Mouse Blood Samples Research Articles

Evaluation of sex steroid hormones and reproductive irregularities in diethyl phthalate-exposed premature mice: modulatory effect of raw honey against potential anomalies.

Phthalates, plasticizing chemicals, are top-rated environmental contaminants. Diethyl phthalate (DEP), a chief member of this family, was declared a potent endocrine disruptor and carcinogen in animals and humans. The current study was designed to explore the probable reproductive damage induced by DEP and the therapeutic efficacy of raw honey in male albino mice. Four-week-old 50 male mice were randomized equally in five groups, as control (C) received 0.1 ml distilled water; vehicle control (VC) received corn oil (0.1 ml/mouse); DEP (3mg/g/BW) dissolved in corn oil; honey control (HC) administered with honey (0.2 mg/g/day); and phthalate plus honey (P+H) administered with DEP and honey (3mg and 0.2 mg/g/BW/day respectively). Mice were treated through oral gavage for 54 days routinely, acclimatized for 6 days, and dissected. In the first instance, the antioxidant potential and total phenolic contents (TPC) of honey were analyzed through ferric reducing antioxidant power (FRAP) assay and Folin-Ciocalteu assay to confirm the antioxidant capacity of honey. The morphological, morphometric, histological, micrometric, sperm count, and hormonal analyses, and antioxidant capacity test in tissue homogenates were conducted by using tissues (testis, epididymis) and blood samples of mice. Mice exposed to DEP have a significant increase in body weight, LH level, and seminiferous tubule lumen diameter and decrease in the gonado-somatic index, testosterone level, sperm count, and seminiferous tubule diameter. Additionally, histopathology of testes showed interstitial space dilations, exfoliations, Leydig cell atrophy, germ cell degenerations, and spermatid retention in DEP-exposed testes sections. However, concomitant use of honey and DEP had shown a significant improvement in histopathological lesions, steroid hormone levels, and healthy sperm count. By these results, it is concluded that honey possessed antioxidant potential that can efficiently protect DEP-induced anomalies in male mice.

Transdermal nanotherapeutics: Panax quinquefolium polysaccharide nanoparticles attenuate UVB-induced skin cancer

Ultraviolet (UV) radiation is known to cause an imbalance of the endogenous antioxidant system leading to an increase in skin cancer. Panax quinquefolium (American ginseng) polysaccharides (GPS) can inhibit such an imbalance due to its anti-oxidative and anti-inflammatory properties. The aim of this study was to investigate the therapeutic effects of topical formulations containing GPS nanoparticles (NPs) to inhibit UVB induced oxidative damage and skin cancer. Photoaging was conducted under UVB irradiation with a dose of 300 mJ/cm2 on SKH1 hairless mice. The treatment groups (n = 5) were as follows: sham control, native GPS, GPS NPs and fluorescent labeled GPS NPs. To compare the photoprotective performance, the topical formulations were applied before and after UVB induction (pre-treatment and post-treatment), followed by sacrificing the animals. Then, skin and blood samples were collected, and inflammatory cytokines production was measured using ELISA. Compared to the sham control, GPS NPs pre-treated mice skin and blood samples exhibited a significant lowering in all cytokine production. In addition, skin histology analysis showed that pre-treatment of GPS NPs prevented epidermal damage and proliferation. The results support that topical formulation containing GPS NPs can inhibit UVB induced oxidative damage and skin cancer.

Experimental Models of Liquid Biopsy in Hepatocellular Carcinoma Reveal Clone-Dependent Release of Circulating Tumor DNA.

Liquid biopsy, the molecular analysis of tumor components released into the bloodstream, has emerged as a noninvasive and resourceful means to access genomic information from cancers. Most data derived from translational studies showcase its numerous potential clinical applications. However, data from experimental models are scarce, and little is known about the underlying mechanisms and factors controlling the release of circulating tumor DNA (ctDNA) and cells (CTCs). This study aimed to model liquid biopsy in hepatocellular carcinoma xenografts and to study the dynamics of release of ctDNA and CTCs; this included models of intratumoral heterogeneity (ITH) and metastatic disease. We quantified ctDNA by quantitative polymerase chain reaction (PCR) targeting human long interspersed nuclear element group 1; targeted mutation analysis was performed with digital droplet PCR. CTCs were traced by flow cytometry. Results demonstrated the feasibility of detecting ctDNA, including clone‐specific mutations, as well as CTCs in blood samples of mice. In addition, the concentration of ctDNA and presence of tumor‐specific mutations reflected tumor progression, and detection of CTCs was associated with metastases. Our ITH model suggested differences in the release of DNA fragments impacted by the cell‐clone origin and the treatment. Conclusion: These data present new models to study liquid biopsy and its underlying mechanisms and highlighted a clone‐dependent release of ctDNA into the bloodstream.

