Method For Isolation Of DNA Research Articles

Detection of human papillomavirus infection in oral cancers reported at dental facility: assessing the utility of FFPE tissues.

Incidence of human papillomavirus (HPV)-associated oral cancers is on the rise. However, epidemiological data of this subset of cancers are limited. Dental hospital poses a unique advantage in detection of HPV-positive oral malignancies. We assessed the utility of formalin-fixed paraffin-embedded (FFPE) tissues, which are readily available, for evaluation of high-risk HPV infection in oral cancer. For protocol standardization, we used 20 prospectively collected paired FFPE and fresh tissues of histopathologically confirmed oral cancer cases reported in Oral Medicine department of a dental hospital for comparative study. Only short PCRs (~ 200bp) of DNA isolated using a modified xylene-free method displayed a concordant HPV result. For HPV analysis, we used additional 30 retrospectively collected FFPE tissues. DNA isolated from these specimens showed an overall 23.4% (11/47) HPV positivity with detection of HPV18. Comparison of HPV positivity from dental hospital FFPE specimens with overall HPV positivity of freshly collected oral cancer specimens (n = 55) from three cancer care hospitals of the same region showed notable difference (12.7%; 7/55). Further, cancer hospital specimens showed HPV16 positivity and displayed a characteristic difference in reported sub-sites and patient spectrum. Overall, using a xylene-free FFPE DNA isolation method clubbed with short amplicon PCR, we showed detection of HPV-positive oral cancer in dental hospitals.

Isolation and amplification of mangrove plants using DNA barcode in Percut Sei Tuan, North Sumatra, Indonesia

Mangroves are a collection of several species of trees or shrubs that distribute around the coastline and can survive in high salinity environments. Around 60% of mangrove forests in North Sumatra are reported to have been damaged, the main factors of this damage being the mangrove forests conversion into ponds and the expansion of oil palm plantations. Identification of mangrove species is very important in protecting and applying the biodiversity of mangrove forests. Identification of living things has evolved from morphological charcetrization to molecular identification. This study aims to explain the DNA isolation and PCR methods to identify mangrove species in North Sumatra. The results suggested that the rbcL primer used can detect mangrove species that were visualized in the form of DNA bands. The length of DNA fragments of mangrove species Acrosticum aureum ranged 632.0-619.6 bp, species Rhizophora apiculata 619.6-585.8 bp, species Nypa fruticans 600- 592.9 bp, species Avicennia alba 549.1-533.5 bp, species Hibiscus tiliaceus was not detected, and mangrove species Acanthus ilicifolius 480.3 bp.

The integrity and assay performance of tissue mitochondrial DNA is considerably affected by choice of isolation method

The integrity of mitochondrial DNA (mtDNA) isolated from solid tissues is critical for analyses such as long-range PCR, but is typically assessed under conditions that fail to provide information on the individual mtDNA strands. Using denaturing gel electrophoresis, we show that commonly-used isolation procedures generate mtDNA containing several single-strand breaks per strand. Through systematic comparison of DNA isolation methods, we identify a procedure yielding the highest integrity of mtDNA that we demonstrate displays improved performance in downstream assays. Our results highlight the importance of isolation method choice, and serve as a resource to researchers requiring high-quality mtDNA from solid tissues.

Who touched the document?: A new overall strategy for collection and identification of DNA from the questioned documents as a supportive evidence.

The questions on which judges/prosecutors apply for expertise are mostly about by whom a document was drafted/signed. In this study, a new collective strategy was constructed including a collection method, a modified-silica-based DNA isolation method, and a novel purification method on four contact traces formed on four different paper surface during writing, using PCR with AmpFlSTR®GlobalFiler™ STR kit (after experimental comparison between three different kits) and identification using CE. This collective analysis approach is more sensitive and superior to its equivalents on questioned documents in literature because quantifiable amounts of touch DNA and profiles with high loci percentages (100% on day 1, 72.72% after 1 week) were obtained up to 1 week even after the most challenging conditions of sample forming that a forensic scientist can meet; as washing hands just before drafting and using a very low pressure in a shorter time (simulating a simple contact real conditions while drafting), using no visualizing technique that damages the document. Using the strategy, four most commonly used paper types were compared, to see in which of them DNA could be recovered better. The success of this strategy was shown on the 1-day to 10-year-old real samples from a diary and some archive documents from a law office (including the mix-DNA and different ballpoint pens). Thus, it became possible to show if a person had touched the document, in high success rates up to 1 week as a secondary evidence, when primary evidences are insufficient for the detection of document fraud offenses.

