Metaplexis Japonica Research Articles

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Taking spontaneous plants as a natural strategy for vegetation restoration in construction and demolition waste landfills: a case study in Suzhou, China.

Construction and demolition waste (CDW) landfills around the city have caused serious damage to the ecological environment and menaced the public health. Restoration of closed CDW landfills is critical to compensate for the degraded ecosystem and ensure safety in further development and utilization. Vegetation restoration is an essential part of the restoration of CDW landfills, in which the use of spontaneous plants is the foundation of the nature-based strategy. In this study, Fenghuangshan CDW landfill in Suzhou, China, was selected as the research site, and the species composition and diversity of the spontaneous plants were analyzed. Moreover, the types of habitats and growth indexes of 8 species with high frequency and 18 species with medium frequency in the CDW landfill were investigated, and a comprehensive evaluation of growth rate and expansion capacity of the 26 species was conducted. The results showed that, herbs were the main type of the spontaneous plants in the CDW landfill. The species and quantities of the spontaneous plants in the CDW landfill were obviously fewer than those in the surrounding areas of the CDW landfill, and the Shannon-Wiener index and Pielou index of the spontaneous plants were lower compared with the surrounding areas of the CDW landfill. Meanwhile, the differences of dominant families and the distribution of origins, life forms and growth types between these two fields were insignificant. The heliophilous and drought tolerance species were widely distributed in the CDW landfill while the shade-tolerant or hygrophilous species were few. The relatively large comprehensive evaluation indexes of Elymus dahuricus, Daucus carota, Sonchus asper, Geranium carolinianum, Rumex acetosa, Metaplexis japonica, Carex breviculmis, Erigeron canadensis, Trigonotis peduncularis, Lamium amplexicaule reflected their high growth rates and strong expansion capacity, demonstrating their great potentiality in the vegetation restoration of CDW landfills as indispensable components of the nature-based solution.

First report of cucumber mosaic virus infecting Metaplexis japonica (Thunb). Makino in Korea

First report of cucumber mosaic virus infecting Metaplexis japonica (Thunb). Makino in Korea

Phase sensitivity of perennial dicotyledonous weed species to Flex herbicide

Phase sensitivity to Flex herbicide, BP (active ingredient fomesafen 250 g/l) of seven perennial weed species common in soybean crops in the south of the Far East was studied in 2022-2023 under vegetation house conditions: bristly thistle Cirsium setosum (Willd.) Bieb., perennial sowthistle Sonchus arvensis L., corn mint Mentha arvensis L., common mugwort Artemisia vulgaris L., rough hedge nettle Stachys aspera Michx., curly dock Rumex crispus L. and rough potato Metaplexis japonica (Thunb.) Makino. The herbicide treatment of weeds was carried out in three terms in different stages of their growth and development. The preparation was applied in six rates of consumption - 0.75; 1.0; 1.0; 1.25; 1.5; 1.8 and 2.0 litres/ha. The degree of herbicidal effect of Flex was assessed by the decrease in height and weight of above-ground organs of experimental plants in comparison with the control (without treatment). It was found that Flex completely destroys plants of all species studied at the early stages of growth and development (2...5 leaves). When treating weeds in subsequent phases (4...10 leaves), the drug retains very good to good effectiveness against corn mint, bristly thistle, rough potato, and rough hedge nettle. The activity of the herbicide is significantly reduced when it is applied to overgrown weeds. Only corn mint retains high sensitivity to fomesafen after treatment.

Construction of tubular carbon matrix-supported NiCoP-NiS2 nanowires with heterointerfaces for overall water splitting

The design of inexpensive bifunctional electrocatalysts with excellent catalytic activity is crucial for the cost reduction from water splitting. As a kind of biomass with hollow tubular structure, Metaplexis japonica fluff is expected to be a natural substrate for the growth of nanostructured electrocatalysts. Herein, nanowire-like NiCo precursors are grown on Metaplexis japonica fluff biomass substrates by hydrothermal method, which are then converted into carbon microtube supported NiCoP-NiS2 composites (NiCoP-NiS2/CMT) by low-temperature phosphorization and sulfidation treatment. As expected, the biomass substrate provides a guiding role for the growth of NiCoP-NiS2 nanowires, which is conducive to expose more active areas and promote charge transfer during the reaction. As a result, the obtained NiCoP-NiS2/CMT exhibits good electrocatalytic performance for both hydrogen evolution reaction (HER) and oxygen evolution reaction (OER) in 1 M KOH, which only requires overpotentials of 134 and 308 mV at 10 mA cm−2, respectively. In addition, the constructed symmetric water splitting device exhibits a cell voltage of 1.62 V at 10 mA cm−2, and it also displays good stability during the 24 h test.