Cell-Released Magnetic Vesicles Capturing Metabolic Labeled Rare Circulating Tumor Cells Based on Bioorthogonal Chemistry.

Capture of circulating tumor cells (CTCs) with high efficiency and high purity holds great value for potential clinical applications. Besides the existing problems of contamination from blood cells and plasma proteins, unknown/down-regulated expression of targeting markers (e.g., antigen, receptor, etc.) of CTCs have questioned the reliability and general applicability of current CTCs capture methodologies based on immune/aptamer-affinity. Herein, a cell-engineered strategy is designed to break down such barriers by employing the cell metabolism as the leading force to solve key problems. Generally, through an extracellular vesicle generation way, the cell-released magnetic vesicles inherited parent cellular membrane characteristics are produced, and then functionalized with dibenzoazacyclooctyne to target and isolate the metabolic labeled rare CTCs. This strategy offers good reliability and broader possibilities to capture different types of tumor cells, as proven by the capture efficiency above 84% and 82% for A549 and HepG2 cell lines as well as an extremely low detection limitation of 5 cells. Moreover, it enabled high purity enrichment of CTCs from 1mL blood samples of tumor-bearing mice, only ≈5-757 white blood cells are non-specific caught, ignoring the potential phenotypic fluctuation associated with the cancer progression.

MTOR regulates PRMT1 expression and mitochondrial mass through STAT1 phosphorylation in hepatic cell

BackgroundFasting changes mitochondrial function, and mTOR acts as a major regulator of mitochondrial energy production ensuring the survival under reduced supply of nutrition. This study assessed the role of protein arginine methyltransferase 1 (PRMT1), which regulates mitochondrial function, in the context of fasting. MethodsThe effect of fasting on mTOR signaling and mTOR-regulated mitochondrial mass was assessed in LO2 cells (in vitro) and C57BL/6J mice (in vivo). Biochemical parameters of fasting were determined in blood samples of mice. PRMT1 expression was investigated by transfecting LO2 cells with an expression vector. Gene expression was determined by real-time quantitative PCR, protein interaction by chromatin immunoprecipitation, protein expression by Western blotting and immunofluorescence microscopy, and the mitochondrial mass by MitoTracker staining. ResultsAfter 48 h of fasting, mTOR and PRMT1 expression, as well as mitochondrial mass, were significantly reduced in LO2 cells, and in liver tissue sections. Fasting downregulated the expression of miR-21 and upregulated the expression of its target phosphatase and tensin homolog (PTEN), which was responsible for reduced mTOR expression. Inhibition of mTOR reduced phosphorylation of STAT1, and thereby PRMT1 expression in LO2 cells. Low PRMT1 down-regulated the expression of peroxisome proliferator-activated receptor (PPAR)-γ and thereby decreased mitochondrial mass. Supplementation of insulin contracted the effect of fasting on all mentioned parameters. ConclusionsFasting downregulates miR-21 and increases its target PTEN, thereby inhibiting mTOR signaling, p-STAT1, PRMT1, and mitochondrial mass. These findings highlight the role of mTOR and PRMT1 in the regulation of cellular energy availability.

Nanopore Identification of Single Nucleotide Mutations in Circulating Tumor DNA by Multiplexed Ligation.