A novel method for liquid-phase extraction of cell-free DNA for detection of circulating tumor DNA

Low yields of extracted cell-free DNA (cfDNA) from plasma limit continued development of liquid biopsy in cancer, especially in early-stage cancer diagnostics and cancer screening applications. We investigate a novel liquid-phase-based DNA isolation method that utilizes aqueous two-phase systems to purify and concentrate circulating cfDNA. The PHASIFY MAX and PHASIFY ENRICH kits were compared to a commonly employed solid-phase extraction method on their ability to extract cfDNA from a set of 91 frozen plasma samples from cancer patients. Droplet digital PCR (ddPCR) was used as the downstream diagnostic to detect mutant copies. Compared to the QIAamp Circulating Nucleic Acid (QCNA) kit, the PHASIFY MAX method demonstrated 60% increase in DNA yield and 171% increase in mutant copy recovery, and the PHASIFY ENRICH kit demonstrated a 35% decrease in DNA yield with a 153% increase in mutant copy recovery. A follow-up study with PHASIFY ENRICH resulted in the positive conversion of 9 out of 47 plasma samples previously determined negative with QCNA extraction (all with known positive tissue genotyping). Our results indicate that this novel extraction technique offers higher cfDNA recovery resulting in better sensitivity for detection of cfDNA mutations compared to a commonly used solid-phase extraction method.

MODIFIKASI METODE ISOLASI DNA CETYL TRIMETHYLAMMONIUM BROMIDE (CTAB) UNTUK SAMPEL EPITEL PIPI MANUSIA

Isolation of deoxyribonucleotide (DNA) is an important step in molecular analysis. In this process, DNA must be obtained in sufficient quantities and in good quality for any further analysis. The Cetyl Trimethylammonium Bromide (CTAB) method is commonly used in DNA isolation of plant or fungal. This method is an alternative in DNA isolation since it is easy and inexpensive. This study aims to modify the CTAB method for DNA isolation from human cheek epithelium for any molecular analysis. Epithelial cells were taken from the oral cavity of the researcher. The isolation protocol included cell lysis step with CTAB buffer and proteinase-K, purification step with the addition of chloroform:isoamylalcohol (24:1), precipitation step with isopropanol. The results of the ratio analysis of DNA spectrophotometer at wavelengths of 260 and 280 nm in the range of 1.73-1.85. The quality of DNA isolation was observed by agarose gel electrophoresis and a firm band was obtained after Ethidium Bromide staining. The DNA concentration in both methods ranged from 400-480 mg/mL. The time required for both methods ranges from 2.5-3 hours. The modified CTAB method DNA isolation protocol produces DNA that has good quality and quantity for molecular analysis processes, such as Polymerase Chain Reaction (PCR).

Using alternative buffer for DNA genomic isolation in forest trees

DNA optimization procedures can be carried out on the type of buffer used during extraction or physical handling techniques in separating genomic DNA from other compounds. The research using Three types of buffer: 1. CTAB, 2. Detergents containing Alkyl Benzene Sulfonate (ABS) surfactants and Three Detergents containing Sodium Laureth Sulphate (SLS) surfactants. This study aims to obtain an optimal DNA isolation method to produce genomic DNA of good quality and sufficient quantity so that it can be used for genetic diversity analysis in forest trees and to determine the optimal alternative buffer for CTAB to facilitate DNA isolation in remote areas, which generally hard to get CTAB. The parameters measured in this study were the presence of DNA and DNA concentration. The results showed that DNA isolation of 12 species of forest trees was successfully carried out using CTAB buffer and Detergent containing ABS surfactants by visualizing the genomic DNA bands from the results of the electrophoresis and Nanodrop spectrophotometer meanwhile Detergent containing SLS surfactants buffer was not successful in DNA isolation. The highest DNA quantity (DNA concentration) was found in 19 samples using CTAB buffer and the detergent containing ABS surfactants buffer with a concentration of 1403,8 - 3412,7 ng/µl. The conclusion of this study was CTAB buffer and the Detergent containing ABS surfactants can also be used as an alternative to a simple buffer for DNA isolation experiments.

