Metabolomic Analysis Research Articles

Transcriptional and Metabolomic Analyses Reveal That GmESR1 Increases Soybean Seed Protein Content Through the Phenylpropanoid Biosynthesis Pathway.

Soybeans are an economically vital food crop, which is employed as a key source of oil and plant protein globally. This study identified an EREBP-type transcription factor, GmESR1 (Enhance of Shot Regeneration). GmESR1 overexpression has been observed to significantly increase seed protein content. Furthermore, the molecular mechanism by which GmESR1 affects protein accumulation through transcriptome and metabolomics was also identified. The transcriptomic and metabolomic analyses identified 95 differentially expressed genes and 83 differentially abundant metabolites during the seed mid-maturity stage. Co-analysis strategies revealed that GmESR1 overexpression inhibited the biosynthesis of lignin, cellulose, hemicellulose, and pectin via the phenylpropane biosynthetic pathway, thereby redistributing biomass within cells. The key genes and metabolites impacted by this biochemical process included Gm4CL-like, GmCCR, Syringin, and Coniferin. Moreover, it was also found that GmESR1 binds to (AATATTATCATTAAGTACGGAC) during seed development and inhibits the transcription of GmCCR. GmESR1 overexpression also enhanced sucrose transporter gene expression during seed development and increased the sucrose transport rate. These results offer new insight into the molecular mechanisms whereby GmESR1 increases protein levels within soybean seeds, guiding future molecular-assisted breeding efforts aimed at establishing high-protein soybean varieties.

Metabolomics analyses provide insights into the nutritional quality profiling in 95 avocado germplasms grown in China

Avocado is widely grown in tropical and subtropical regions of China. Diverse germplasms have been generated through natural hybridization and selective breeding. Here, to screen high-quality avocado germplasms, we characterized the nutritional quality of 95 avocado germplasms grown in China based on metabolomics. The oil content of the 95 avocado germplasms was 2.18 %–16.60 % and followed a normal distribution. We further profiled nine fatty acids, 16 hydrolyzed amino acids, and eight mineral elements in avocado fruit, which varied widely among different germplasms. Correlation analysis revealed significant positive correlations between fatty acid components, as well as between amino acid components and between mineral elements. Clustering analysis and evaluation of the 95 avocado germplasms identified 14 germplasms with high nutritional quality. These findings provide a basis for evaluation of avocado fruit quality and utilization of high-quality avocado germplasms, as well as important implications for the breeding of avocado.

Effects of different drying methods on the nutritional components, microstructure, and metabolomic profile of Spirulina maxima

Spirulina maxima (S. maxima) is considered a potential solution to address the issue of human food security. In this study, three drying methods were employed: spray drying (SD), freeze drying (FD), and vacuum drying (VD), to process fresh S. maxima (FS). A comprehensive nutritional evaluation was conducted using principal component analysis and cluster analysis, along with an untargeted metabolomics study. The results indicated that after SD, FD, and VD treatments, the phycocyanin content decreased by 23 %, 9 %, and 80 %, respectively, compared to that of the FS. The polysaccharide content also significantly decreased by 36 %, 33 %, and 67 %, respectively. Comprehensive analysis showed that SD resulted in the least loss of nutritional indicators in S. maxima. Further metabolomics analysis revealed that prolonged exposure to high temperatures can lead to metabolic disruptions in 2-oxocarboxylic acid metabolism, purine metabolism, amino acid biosynthesis, and starch and sucrose metabolism. Additionally, the levels of coproporphyrin I and coproporphyrin III increased which ultimately led to a decrease in chlorophyll and phycocyanin contents. Therefore, VD resulted in the poorest quality of S. maxima. This study provided a theoretical basis for the quality assessment of S. maxima in response to drying.

Total minor ginsenosides exert anti-fatigue effects via antioxidant, anti-inflammatory, regulating gut microbiota and serum metabolism

Minor ginsenosides have demonstrated notable anti-fatigue capabilities. The aim of this study was to investigate the anti-fatigue mechanisms of total minor ginsenosides (TMGs) derived from a process involving probiotic fermentation and high-pressure steam treatment. The fatigue model was established in BALB/c male mice using weight-bearing swimming and TMGs were administered by orally at a dosage of 200 mg/kg for four weeks. The anti-fatigue mechanisms of TMGs were explored by assessing liver oxidative stress, skeletal muscle inflammation markers, as well as their impact on gut microbiota and serum metabolism. The results indicated that TMGs could significantly increase the levels of SOD, CAT, ATP and Na+-K+-ATPase and enhance the antioxidant capacity by modulating the PGC-1α/KEAP1/NRF2/HO-1 pathway. Meanwhile, TMGs reducing the levels of inflammatory factors TNF-α, IL-1β and IL-6 and inhibited inflammation by modulating the AMPK/TORC2/CREB/PGC-1α pathway. TMGs also regulated the gut microbiota, increasing the abundance of probiotic bacteria and the content of short-chain fatty acids (SCFAs) in the cecum. Serum metabolomics analyses have shown that TMGs can significantly affect the serum metabolic profile of fatigue model mice, regulating metabolic markers through affecting anti-fatigue-related metabolic pathways. In conclusion, TMGs exerted significant anti-fatigue effects through antioxidant and anti-inflammatory effects, and alleviate fatigue by regulating gut microbiota and serum metabolism.