Circulating tumor DNAs (ctDNAs) are highly promising cancer biomarkers, potentially applicable for noninvasive liquid biopsy and disease monitoring. However, to date, sequencing of ctDNAs has proven to be challenging primarily due to small sample size and high background of fragmented cell-free DNAs (cfDNAs) derived from normal cells in the circulation, specifically in early stage cancer. Solid-state nanopores (ssNPs) have recently emerged as a highly efficient tool for single-DNA sensing and analysis. Herein, we present a rapid nanopore genotyping strategy to enable an amplification-free identification and classification of ctDNA mutations. A biochemical ligation detection assay was used for the creation of specific fluorescently-labelled short DNA reporter molecules. Color conjugation with multiple fluorophores enabled a unique multi-color signature for different mutations, offering multiplexing potency. Single-molecule readout of the fluorescent labels was carried out by electro-optical sensing via solid-state nanopores drilled in titanium oxide membranes. As proof of concept, we utilized our method to detect the presence of low-quantity ERBB2 F310S and PIK3Ca H1047R breast cancer mutations from both plasmids and xenograft mice blood samples. We demonstrated an ability to distinguish between a wild type and a mutated sample, and between the different mutations in the same sample. Our method can potentially enable rapid and low cost ctDNA analysis that completely circumvents PCR amplification and library preparation. This approach will thus meet a currently unmet demand in terms of sensitivity, multiplexing and cost, opening new avenues for early diagnosis of cancer.

Efficacy and preclinical safety of ARB202, a potential first-in-class anti-CDH17/CD3 bispecific T-cell engager, for treatment of pancreatic and colorectal cancers.

405 Background: Globally, gastrointestinal (GI) cancers, which account for around 28% of all cancers, has increased constantly at a CAGR of 2% (2014-2019), while the treatment options remain limited and often ineffective. This is largely due to late diagnosis and lack of new tumor associated antigens for most of the GI malignancies. Cadherin-17, CDH17 (aka CA17), is being evaluated as a potential therapeutic target and molecular marker for GI cancers, of which aberrant expression of CDH17 was reported in 50-90% in tumor samples (including stomach, pancreas, liver/bile duct and colon) by multiple groups. The present study aims to develop a humanized CDH17-CD3 bispecific T-cell engager antibody, ARB202, to treat advanced pancreatic and metastatic colon cancers. Methods: The ARB202 bispecific was generated from anti-CDH17 monoclonal ARB102 as previously described (Lum Y et al, Mol. Pharm. 2020) by linking a CD3-binding scFv in the format of IgG4-scFv. Biophysical properties, efficacy and safety were evaluated. Efficacy was addressed in cytotoxicity assays, IL2-release assays and subcutaneous xenograft models using multiple GI tumor target lines. Preclinical safety profiles include Tissue cross-reactivity assays and GLP repeat-dose toxicity studies in NHP. Results: The ARB202 bispecific antibody was efficiently produced (yield ~1 g/L) and remained stable for at least 3 months under accelerated stress tests. Binding affinity (Kd [M]) of ARB202 to CDH17 and CD3 was at 10-10 and 10-9 respectively, with cellular affinities of 10-9 and 10-8. In vitro cytotoxicity assays demonstrate that ARB202-mediated tumor cell killing is CDH17-dependent and requires immune synapse formation with effector T cells. By contrast, normal cells and CDH17-negative cancer cells are resistant. Pancreatic AsPC1 xenograft model revealed an ARB202 (co-inoculated with human PBMC) dose-dependent inhibition of tumor growth. Human IL-2 release in mice blood samples was consistent with functional CDH17 and CD3 engagement. ARB202 PK profile in rodents and NHP was found to be excellent relative to other bispecifics and GLP toxicity studies showed no significant findings nor adverse effects. Conclusions: ARB202 bispecific antibody promises to be a first-in-class biologic, which may tackle approximately 50% of GI cancers that which have been reported CDH17 positive. First-in-human clinical study with advanced GI cancers is scheduled to start in Q1 2021.