Development and validation of a flexible DNA extraction (PAN) method for liquid biopsy of multiple sample types.

BackgroundLiquid biopsy is gaining increasing popularity in cancer screening and diagnosis. However, there is no relatively mature DNA isolation method or commercial kit available that is compatible with different LB sample types. This study developed a PAN‐sample DNA isolation method (PAN method) for liquid biopsy samples.MethodsThe PAN method has two key steps, including biosample‐specific pretreatments for various LB sample types and high concentration guanidine thiocyanate buffer for lysis and denaturation procedure. Subsequently, the performance of PAN method was validated by a series of molecular analyses.ResultsThe PAN method was used to isolate DNA from multiple sample types related to LB, including plasma, serum, saliva, nasopharyngeal swab, and stool. All purified DNA products showed good quality and high quantity. Comparison of KRAS mutation analysis using DNA purified using PAN method versus QIAamp methods showed similar efficiency. Epstein‐Barr virus DNA was detected via Q‐PCR using DNA purified from serum, plasma, nasopharyngeal swab, and saliva samples collected from nasopharyngeal carcinoma patients. Similarly, methylation sequencing of swab and saliva samples revealed good coverage of target region and high methylation of HLA‐DPB1 gene. Finally, 16S rDNA gene sequencing of saliva, swab, and stool samples successfully defines the relative abundance of microbial communities.ConclusionsThis study developed and validated a PAN‐sample DNA isolation method that can be used for different LB samples, which can be applied to molecular epidemiological research and other areas.

Comparison of PCR (Polymerase Chain Reaction) Results Using DNA Template Isolation Results with Column and Resin Methods

DNA isolation is a basic technique in molecular biology where DNA is separated from various unnecessary components. There are various methods of DNA isolation but the most commonly used methods are column and resin methods. The purpose of this study was to compare the results of PCR using DNA template isolated by column and resin methods. The research method used in this research is descriptive experimental using 8 whole blood samples. Samples were tested quantitatively with UV-VIS spectrophotometer and qualitatively using PCR. This research was conducted from February to April 2021. The results showed that based on quantitative DNA testing, DNA samples isolated using the column method had higher purity than the resin isolation method, which means that the resin method contained a lot of contamination. However, in terms of concentration, the resin method had a higher concentration than the column method and there was no significant difference in the purity and concentration of DNA if the sample was isolated using the column method and the resin method (r=0.169, r=0.252) after the dependent T test was performed. . In the analysis using PCR, samples isolated by the column method showed a fairly clear band compared to the resin method.

Comparison the Quality of Template DNA isolated by Column Method with and without Centrifugation

DNA isolation is the first step in molecular biology work. The quality of the DNA template is very important because it can affect the DNA amplification reaction. The application of centrifugation to the sample is expected to produce a Buffy coat layer containing nuclear cells. This study aims to compare the quality of the DNA template isolated from the column with and without centrifugation. This research used descriptive experimental method. The samples used were 16 samples with the division of 8 samples given centrifugation treatment and 8 samples without centrifugation. DNA isolation column method is a DNA isolation method that uses a silica membrane, where the silica membrane works as a filter for DNA that is split from the cell. The DNA isolation method column was carried out according to the standard protocol on the Geneaid DNA mini Kit Blood/Tissue. The concentration and purity of DNA were measured using UV-Vis Spectrophotometry at 260 nm and 280 nm. Visualization of DNA isolation results was carried out using 1% agarose gel. The results of measuring the quality of DNA samples using the column method with centrifugation showed better results with clearer visualization of DNA bands than samples without centrifugation. The results of the T dependent statistical test on both samples of p value < 0.05 showed that there was a significant difference in DNA quality with centrifuged and non-centrifuged treatment.