Ultrathin Fe2O3 shell-encapsulated NiFe alloy nanoparticles embedded in tubular carbon matrix for enhanced oxygen evolution reaction

The exploitation of efficient and low-cost electrocatalysts for the oxygen evolution reaction (OER) is the key to the industrialization of the hydrogen production technology from water splitting. Herein, Ni1Fe2@Fe2O3 composites with core-shell structure embedded in Metaplexis japonica fluff-derived carbon microtube matrix (Ni1Fe2@Fe2O3@C) are prepared by nitrate soaking and subsequent high-temperature calcination, which are used to catalyze the OER. The existence of carbon matrix greatly prevents the agglomeration of metal particles and creates an efficient electron transfer path for OER. The synergy among the carbon matrix, Ni1Fe2 core and Fe2O3 shell together enhances the OER performance, thus endowing Ni1Fe2@Fe2O3@C with the considerable catalytic activity with the overpotential of 271 mV at 10 mA cm−2 and a Tafel slope of 78 mV dec−1. Ni1Fe2@Fe2O3@C also shows good stability due to the double protection of metal particles by biomass carbon matrix and ultrathin Fe2O3 shell. The water splitting device composed of Pt/C as the cathode and Ni1Fe2@Fe2O3@C as the anode exhibits water splitting activity close to that of Pt/C || RuO2 system in alkaline medium, and the stability retention rate of the system reaches to 93 % after 30 h electrolysis.

Bio-Derived Carbon with Tailored Hierarchical Pore Structures and Ultra-High Specific Surface Area for Superior and Advanced Supercapacitors.

We report here on a hollow-fiber hierarchical porous carbon exhibiting an ultra-high specific surface area, synthesized by a facile method of carbonization and activation, using the Metaplexis Japonica (MJ) shell. The Metaplexis Japonica-based activated carbon demonstrated a very high specific surface area of 3635 m2 g−1. Correspondingly, the derived carbonaceous material delivers an ultra-high capacitance and superb cycle life in an alkaline electrolyte. The pore-ion size compatibility is optimized using tailored hierarchical porous carbon and different ion sized organic electrolytes. In ionic liquids nonaqueous based electrolytes we tailored the MJ carbon pore structure to the electrolyte ion size. The corresponding supercapacitor shows a superior rate performance and low impedance, and the device records specific energy and specific power densities as high as 76 Wh kg−1 and 6521 W kg−1, as well as a pronounced cycling durability in the ionic liquid electrolytes. Overall, we suggest a protocol for promising carbonaceous electrode materials enabling superior supercapacitors performance.

Biomass‐Derived, Nitrogen‐Rich Carbon Tubes as Anodes for Sodium‐Ion Hybrid Capacitors

AbstractSodium‐ion hybrid capacitors (SIHCs) are considered a prospective alternative to lithium‐ion batteries (LIBs) since there are rich and available sodium reserves. Here, nitrogen‐doped carbon tubes (N‐MJ) derived from metaplexis japonica fluff are prepared by using a facile method of etching and peeling the fluff with urea to prepare a Na+ storage anode. With prominent traits in terms of structure and a high nitrogen content (11.08 %), N‐MJ exhibits exceptional Na+ storage performance with a high reversible capacity (390.9 mAh g−1 at 50 mA g−1) and excellent long‐term circulation (208.1 mAh g−1 after 2650 cycles at 1 A g−1). Systemic kinetic analysis manifests that the extraordinary performance is responsible for the large‐scale capacitance control. Furthermore, the SIHCs assembled by using N‐MJ and activated carbon (AC) presents a maximum energy density of 111.4 Wh kg−1 (at 445.8 W kg−1) and power density of 2455.2 W kg−1 (at 34.1 Wh kg−1). Notably, the developed SIHCs maintain a 100 % capacity retention rate at 1 A g−1 after 5000 cycles. Overall, our work not only provides a good choice for storage Na+ anode materials, but also supplies a feasible method for the recycling of waste biomass.