Molecular Identification of ABC2 Transporter Gene Encode Protein Ngawi Trypanosoma evansi Isolate that suspected resistance to Isometamidium Chloride

This study aims to determine the profile of the ABC2 encoding transporter on Trypanosoma evansi (T. evansi) Ngawi isolates, Indonesia, exposed with Isometamidium Chloride (ISM). This study used blood samples of mice containing Trypanosoma evansi that had been exposed with ISM 0.05 mg/kg BW, ISM 0.1 mg/kg BW and ISM 0.3 mg/kg BW for 4 weeks, and control group. Blood samples were extracted and amplified using primers. ABC2 F 5 ’GCTTGTCCGACCATCTTGCA 3’ and ABC2 R 5 ’AGGTCCACTCCCATGCTACA 3’ that produced 350 basepairs (bp). The sequencing results were then analyzed using BLAST and MEGA 7.0. There was 1 deference nucleotide (107) derived from multiple alignments, while in amino acids there was no difference in all samples. Trypanosoma evansi which was exposed with ISM does not have many differences in nucleotide or amino acid and only one type of mutation. The ABC2 Transporters of four groups of T.evansi have high similarity to ABC Transporters of T. brucei gambiense, T. brucei brucei, and T. brucei brucei (Tbabc2). Therefore, further research on the ABC2 Transporter gene is needed.

Toxicokinetics of methylmercury in diabetic KK-Ay mice and C57BL/6 mice.

We compared the toxicokinetics of methylmercury (MeHg) in KK-Ay type 2 diabetic mice and C57BL/6J mice to evaluate how metabolic changes associated with diabetes affect MeHg toxicokinetics. A single dose of MeHg (0.2, 1, or 5 mg mercury/kg) was administered orally to 12-week-old KK-Ay and C57BL/6J male mice. Total mercury concentrations in plasma, blood cells, whole blood, and tissues (brain, kidneys, liver, and pancreas) were measured after 4, 7, 11, and 14 days. The volume of distribution/bioavailability and the elimination rate constant per day were higher in KK-Ay mice, while the terminal elimination half-life was lower in almost all samples of KK-Ay mice. The area under the curve was lower in all blood and almost all tissue samples from KK-Ay mice. Total clearance/bioavailability was lower in all blood and tissue samples of KK-Ay mice at all MeHg doses. These results indicate that MeHg is more rapidly absorbed by, and eliminated from, the blood cells, brain, liver, kidney, and pancreas of KK-Ay mice under the experimental conditions. Different patterns of tissue-to-plasma and tissue-to-whole blood partition coefficients suggest that notable differences in MeHg transfer between plasma and blood cells affect its distribution in tissues of the two mouse strains. These findings are useful to understand the selective distribution of MeHg to target organs and the sensitivity to MeHg in pathological states.

Inhibition of Host Arginase Activity Against Staphylococcal Bloodstream Infection by Different Metabolites.

Staphylococcus aureus is a notorious bacterial pathogen that often causes soft tissue and bloodstream infections and invariably garners resistance mechanisms against new antibiotics. Modulation of the host immune response by metabolites is a powerful tool against bacterial infections, but has not yet been used against S. aureus infections. In this study, we identified four metabolite biomarkers: L-proline, L-isoleucine, L-leucine, and L-valine (PILV), through a metabolomics study using animal models of S. aureus bloodstream infection. The exogenous administration of each metabolite or of PILV showed anti-infective effects, and a higher protection was achieved with PILV in comparison to individual metabolites. During the staphylococcal infection, the expression of most host arginase and nitric oxide synthase (NOS) isozymes was simultaneously induced in mouse liver, kidney, and blood samples. However, the induction of arginase isozymes was dramatically stronger than that of NOS isozymes. This elevated arginase activity was inhibited by the metabolite biomarkers thus killing S. aureus, and PILV exhibited the strongest inhibition of arginase activity and bacterial inhibition. The suppression of arginase activity also contributed to the metabolite-mediated phagocytic killing of S. aureus in mouse and human blood. Our findings demonstrate the metabolite-mediated arginase inhibition as a therapeutic intervention for S. aureus infection.

Tracking the expression of therapeutic protein targets in rare cells by antibody-mediated nanoparticle labelling and magnetic sorting.