The Comparative Analysis of Some DNA Isolation Methods in Various Plant Taxa

Bitkilerde moleküler düzeyde yapılan çalışmalar, incelenen taksonlardan maksimum kalitede DNA eldesi gerektirmektedir. Bu nedenle, çalışılacak bitkilerden yüksek konsantrasyonlu ve mümkün olabildiğince saf DNA eldesi son derece önemlidir. Bitkilerden genomik DNA izolasyonu için farklı protokoller bulunmaktadır. Bu araştırmada tıbbi ve aromatik bitkilerden Asteraceae, Apiaceae ve Lamiaceae familyalarına ait bazı taksonlar kullanılmıştır. Taksonların hem herbaryum materyali haline getirilmiş kuru yaprak dokularından, hemde taze yaprak dokularından örnekler alınarak denenecek yöntemlerin hangi tip dokularda daha etkin olduğu araştırılmaya çalışılmıştır. Kullanılan yöntemlerde ekstraksiyon tampon çözeltileri içinde yalnızca CTAB ile CTAB+PVP beraber olacak şekilde hazırlanmış, buna ilave olarak hazır izolasyon kiti kullanılmıştır. Genel olarak tüm yöntemlerden yüksek konsantrasyonda DNA elde edilirken, bu yöntemlerle elde edilen gDNA’da, proteinler, RNA, polisakkaritler, uçucu yağlar, fenoller ve diğer kirleticilerin miktarı minimal düzeye indirilmeye çalışılmıştır. İzole edilen DNA’ların konsantrasyonu ve saflığı nanodrop spektrofotometrede ölçülürken, yoğunluğu agaroz jel elektroforezinde görüntülenmiştir. Ayrıca elde edilen DNA’ların PCR çalışmalarına uygunluğu da çeşitli primerler kullanılarak test edilmiştir. Elde edilen DNA’ların miktarı ve kalitesi taksonlar arasında farklılık gösterse de en kaliteli izolasyon her zaman taze bitki materyali kullanılarak yapılan izolasyonlardan elde edilmiştir. Bununla birlikte yalnızca CTAB çözeltisi kullanılan ekstraksiyon yöntemi en yüksek saflık ve yoğunlukta olan DNA’ yı sağlamıştır. Bunu takiben CTAB+PVP yöntemlerinin benzer sonuçlar verdiği görülürken, hazır kit kullanımının ise bitkilerden DNA izolasyonunda çok da kullanışlı olmadığı saptanmıştır. Hazır kit kullanımı her ne kadar daha temiz görünümlü DNA verse de elde edilen DNA’ların yetersiz olduğu görülmüş ve PCR çalışmalarında müspet sonuç vermemiştir.

Application of Doyle and Doyle method for DNA isolation from pamelo yellow orange (Citrus maxima Merr), lime orange (C. limon) and sunkist orange (C. sinensis)

Various species of the genus Citrus have grown naturally and were cultivated in Indonesia as a mega-biodiversity country. In recent years, the nutritional content and antioxidant activity of citrus fruits has been used to prevent of the various chronic and degenerative human diseases including potential as an antidote to viruses. Development of the potential and superiority of Indonesian oranges including Pomelo yellow orange (Citrus maxima Merr), lime orange (C. limon) and Sunkist orange (C. sinensis) are needed to be done with molecular characterization that begins with DNA isolation. The study was conducted with the aim of applying the Doyle and Doyle method for DNA isolation to all of the three types of oranges. The method for isolate DNA from plant usually use Cethyl Trimethyl Ammonium Bromide (CTAB) and Sodium Dodecyl Sulphate (SDS). The aim of this study is to isolate DNA from the orange leaves of Pomelo Yellow Orange, Lime Orange and Sunkist Orange with the Doyle & Doyle method. The results of the isolation of orange DNA were measured using NanoDrop. The results showed that the DNA of the three oranges had purity of pomelo yellow oranges 1,83, limes 1.8 and sunkist oranges 1,51. The concentrations obtained from each of the oranges were Yellow Bali Citrus 532 ng / µl, Lime Citrus 664.5 ng / µl and Sunkist Orange 888.6 ng / µl.