Complete genome sequence of a putative new and distinct caulimovirus from Metaplexis japonica (Thunb.) Makino in China

In 2019, a new disease characterized by yellow mottling on leaves was observed on Metaplexis japonica (Thunb.) Makino plants in Liaoning, China. Using RNA sequencing and PCR with overlapping primers, the complete nucleotide sequence of the circular double-stranded DNA genome of a new virus similar to caulimoviruses in diseased samples was determined. The genome comprised 7733 base pairs and was predicted to encode six proteins. It had the closest relationship to a caulimovirus, strawberry vein banding virus, based on sequence comparisons and phylogenetic analysis. Species-level sequence divergences from caulimoviruses were also observed in the conserved genomic regions. A complete episomal viral genome sequence in symptomatic M. japonica plants was identified, and the name "metaplexis yellow mottle-associated virus" is proposed for this virus.

Oil spill cleanup by natural fibers: a review

Purpose In recent years, oil spill pollution has become one of the main problems of environmental pollution. Recovering oil by means of sorbent materials is a very promising approach and has acquired more attention due to its high cleanup efficiency. Compared to synthetic fibrous sorbents, the use of natural fibers in oil spill cleanups offers several advantages including environmental friendliness, degradable features and cost-effectiveness. Therefore, studies on developing sorbents using natural fibers for oil spill cleanup applications have become a research hotspot. Design/methodology/approach This paper reviews the work conducted by several researchers in developing oil sorbents from fibers such as cattail, nettle, cotton, milkweed, kapok, populous seed fiber and Metaplexis japonica fiber. Some featured critical parameters influencing the oil sorption capacity of fibrous substrates are discussed. Oil sorption capacity and reusability performance of various fibers are also discussed. Recent developments in oil spill cleanups and test methods for oil sorbents are briefly covered. Findings The main parameters influencing the oil sorption capacity of sorbents are fiber morphological structure, fiber density (g/cc), wax (%), hollowness (%) and water contact angle. An extensive literature review showed that oil sorption capacity is highest for Metaplexis japonica fiber followed by populous seed fiber, kapok, milkweed, cotton, nettle and cattail fiber. After use, the sorbents can be buried under soil or they can also be burned so that they can be vanished from the surface without causing environmental-related issues. Originality/value This review paper aims to summarize research studies conducted related to various natural fibers for oil spill cleanups, fiber structural characteristics influencing oil sorption and recent developments in oil spill cleanups. This work will inspire future researchers with various knowledge backgrounds, particularly, from a sustainability perspective.

Microporous active carbon with ultrahigh surface area from Metaplexis japonica for high-performance supercapacitor

Microporous active carbon with tunable pore structure and ultrahigh specific surface area of about 2210 m2 g−1 was synthesized from sustainable biomass precursor Metaplexis japonica via a facile carbonization-activation method, among which, micropores with pore size ranging from 1 to 2 nm occupy 87% of the pore volume. This Metaplexis japonica-derived active carbon (MJAC) exhibited high specific capacitance (287 F g−1 at 1.0 A g−1) with good rate capability and excellent cycling stability (capacitance retention of 99% after 20,000 cycles at 20 A g−1) in a three-electrode system. Notably, the interconnected hierarchical and open structure with a high specific surface area contributed to the wide operating voltage window of 2.2 V and high energy density of 29 W h kg−1 at a power density of 550 W kg−1 in a two-electrode system. Therefore, all the remarkable performance of MJAC makes it attractive for application in supercapacitor.

N-doped layered porous carbon electrodes with high mass loadings for high-performance supercapacitors

We report a porous carbon material (NPCM) with a high N content as a high-performance supercapacitor electrode material which was prepared by a simple activation-doping process using Metaplexis Japonica shell as the carbon precursor, ammonium chloride as the nitrogen source and zinc chloride as the activation agent. Its high electrical conductivity, large ion-accessible surface area and fast ion transport ability make it possible to achieve a high mass loading of NPCM per area of the electrode and a high energy and high power density supercapacitor. An electrode with a low NPCM mass loading of 1 mg cm−2 has a gravimetric specific capacitance of 457 F g−1 and an areal specific capacitance of 47.8 μF cm−2. At a much high NPCM loading of 17.7 mg cm−2 it has a high gravimetric capacitance of 161 F g−1. Furthermore, an assembled NPCM//NPCM symmetric supercapacitor with an optimal NPCM loading of 12.3 mg cm−2 delivered a high specific energy of 12.5 Wh kg−1 at an ultrahigh power of 80 kW kg−1 in 1 mol L−1 Na2SO4. The achievement of such high-energy and high-power densities using NPCM will open exciting opportunities for carbon-based supercapacitors in many different applications.