Molecular-level features of tumours can be tracked using single-cell analyses of circulating tumour cells (CTCs). However, single-cell measurements of protein expression for rare CTCs are hampered by the presence of a large number of non-target cells. Here, we show that antibody-mediated labelling of intracellular proteins in the nucleus, mitochondria and cytoplasm of human cells with magnetic nanoparticles enables analysis of target proteins at the single-cell level by sorting the cells according to their nanoparticle content in a microfluidic device with cell-capture zones sandwiched between arrays of magnets. We used the magnetic labelling and cell-sorting approach to track the expression of therapeutic protein targets in CTCs isolated from blood samples of mice with orthotopic prostate xenografts and from patients with metastatic castration-resistant prostate cancer. We also show that mutated proteins that are drug targets or markers of therapeutic response can be directly identified in CTCs, analysed at the single-cell level and used to predict how mice with drug-susceptible and drug-resistant pancreatic tumour xenografts respond to therapy.

Systemic and Cardiac Alterations After Long Bone Fracture.

ABSTRACTThe purpose of this study was to reveal possible consequences of long-bone fracture on cardiac tissue and to analyze the role of systemically elevated danger associated molecular patterns, complement anaphylatoxins and cytokines. Blood samples of mice, pigs, and humans after a fracture were analyzed by ELISAs for complement component 5a (C5a), tumor necrosis factor (TNF), and extracellular histones. In vivo results were completed by in vitro experiments with human cardiomyocytes treated with TNF and extracellular histones. The influence of histones and human plasma after fracture on isolated human polymorphonuclear leukocytes (PMNs) was investigated. An elevation of TNF, C5a, and extracellular histones after long bone fracture was measured. Moreover, the appearance of systemic troponin I levels was observed and structural changes in connexin 43 and desmin were detected. Further, the presence of TNF leads to elevation of reactive oxygen species, troponin I release, and histone appearance in supernatant of human cardiomyocytes. Incubation of human PMNs with histones and plasma of patients after fracture lead to formation of neutrophil extracellular traps. Present results suggest that structural alterations in the heart might be consequences of the complement activation, the release of extracellular histones, and the systemic TNF elevation in the context of a long bone fracture.

The Involvement of Type 2 Innate Lymphoid Cells in Airway Inflammation of Asthma.

The airway inflammatory response is closely associated with asthma. The purpose of this article was to study the roles of innate lymphoid cells (ILCs) in the process of airway inflammatory response in asthma. We established the asthmatic mice model with intraperitoneal injected ovalbumin medium, then with the flow cytometry analysis, we detected the ILCs and their surface proteins in the mice blood samples, besides, we analyzed the amounts of inflammatory cytokines and secreted proteins in the mice bronchoalveolar lavage fluid and blood serum. Moreover, Western blot analyzed the proteins in the mice bronchial epithelial tissues. The ILC2 amounts were obviously increased in young asthmatic mice model. And, the proteins CD25 and CCR10 were highly expressed in the sorted ILC2s. Besides, the cytokines interleukin (IL)-5, IL-13, IL-33, CCL22, and CCL27 were abundant in the bronchoalveolar lavage fluid of asthmatic mice model. And, the secretion of IL-5, IL-13, IL-33, TSLP, and CCL22 in blood serum was much more in asthmatic mice model than in the normal control mice, whereas the secretion of PGD2 was suppressed in asthmatic mice bronchoalveolar lavage fluid and blood serum. Additionally, the guanine nucleotide-binding proteins Gα12 and Gα13 were upregulated in asthmatic mice bronchial tissues, and the protein SERCA2 was downregulated; moreover, the proteins NFAT, IRF4, and its downstream signal STAT6 were all upregulated in the asthmatic mice bronchial tissues. ILC2s were involved in the response of airway inflammation through secretion of proinflammatory cytokines and chemokines to dysregulate the Ca2+ homeostasis in airway in the process of asthma. [Figure: see text].

Magnetic Nanotrap Particles Preserve the Stability of Venezuelan Equine Encephalitis Virus in Blood for Laboratory Detection.