Genetic of Salak Pondoh, Gading Varieties and Its Hybrids Based on RAPD Markers

<p>A molecular marker of parent and offspring is used to find fast and accurate markers influenced by DNA isolation and amplification. This research aims to find the most suitable DNA isolation and DNA amplification methods. This study used four DNA isolation methods; namely IM01, IM02, IM03, and IM04. DNA amplification used ten protocols (AP01, AP02, AP03, AP04, AP05, AP06, AP07, AP08, AP09, and AP010). The results of the research showed that the most suitable DNA isolation method for salak was IM0, and the most suitable DNA amplification for salak was AP04 that produces the highest value of DNA bands.</p><p><strong> </strong></p><p>Keywords: DNA isolation; DNA amplification; hybrids.</p>

Unravelling unexplored diversity of cercosporoid fungi (Mycosphaerellaceae, Mycosphaerellales, Ascomycota) in tropical Africa.

Cercosporoid fungi (Mycosphaerellaceae, Mycosphaerellales, Ascomycota) are one of the largest and most diverse groups of hyphomycetes causing a wide range of diseases of economically important plants as well as of plants in the wild. Although more than 6000 species are known for this group, the documentation of this fungal group is far from complete. Especially in the tropics, the diversity of cercosporoid fungi is poorly known. The present study aims to identify and characterise cercosporoid fungi collected on host plants belonging to Fabaceae in Benin, West Africa. Information on their morphology, host species and DNA sequence data (18S rDNA, 28S rDNA, ITS and tef1) is provided. DNA sequence data were obtained by a simple and non-culture-based method for DNA isolation which has been applied for cercosporoid fungi for the first time in the context of the present study. Among the loci used for the phylogenetic analysis, tef1 provided the best resolution together with the multigene dataset. Species delimitation in many cases, however, was only possible by combining molecular sequence data with morphological characteristics. Based on forty specimens recently collected in Benin, 18 species are presented with morphological descriptions, illustrations and sequence data. Among these, six species in the genus Cercospora and two species in Pseudocercospora are proposed as species new to science. The newly described species are Cercospora (C.) beninensis on Crotalaria macrocalyx, C. parakouensis on Desmodium tortuosum, C. rhynchophora on Vigna unguiculata, C. vignae-subterraneae on Vigna subterranea, C. tentaculifera on Vigna unguiculata, C. zorniicola on Zornia glochidiata, Pseudocercospora sennicola on Senna occidentalis and Pseudocercospora tabei on Vigna unguiculata. Eight species of cercosporoid fungi are reported for Benin for the first time, three of them, namely C. cf. canscorina, C. cf. fagopyri and C. phaseoli-lunati are new for West Africa. The presence of two species of cercosporoid fungi on Fabaceae previously reported from Benin, namely Nothopassalora personata and Passalora arachidicola, is confirmed.

CpDNA-Gene-Sequence-Based Genetic Diversity, Population Structure, and Gene Flow Analysis of Ethiopian Lowland Bamboo (Bambusinea: Oxytenanthera abyssinica (A. Rich.) Munro)

Background. As a member of Poaceae and subfamily Bambusoideae, Ethiopian lowland bamboo (Oxytenanthera abyssinica) is one of the most important nontimber forest resources or a potential alternative to wood and wood products. Ethiopia contributes 86% of the total area of bamboo on the continent, Africa, and 7% of the world. O. abyssinica in Ethiopia accounts for 85% of the total national coverage of bamboo. Several studies have been performed on the genetic diversity and population structure analysis of various bamboo species throughout the world but almost nothing in Ethiopia and O. abyssinica. Methods. Young fresh leaves of O. abyssinica from thirteen natural lowland bamboo growing areas across the country were collected. DNA was isolated using a modified CTAB DNA isolation method. Three cpDNA gene sequences (matK, ndhF3, and rps16) were used for the study. PCR products were analyzed, purified, and pair-end sequenced to calculate AC/GC content, average number of nucleotide differences (k), nucleotide diversity (π) and population mutation rates per 100 sites ( θ w ), InDel (Insertion-Deletion), DNA divergence, gene flow, and genetic differentiation. Results. Metekel Zone was found to have extremely higher k, π, and θ w . Higher frequency of genetic differentiation was found between Metekel Zone vs. the distant populations. Higher frequency of gene flow was found between Assosa Zone vs. Oromia populations. Kurmuk haplotype from gaps or missing data considered and Bambasi haplotype from not considered has descendants around them. Conclusion. Using sequences of cpDNA genes, populations of O. abyssinica collected in Ethiopia show clear diversity based on their geographic location. Metekel Zone was found to have the most diverse population, Assosa Zone has been found to be the source of evolution of O. abyssinica, and Gambella population shows a difference from other O. abyssinica populations.

