequences and haplotype diversity was 0.985 + 0.005. The network showed two major matrilineal clustering: the dominant cluster constituting the Nigerian cattle together with other African cattle while the other clustered Eurasian cattle. Paternal analysis indicates only zebu haplogroup in Nigerian cattle with high genetic diversity 1.000 ± 0.016 compared to other cattle. There was no signal of maternal genetic structure in Nigerian cattle population, which may suggest an extensive genetic intermixing within the country. The absence of Bos indicus maternal signal in Nigerian cattle is attributable to vulnerability bottleneck of mtDNA lineages and concordance with the view of male zebu genetic introgression in African cattle. Our study shades light on the current genetic diversity in Nigerian cattle and population history in West Africa.

Genetic diversity analysis of Topmouth Culter (Culter alburnus) based on microsatellites and D-loop sequences

Topmouth culter (Culter alburnus) is an economically important fish species distributed in rivers, lakes and reservoirs throughout China. This study focused on the genetic diversity and genetic germplasm resources of C. alburnus populations. We developed a set of 14 polymorphic multi-nucleotide repeat microsatellites using specific locus amplification fragment sequencing (SLAF-seq). Based on microsatellites and mitochondrial DNA D-loop sequences analysis, we identified six C. alburnus populations that had a high level of genetic diversity. Among them, the Xingkai Lake (XKL) population had the lowest genetic diversity, so it might require strengthened protection measures. XKL and Danjiangkou Reservoir (DJKR) populations were relatively closely related, and genetically distant from the remaining four populations. These results shall help us effectively monitor the germplasm resources of C. alburnus and provide scientific guidance for its resource development, utilization and protection.