Three new C21 steroidal glycosides isolated from Metaplexis japonica and their potential inhibitory effects on tyrosine protein kinases

Three new steroidal glycosides, metapregnoside A–C (II–IV), together with one known compound, byzantionoside B (I), were isolated from the fresh whole herb of Metaplexis japonica by using high-speed countercurrent chromatography and semi-preparative liquid chromatography. Their structures and relative configurations were elucidated by spectroscopic methods including 1D NMR, 2D NMR and HR-ESI-MS. The potential targets of compound I–IV were identified by virtual screening. And the potential inhibitory effects of these compounds on tyrosine protein kinases were compared by molecular docking. Byzantionoside B (I) was the first isolated compound from Metaplexis genus. The docking score of metapregnoside C (IV) was the highest. And the sugar chain residues at position C-20 in the pregn-4-en-3-one derivatives is the main factor affecting their docking scores on tyrosine protein kinases Fes/Fps.

Carbon tubes from biomass with prominent adsorption performance for paraquat

Paraquat (PQ) pollution has become an increasing seriously threat to the ecological environment. Thus, it is vital to study novel adsorption materials capable of removing PQ. Modified carbon tubes (MCT-600) were prepared by carbonizing the seed hair fibers of Metaplexis japonica at 600 °C and further modifying with nitric acid. The MCT-600 was found to possess a regular morphology, a good graphitization degree and an abundance of carboxyl functional groups. Moreover, this materil exhibits excellent adsorption performance for paraquat (PQ), such as a fast adsorption rate (adsorption equilibrium within 20 min), large adsorption capacity (218.61 mg g−1) and good regeneration ability (reused more than 5 times). The adsorption process for PQ onto MCT-600 was found to be well matched to a Langmuir isotherm and pseudo-second-order kinetics model. Owing to its unique surface properties, green raw material source and simple preparation process, MCT-600 shows potential as an outstanding candidate for PQ removal from water.

Activated carbon fiber derived from the seed hair fibers of Metaplexis japonica: Novel efficient adsorbent for methylene blue

Activated carbon fiber (ACF) has broad application prospects in dyeing wastewater purification owing to its high specific surface area and hierarchical pore distribution. Natural fiber based ACFs is a group of emerging biomass adsorbent with attractive potential adsorbent properties. Herein, we develop a facile carbonization strategy to obtain a novel biomass ACF derived from the seed hair fibers of metaplexis japonica (MACFs), and the prepared MACFs possess hollow structure and the formation of graphite-like crystallites from MACFs is promoted by high temperature of carbonization. MACFs possess well-developed pore distribution, with a maximum specific surface area and total pore volume of 1882.003 m2/g and 1.613 cm3/g, respectively. MACFs exhibits the maximum adsorption capacity to be 943.372 mg/g for methylene blue (MB) fitting well with Langmuir model. Furthermore, MACFs can adsorb full solution of 90 mg/l by filtering only one time, proving its fast-adsorption performance. The high adsorption capacity and speed of MACFs are mainly attributed to three factors: high specific surface area and rich pores benefited from the full activation of hollow fibers, strong electrostatic attraction to MB provided by surface groups, and good contact with dye liquor. This work may shed light of the adsorption mechanism of biomass ACFs for the dyeing molecules and pave the way for the development of low-cost and highly efficient adsorbent.

Metaplexis japonica seed hair fiber: a hydrophobic natural fiber with robust oil–water separation properties

Natural fiber materials exhibit numerous advantages in the fields of oil absorption and oil–water separation owing to their abundant resources, low-cost, renewable and degradable characteristics. Herein, metaplexis japonica seed hair fiber (Mj-fiber), a hydrophobic natural fiber, is proposed as a promising candidate of oil-absorbing and oil–water separation fiber materials with excellent features such as surface superhydrophobicity, high hollow and cross-section heteromorphy. In particular, the oil-absorbing and oil–water separation abilities of such fibers are investigated for the first time. Some featured critical parameters, such as the surface static contact angle and spreading wetting process, oil absorption and oil–water separation performance of fiber assembly are systematically clarified. Mj-fibers possess outstanding superhydrophobic properties with remarkable static contact angle of 151.12°, whereas excellent lipophilicity with static contact angle of 0° against vegetable oil, motor oil and diesel oil. Mj-fibers also have good sorption capacities for vegetable oil, motor oil and diesel oil with 81.52, 77.62 and 57.22 g/g respectively, and oil retention capacities after 12 h with 79.1%, 75.4% and 72.0% respectively. More importantly, Mj-fibers as the filters exhibit an effective oil–water separation performance with high separation efficiency of 98% after four cycles, demonstrating its prominent reusability. Therefore, this work points out a new pathway of bio-based oil absorption material for water pollution caused by oil spill and other accidents with economical, environment-friendly and efficient solution.