Аналіз генетичного поліморфізму культури Chlorella vulgaris Beyer. за вирощування в присутності селеніту натрію в комбінації з сульфатом цинку та хлоридом хрому

The use of microalgae for the economic needs and the commercial goals determines the areas of the scientific researches that will make it possible to increase their productivity. It is also important to direct the metabolism of the algae to the activating of certain synthetic processes in order to obtain the desired compounds. The metals and non-metals, entering into the cell, have a high biochemical activity. These elements modify the metabolic reactions in general and the metabolic reactions related to the functioning of the genome of microalgae cells. Aim. The aim was to study the genetic polymorphism of Chlorella vulgaris under the action of such trace elements as selenium, zinc and chromium in order to optimize the methods of algae cultivation and the obtaining of the beneficial compounds. Methods. The hydrobiological methods of algae cultivation, DNA isolation method by Rogers S. and Bendich A. (1985), PCR-analysis with ISSR (inter simple sequence repeats)- and IRAP-markers (inter-retransposon amplified polymorphism) have been used. Results. For all samples of C. vulgaris 109 DNA-fragments were obtained and 42 of them were polymorphic (38.5%). Jacquard distances (DJ) between the samples of C. vulgaris culture (cultures are grown on the media with different elements compositions and control (standard conditions) were 0.232 (only selenite), 0.206 (selenite and zinc) and 0.300 (selenite and chromium). Conclusions. Probably the genetic modifications of C. vulgaris cells are caused by the additional introduction of the microelements into the culture medium. The genetic polymorphism of the algae grown on media with various trace elements and their combinations was like the genetic polymorphism of the unicellular green algae grown in the natural conditions. It indicates the absence of significant genotoxic effects of the trace elements and high metabolic and genetic plasticity of algal culture.

Optimized bacterial DNA isolation method for microbiome analysis of human tissues.

Recent advances in microbiome sequencing have rendered new insights into the role of the microbiome in human health with potential clinical implications. Unfortunately, the presence of host DNA in tissue isolates has hampered the analysis of host‐associated bacteria. Here, we present a DNA isolation protocol for tissue, optimized on biopsies from resected human colons (~2–5 mm in size), which includes reduction of human DNA without distortion of relative bacterial abundance at the phylum level. We evaluated which concentrations of Triton and saponin lyse human cells and leave bacterial cells intact, in combination with DNAse treatment to deplete released human DNA. Saponin at a concentration of 0.0125% in PBS lysed host cells, resulting in a 4.5‐fold enrichment of bacterial DNA while preserving the relative abundance of Firmicutes, Bacteroidetes, γ‐Proteobacteria, and Actinobacteria assessed by qPCR. Our optimized protocol was validated in the setting of two large clinical studies on 521 in vivo acquired colon biopsies of 226 patients using shotgun metagenomics. The resulting bacterial profiles exhibited alpha and beta diversities that are similar to the diversities found by 16S rRNA amplicon sequencing. A direct comparison between shotgun metagenomics and 16S rRNA amplicon sequencing of 15 forceps tissue biopsies showed similar bacterial profiles and a similar Shannon diversity index between the sequencing methods. Hereby, we present the first protocol for enriching bacterial DNA from tissue biopsies that allows efficient isolation of all bacteria. Our protocol facilitates analysis of a wide spectrum of bacteria of clinical tissue samples improving their applicability for microbiome research.