Most of the modern techniques used for identification of viral-induced disease are based on identification of viral antigens and/or nucleic acids in patient's blood. Diagnosis in the field or in remote locations can be challenging and alternatively samples are shipped to diagnostic labs for testing. Shipments must occur under controlled temperature conditions to prevent loss of sample integrity. We have tested the ability of magnetic Nanotrap® (NT) particles to improve stability and detection of Venezuelan equine encephalitis virus (VEEV), viral capsid protein, and viral genomic RNA in whole human blood at elevated temperature and prolonged storage conditions. NT particles have previously been shown to capture and enrich multiple pathogens including respiratory syncytial virus, influenza virus, coronavirus, and Rift Valley fever virus. Our study indicates that samples incubated with NT particles had detectable levels of infectious VEEV in blood equal to or greater than samples without NT treatment across all temperatures. Viral RNA detection was increased in the presence of NT particles at later time points (72 h) and higher temperature (40°C) conditions. Likewise, detection of VEEV capsid protein was enhanced in the presence of NT particles up to 72 h at 40°C. Finally, we intranasally infected C3H mice with TC-83, the live attenuated vaccine strain of VEEV, and demonstrated that NT particles could substantially increase the detection of VEEV capsid in infected blood incubated up to 72 h at 40°C. Samples without NT particles had undetectable capsid protein levels. Taken together, our data demonstrate the ability of NT particles to preserve and enable detection of VEEV in human and mouse blood samples over time and at elevated temperatures.

Antishock Characteristics of Erythrocyte-mediated Endoplasmic Reticulum Stress in Macrophages in Severe Hemorrhagic Shock Environment Based on TLR9-cGAS-STING-IFN Signal Axis

This study aimed to investigate the protective effects of erythrocyte-mediated endoplasmic reticulum (ER) stress in macrophages in hemorrhagic shock. An hemorrhagic shock model was established in male BALB/c mice. Animals were randomly divided into three groups (n = 8): control group (A), erythrocyte reinfusion group (B), and TLR9 inhibition group (C). Eight healthy BALB/c mice were also included as group N (n = 8). Mice in group A were not treated, while mice in groups B and C were transfused with red blood cells separated from the blood of mice in group N. Flow cytometry was used to detect the expression of erythrocyte surface protein TLR9 in each group. Immunofluorescence assay was used to analyze the distribution and relative expression of protein STING in macrophages. Flow cytometry was used to analyze the expression of STING, ATF6, and IRE1 in macrophages. Enzyme-linked immunosorbent assay was used to analyze the levels of inflammatory signal molecules, including IFN-α, IFN-β, IL-6, CCL4, CCL5, and IL-6. FITC-Annexin V was used to analyze the apoptosis of immune cells (macrophages) in mouse blood samples and to detect the concentration of calcium ions in erythrocyte cytoplasm. The results showed that the expression of erythrocyte surface protein TLR9; the distribution of STING-positive cells in macrophages; the expressions of STING, ATF6, and IRE1 in macrophages; the levels of inflammatory signal molecules; the apoptosis rate of macrophages; and the intracellular calcium concentration in erythrocytes in group B were higher than those in group A, followed by group C. These results suggest that TLR9 regulates ER stress in macrophages of mice with hemorrhagic shock through the TLR9-cGAS-STING-IFN signaling pathway. Increased expression of TLR9 enhanced macrophage activity, reduced apoptosis, enhanced inflammatory response and immune response, and restored electrolyte level, which might be a therapeutic option for the treatment of hemorrhagic shock.

Malaria Parasitaemia and Changes in Follicle Stimulating Hormone and Luteinizing Hormone Levels of Adult Mice

To understand the treatment of malaria, it is important to understand the effect of the administration of specific anti-malarials on various physiological variables. Current study investigated the effect (s) of the anti-malarial, coartem and co-administration of the antioxidant, Vitamin E on the levels of Luteinising and Follicle Stimulating Hormones [LH and FSH] of malaria parasite infected mice. Twenty-eight (28) adult mice were obtained, acclimatized for two (2) weeks and randomly selected into four (4) groups of seven (7) rats per group. Group 1 (Control) received standard mice diet and water <i>ad libitum</i>, while group 2 mice were infected with malaria (<i>Plasmodium berghei</i>) and left untreated. Groups 3 and 4 were inoculated with malaria (<i>Plasmodium berghei</i>); then treated with coartem and coartem + vitamin E respectively. After three (3) weeks of administration of test substance, the mice blood samples were obtained from mice (for each group) and assayed for serum FSH and LH levels. Statistical comparison was then conducted (using the student t-test) against those of control group to ascertain the effects of the changes due to coartem and/or antioxidant vitamin E co-administration to <i>plasmodium berghei</i> infected mice. Study found a statistically significant increase in serum LH levels of male mice after inoculation with <i>plasmodium berghei</i>. This decrease was noticed more even with coartem and antioxidant vitamin E co-administration, implicative of a possible effect in fecundity levels of infected male mice. The level of FSH was significantly increased in infected mice, but however showed a reversal following treatment with coartem and/or antioxidant vitamin E. The effects on reproductive hormones seen here may mirror the effects in man. More studies are needed to elucidate that.