Neuroprotective Effect of Metaplexis japonica against in vitro Ischemia Model

Metaplexis japonica (Apocynaceae) is a perennial herb, extensively used in traditional medicinal system for various diseases. The purpose of the study was to evaluate the protective effect of M. japonica against in vitro ischemia. In the present study, 70% ethanol extract of M. japonica was fractionated with different polarity solvents. For in vitro ischemia, oxygen-glucose deprivation followed by reoxygenation (OGD-R) in cells was used to investigate the effects of M. japonica and its fractions. For oxidative stress model, Hydrogen peroxide (H2 O2 ) induced cell death was studied in HT22 cell line. M. japonica and its fractions significantly reduced the HT22 cell damage, which was induced by 4 hrs of OGD followed by 24 hrs of reoxygenation and 24 hrs of H2 O2, respectively. The effectiveness of ethyl acetate fraction was higher than other fractions/crude extract. Our results suggest that M. japonica could be a neuroprotective agent for the treatment of stroke.
 Key words: Metaplexis japonica, Stroke, Oxygen-glucose deprivation, Neuroprotection

The Metaplexis japonica fiber as a potential absorbent for removal of oils and organic solvents

In this study, the oil absorption properties and hydrophobic–oleophilic characteristics of Metaplexis japonica fiber (Mj-fiber) was thoroughly examined. The scanning electron microscopy (SEM) and Fourier-transform infrared spectroscopy (FTIR) analysis revealed that Mj-fiber has hollow structure with thin wall and large lumen covered by hydrophobic waxy coating, indicating its potentiality as oil absorbent. The wetting behaviour of water and oil on the Mj-fiber proved its excellent hydrophobic–oleophilic properties. The Mj-fiber showed high absorption capacity ranging from 48.2 to 137.8 g/g for the variety of oils and organic solvents. Moreover, the Mj-fiber exhibited fast absorption kinetics with the oil-absorbing capacity of 114.8 and 110.0 g/g for motor oil and rapeseed oil respectively at 1 min. In addition, this fiber can effectively recover the oil and organic solvent on the surface or below the water and showed good oil-water separation ability. After seven cycles of reuse, the Mj-fiber still exhibits good oil absorption capacity. The high absorption capacity, environmental compatibility, and good reusability of this fiber confirm its potentiality as natural oil absorbents.

Antibacterial and antioxidant flavonoid derivatives from the fruits of Metaplexis japonica

Metaplexis japonica (Thunb.) Makino is widely distribution and cultivated as a vegetable in China. Chemical studies revealed that its stem and root are rich in polysaccharides, flavonoids, polyphenols, and steroids, which also exhibited interesting activities. However, little attention has been focused on the biological constituents in the fruits of M. japonica. In order to achieve the best use of M. japonica, a chemical investigation of the secondary metabolites of the fruits of M. japonica was performed, and led to the isolation of one new (1), along with eight known flavoniod derivatives (2–9). The antioxidant and antibacterial properties of the crude extract and compound 1 were deeply evaluated through antioxidant and antimicrobial assays. Among them, the crude extract showed significant antioxidant activities in all assays, as well as broad-spectrum antibacterial effects. These results suggested that crude extract of M. japonica would be a potential source as a possible preservatives for foods.

Metaplexis japonicaseed hair fiber: a member of natural hollow fibers and its characterization

Metaplexis japonica seed hair fibers (Mj-fiber), harvested from the seed pods of Metaplexis japonica (Apocynaceae: Asclepiadoideae) originating in China, Japan and Korea, have features ensuring its potential application in the textile and other industrial fields. In spite of the extensive study on the medicinal properties of Metaplexis japonica, research literature about Mj-fiber is quite limited. We obtained Mj-fibers by artificial peeling and seed removing; then the fiber morphology, chemical composition, structures, fiber surface absorption characteristics, and tensile and thermal properties were studied in detail. From the results, Mj-fiber has a hollow structure with a thin fiber wall and large lumen, in which the hollowness is over 92%. Uniquely, Mj-fiber is a natural profiled fiber with a cross-section of a "cross flower" morphology. At the same time, the density of it is very low, accounting for only one-fifth of the cotton fibers, and the fiber length distribution is relatively concentrated. The main component is cellulose, with a content of 53.9 ± 3.20% and structure of cellulose I. In particular, Mj-fiber has excellent hydrophobic and oil affinity surface characteristics. Moreover, the fibers bulkiness and warmth retention performance are comparable to that of duck down. Therefore, the results provide an experimental basis for the application of Mj-fibers in the textile and other industrial fields.