USE OF DIFFERENTIAL LYSIS FOR DNA ISOLATION TO CONFIRM SPERM TRANSFECTION

The purpose of the work. Despite some progress, the creation of transgenic pigs remains a long and inefficient process. One of the key points in the transfection of porcine generative cells is determining the event of the internalization of foreign DNA by cells. The methods currently used to determine the event of the internalization of foreign DNA by cells do not take into account the possibility of the presence of foreign DNA on the surface of sperm, even after washing from the culture medium. With this in mind, the purpose of this work is to develop a method for confirming the transfection of sperm with plasmid DNA.
 Materials and methods of research. Sperm were washed four times with GCCS diluent. Sperm transfection was carried out in 0.6 ml polypropylene tubes with a lid in a volume of 50 μl of a suspension of protein-washed sperm in GCCS with a sperm concentration of 100 million/ml. To 50 μl of the suspension of washed sperm from proteins it was added 10 μl of the ring form of plasmid pET-28c (Novagen, France). Sperm were incubated in a thermostat at 37.7°C for two hours. Incubated sperm were stored at -20°C.
 To isolate DNA, 60 μl of a suspension of washed sperm from proteins with plasmid pET-28c was transferred to 1.5 ml of a polypropylene tube with a lid and centrifuged for 5 min under conditions of 12 thousand vol. min, then 35 μl of supernatant was transferred into a clean 1.5 ml tube leaving at the bottom of approximately 25 μl of liquid with sediment.
 Isolation of DNA from the supernatant: In a 1.5 ml tube containing 35 μl of supernatant, 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 were added to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing the DNA of plasmid pET-28c was transferred to a clean 0.6 ml tube with a lid and stored at -20°C.
 Isolation of DNA from the precipitate: To the precipitate it was added 100 μl of TE buffer and 2 μl of Proteinase K (20 mg/ml) and kept for 1.5 h at +56°C. After 5 minutes of centrifugation under conditions of 12 thousand vol. min the supernatant was removed, then to the precipitate was added 100 μl of TE buffer. The procedure of washing with TE buffer was repeated twice. To the purified precipitate it was added 7 μl of dithiothreitol (DTT), 2 μl of Proteinase K (20 mg/ml) and 5% aqueous suspension of Chelex-100 to a final volume of 100 μl. The contents of the tube were vortexed and incubated in a solid-state thermostat for 30 min at +56°C and 8 min at +96°C. The supernatant containing boar sperm DNA was transferred to a clean 0.6 ml tube with a lid and stored at -20°C.
 The amplification was performed on a programmable thermostat TERTSIK-2 (DNA Technology, Russia). Oligonucleotide primers for the amplification of pET-28c DNA had the following structure: T7 promoter – TAATACGACTCACTATAGGG, T7 terminator – CGCTGAGCAATAACTAGC. This pair of oligonucleotide primers allows to obtain a PCR product with a size of 314 b.p. Tubes with PCR products were stored at -20°C.
 The specificity of the PCR products was checked by 2% agarose gel electrophoresis in 1 × Tris-borate electrode buffer (TBE) for 2 h at a current of 50 mA in a horizontal electrophoretic chamber (Cleaver Scientific Ltd., UK). DNA of plasmid pUC19 hydrolyzed by Msp I endonuclease was used as a molecular weight marker. After electrophoresis, the gel was stained with ethidium bromide solution (10 mg / cm3), and the results of electrophoresis were photographed using a gel documentation system (Cleaver Scientific Ltd., UK).
 Research results. The amplification of DNA of plasmid pET-28c, which was isolated using differential lysis, allowed to obtain a PCR product with a size of 314 b.p. The size of the PCR product using oligonucleotide primers (T7promoter/T7terminator) was as expected. Thus, evidence was obtained that plasmid DNA can enter sperm.
 Conclusions. The time required to isolate DNA using differential lysis depends on the qualifications of the staff and the amount of researches and averages 5–6 hours. This method of DNA isolation does not require the complex equipment and significant costs for reagents, but fertilization of eggs with sperm with a confirmed transfection event will save in the next stages of transfection.

Cyprus Sausages' Bacterial Community Identification Through Metataxonomic Sequencing: Evaluation of the Impact of Different DNA Extraction Protocols on the Sausages' Microbial Diversity Representation.