Brassica rapa Polysaccharides Ameliorate CCl4 -Induced Acute Liver Injury in Mice through Inhibiting Inflammatory Apoptotic Response and Oxidative Stress.

Brassica rapa L., also called NIUMA, is used empirically in Tibetan medicine for its antioxidant, anti-inflammatory and antiradiation activities. This study explored the hepatoprotective effects of B. rapa polysaccharides (BRPs) on acute liver injury induced by carbon tetrachloride (CCl4 ) in mice and the underlying mechanisms. Mice were treated with CCl4 after the oral administration of BRPs (55, 110 and 220 mg/kg) or bifendate (100 mg/kg) for 7 days. Blood and liver samples of mice were collected for analysis after 24 h. The ALP, ALT and AST levels and the biological activities of SOD, MDA and GSH-Px were measured. Histopathological changes in the liver were determined through hematoxylin and eosin staining. Moreover, TNF-α, IL-1β and IL-6 expression levels were detected by commercial reagent kits. Finally, Western blot analysis was used to check the relative expression levels of caspase-3, p-JAK2 and p-STAT3. The BRP pre-treatment significantly decreased the enzymatic activities of ALT, ALP and AST in the serum, markedly increased the activities of SOD and GSH-Px in the liver and reduced the MDA concentration in the liver. BRPs alleviated hepatocyte injury and markedly inhibited the expression of TNF-α, IL-1β and IL-6, also downregulating the CCl4 -induced hepatic tissue expression of caspase-3. Furthermore, BRPs inhibited the JAK2/STAT3 signaling pathway in a dose-dependent manner in the liver. This study demonstrated that BRPs exert hepatoprotective effect against the CCl4 -induced liver injury via modulating the apoptotic and inflammatory responses and downregulating the JAK2/STAT3 signaling pathway. Therefore, B. rapa could be considered a hepatoprotective medicine.

The effect of zinc supplementation on pro-inflammatory cytokines (TNF-α, IL-1 AND IL-6) in mice with Escherichia coli LPS-induced diarrhea

Inflammation in the intestine causes diarrhea due to an increased release of pro-inflammatory cytokines such as TNF-α, IL-1, and IL-6. These are triggered by the exposure of E. coli-LPS to epithelial cells of the intestinal mucosa as well as low concentration of zinc in plasma such as in infants or children who are experiencing diarrhea. This paper aims to determine the effects of zinc supplementation on pro-inflammatory cytokines (TNF-α, IL-1 and IL-6) in mice with E. coli-LPS-induced diarrhea. This study used a controlled trial experimental design in the laboratory. A sample size of 20 mice were randomly divided into 4 groups: 1) Control group was given standard foods, 2) Trial group was given E. coli-LPS 2.5 mg/kg/oral once on day1, 3) Prevention group was given E. coli-LPS + 30 mg/kg/oral of zinc once daily for 12 days, 4) Therapeutic group was given E. coli-LPS, and were then given 30 mg/kg/oral of zinc once daily for 12 days if diarrhea occurred. Blood samples of mice were taken through the orbital sinus on the 0, 5th, 10th hour, and on the 4th, 8th and 12th days. Positive effects of zinc supplementation on levels of pro-inflammatory cytokines were observed, in which the higher levels of zinc were present, the lower levels of pro-inflammatory cytokines, especially TNF-α were observed. However, there was an increase of IL-1 and IL-6 levels on the 8th day in the prevention and therapeutic groups. Oral zinc supplementation had a significant positive effect on the levels of pro-inflammatory cytokines. Where there were higher levels of zinc, lower levels of pro-inflammatory cytokines TNF-α were present.