Cyprus traditional sausages from the Troodos mountainous region of Pitsilia gained the protected geographical indication (PGI) designation from the European Committee (EU 2020/C 203/06). Still, we lack authentication protocols for the distinction of “Pitsilia” from industrially produced Cyprus sausages. Microbial activity is an essential contributor to traditional sausages’ sensorial characteristics, but whether the microbial patterns might be associated with the area of production is unclear. In the present research, we applied high-throughput sequencing (HTS) to provide a linkage between the area of production and Cyprus sausages’ bacterial diversity. To strengthen our findings, we used three different DNA extraction commercial kits: (i) the DNeasy PowerFood Microbial Kit (QIAGEN); (ii) the NucleoSpin Food Kit (MACHEREY-NAGEL); and (iii) the blackPREP Food DNA I Kit (Analytik Jena), in which we applied three different microbial cell wall lysis modifications. The modifications included heat treatment, bead beating, and enzymatic treatment. Results regarding metagenomic sequencing were evaluated in terms of number of reads, alpha diversity indexes, and taxonomic composition. The efficacy of each method of DNA isolation was assessed quantitatively based on the extracted DNA yield and the obtained copy number of (a) the 16S rRNA gene, (b) the internal transcribed spacer (ITS) region, and (c) three Gram-positive bacteria that belong to the genera Latilactobacillus (formerly Lactobacillus), Bacillus, and Enterococcus via absolute quantification using qPCR. Compared with some examined industrial sausages, Pitsilia sausages had significantly higher bacterial alpha diversity (Shannon and Simpson indexes). Principal coordinates analysis separated the total bacterial community composition (beta diversity) of the three Pitsilia sausages from the industrial sausages, with the exception of one industrial sausage produced in Pitsilia, according to the manufacturer. Although the eight sausages shared the abundant bacterial taxa based on 16S rDNA HTS, we observed differences associated with bacterial diversity representation and specific genera. The findings indicate that the microbial communities may be used as an additional tool for identifying of the authenticity of Cypriot sausages.

Choice of Commercial DNA Extraction Method Does Not Affect 16S Sequencing Outcomes in Cloacal Swabs.

Simple SummaryThe cloacal anatomy is unique because the fecal, urinary, and reproductive tracts converge into one orifice. Therefore, sampling for microbiome research can be difficult in birds, especially in agricultural production settings where it may not be feasible to sample the intestines, and cloacal swabs are often used. There is a need to evaluate laboratory methods for 16S rRNA sequencing in cloacal swab samples to ensure reproducible and trustworthy downstream results. We compared four DNA extraction methods from two commercially available magnetic-based DNA extraction kits. Mock communities and negative controls were included for each method and subjected to 16S rRNA sequencing. While extraction quality and yield differed between each extraction method, overall sequencing results were not affected, including alpha and beta diversity. Positive and negative controls are an important aspect of microbiome science and our findings lend guidance to future microbiome research in poultry.As the applications of microbiome science in agriculture expand, laboratory methods should be constantly evaluated to ensure optimization and reliability of downstream results. Most animal microbiome research uses fecal samples or rectal swabs for profiling the gut bacterial community; however, in birds, this is difficult given the unique anatomy of the cloaca where the fecal, urinary, and reproductive tracts converge into one orifice. Therefore, avian gut microbiomes are usually sampled from cloacal swabs, creating a need to evaluate sample preparation methods to optimize 16S sequencing. We compared four different DNA extraction methods from two commercially available kits on cloacal swabs from 10 adult commercial laying hens and included mock communities and negative controls, which were then subjected to 16S rRNA amplicon sequencing. Extracted DNA yield and quality, diversity analyses, and contaminants were assessed. Differences in DNA quality and quantity were observed, and all methods needed further purification for optimal sequencing, suggesting contaminants due to cloacal contents, method reagents, and/or environmental factors. However, no differences were observed in alpha or beta diversity between methods. Importantly, multiple bacterial contaminants were detected in each mock community and negative control, indicating the prevalence of laboratory and handling contamination as well as method-specific reagent contamination. We found that although the extraction methods resulted in different extraction quality and yield, overall sequencing results were not affected, and we did not identify any method that would be an inappropriate choice in extracting DNA from cloacal swabs for 16S rRNA sequencing. Overall, our results highlight the need for careful consideration of positive and negative controls in addition to DNA isolation method and lend guidance to future microbiome research in poultry.