Therapeutic effect of regulatory T cells on mice with experimental autoimmune encephalomyelitis

Objective To study the role of Treg cells in the development of mouse experimental autoimmune encephalomyelitis (EAE) through depleting or transplanting Treg cells. Methods C57BL/6 mice were injected with anti-CD25 monoclonal antibody to deplete natural CD25-expressing Treg cells in vivo, and then treated with MOG35-55/CFA to induce EAE. Their EAE scores were compared with those of the mice without Treg cell deletion (control group). The numbers and percentages of CD4+ Foxp3+ cells in mouse blood samples on 6 d, 10 d, 20 d and 35 d were quantified using flow cytometry. To evaluate the therapeutic effect of Treg cells transplantation on EAE, magnetic activated cell sorting (MACS) combined with fluorescence-activated cell sorting (FACS) was used to isolate Treg cells from spleen and lymph nodes of Foxp3GFP+ transgenic mice on 6 d after EAE induction. Then the cells were injected through tail vein into wild-type mice on 6 d after EAE induction. The EAE scores of both recipient and control mice were recorded and compared. Results The efficiency of natural Treg cells depletion with anti-CD25 antibody was above 95%. The mice with Treg cell depletion developed significantly more severe EAE than the control mice after MOG35-55/CFA induction. FACS analysis of Treg cells during the development of EAE demonstrated that the lowest Treg cell percentage was detected on 6 d after EAE induction, hence it was the time point for the transplantation of Treg cells. CD4+ GFP+ Treg cells were isolated from Foxp3GFP+ transgenic mice on 6 d after EAE induction and immediately transplanted into wild-type mice on 6 d after EAE induction. The transplantation of isolated Treg cells significantly alleviated the EAE in mice as compared with the control group. Conclusions Mice with Treg cell depletion developed severer EAE than the control mice after induction, but the EAE score could be significantly reduced with the transplantation of Treg cells. This study showed that the transplanted Treg cells had protective effect on mice during the course of EAE development. Thus, Treg cell transplantation could be used as an effective therapeutic approach for the treatment of multiple sclerosis (MS). Key words: Multiple sclerosis; Experimental autoimmune encephalomyelitis; Regulatory T cell

1648. Prevalence of Orientia tsutsugamushi, Anaplasma phagocytophilum, and Leptospira interrogans in Striped Field Mice in Gwangju, Republic of Korea

BackgroundScrub typhus, anaplasmosis, and leptospirosis are well-known diseases that are considered common, widespread rodent-borne infectious diseasesMethodsThis study investigated the prevalence of Orientia tsutsugamushi, Anaplasma phagocytophilum, and Leptospira interrogans in wild rodents through molecular detection using organ samples and through serological assay using blood samples of mice collected from two distinct sites in Gwangju Metropolitan City, Republic of Korea (ROK).ResultsA total of 47 wild rodents, identified as Apodemus agrarius (A. agrarius), were captured from June to August 2016. The seroprevalence of antibodies against bacterial pathogens in A. agrarius sera was analyzed; 17.4% (8/46) were identified as O. tsutsugamushi through indirect immunofluorescence assay and 2.2% (1/46) were identified as Leptospira species through passive hemagglutination assay. Using polymerase chain reaction, the spleen, kidney and blood samples were investigated for the presence of O. tsutsugamushi, A. phagocytophilum, and L. interrogans. Out of the 47 A. agrarius, 19.1% (9/47) were positive for A. phagocytophilum and 6.4% (3/47) were positive for L. interrogans, while none were positive for O. tsutsugamushi. Four out of 46 (8.7%) blood samples, six out of 45 (13.3%) spleen samples, and one out of 47 (2.1%) kidney samples were positive for A. phagocytophilum. Three out of 47 (6.4%) kidney samples were positive for L. interrogans. The sequencing results of PCR positive samples demonstrated >99% similarity with A. phagocytophilum and L. interrogans sequencesConclusion A. phagocytophilum was mostly detected in the spleen, whereas L. interrogans was mostly detected in the kidneys. Notably, A. phagocytophilum and L. interrogans were detected in A. agrarius living in close proximity to humans in the metropolitan suburbans. The results of this study indicate that rodent-borne bacteria may be present in wild rodents in the metropolitan suburban areas of ROK Disclosures All authors: No reported disclosures.