Comparative transcriptomic and metabolomic analyses reveal key regulatory gene for methyl jasmonate-induced steroidal saponins synthesis in Dioscorea composita

Dioscorea composita (D. composita) is a perennial herb with abundant steroidal saponins that have gained worldwide attention for their remarkable efficacy in cardiovascular diseases. However, few studies have been worked on the regulatory network of steroidal saponins biosynthesis under phytohormone induced. In this study, we combined the transcriptome and metabolome analysis to reveal the variation of diosgenin and steroidal saponins in transcriptional and metabolism levels under methyl-jasmonate (MeJA) treatment. Although the application of MeJA indeed significantly increased the accumulation of diosgenin of D. composita, different types of steroidal saponins exhibited different accumulation patterns. Consistently, the expression levels of UDP-glycosyltransferases and Cytochrome P450 monooxygenases genes that highly related to the accumulation of steroidal saponins were either up- or down-regulated. Correlation analyses of transcription factors (TFs)-steroidal saponins and structural genes-TFs were further to identified the TFs potentially involved in the regulation of steroidal saponins biosynthesis. Silencing of DcWRKY11 in Dioscorea composita decreases the accumulation of steroidal saponins by regulating the expression steroidal saponins synthesis genes, suggesting that DcWRKY11 is a positive regulator in the regulation of steroidal saponins biosynthesis. Our findings take a deeper understanding of the regulatory network of MeJA-mediated steroidal saponins biosynthesis in D. composita.

Impact of Aerobic Exercise on Brain Metabolism: Insights from Spatial Metabolomic Analysis.

Exercise is acknowledged for its beneficial effects on brain health; however, the intricate underlying molecular mechanisms remain poorly understood. This study aimed to explore aerobic exercise-induced metabolic alterations in the brain. We conducted an eight-week treadmill running exercise program in two-month-old male C57/BL6J mice. Body weight, serum lipid, glucose levels, and spatial cognition were measured. Spatial metabolomic analysis was performed to compare the metabolomic profiles across different brain regions. Immunohistochemical methods were used to compare the expression of carnitine palmitoyltransferase 1c (CPT1c). Exercise induced significant changes in the analysed metabolomic profiles. There were 904 differentially expressed metabolites (DEMs) detected in the whole brain section. Notable alterations in lipid profiles were observed, and among the 292 lipids detected, there were 74 (25.34%), 85 (29.11%), and 78 (26.71%) lipids differentially expressed in the hippocampus, thalamus, and hypothalamus of the Exe group, respectively. Lipid metabolism related pathways and enzymes were also altered, with L-carnitine and CPT1c upregulated in the three regions (p<0.05), and epinephrine levels decreased in the hippocampus (p<0.05). Furthermore, the vitamin B6 metabolism pathway was altered in the hypothalamus. This study highlighted the significant changes in lipid metabolism induced by involuntary exercise in the brains of young male mice. Exercise also altered epinephrine levels and the vitamin B12 metabolic pathway in specific brain regions, which indicated the multifaceted effects of exercise on the brain.

Natto-derived dipeptide Gln-Gln attenuates scopolamine-induced memory impairment by enhancing cholinergic function in mice

This study investigated the efficacy of natto in counteracting memory impairment induced by scopolamine in mice and identified promising peptides. The peptide fraction prepared from natto fermented for 18 h with Bacillus subtilis var. natto TTCC12 improved memory retention and upregulated hippocampal neuroprotective gene expression, including for choline acetyltransferase (ChAT) and brain-derived neurotrophic factor. Metabolomic analysis revealed that several dipeptides, such as Gln-Leu, Gln-Ile, Gln-Gln, and Ala-Tyr, increased in the blood 60 min after oral administration of the natto peptide fraction in rats. These dipeptides significantly attenuated scopolamine-induced memory impairment and increased brain acetylcholine (ACh) levels. Specifically, Gln-Gln exhibited a dose-dependent improvement by enhancing cholinergic function through increased levels of ACh and ChAT. However, an equimolar amount of Gln, as a free amino acid, showed no significant effects. Therefore, this study demonstrated the potential of natto and its constituents, particularly dipeptides Gln-Gln, in mitigating cognitive impairment.

Altered intestinal microbiota and fecal metabolites in patients with latent and active pulmonary tuberculosis.

Pulmonary tuberculosis (PTB) is the main cause of infection-related mortality and the most common infectious disease that develops resistance to antibiotics. Gut microbiota and their associated metabolites are assumed to induce and influence the development of PTB. However, the alterations of gut microbiota and metabolites in TB patients is currently unclear. Fecal samples were collected from 13 PTB patients, 13 LTBI patients, and 13 healthy controls (HC). 16S rRNA sequencing and metabolomics were used to analyze the changes in the intestinal microbiota and the composition of fecal metabolites in groups. Our findings indicated that the α-diversity of the gut microbiota in patients with PTB and LTBI decreases compared to HC, and at the phylum level, the relative abundance of Firmicutes decreases and the relative abundance of Bacteroides increases. And six genera were notably enriched in PTB patients and four in LTBI patients. Metabolomic analysis showed alterations in metabolite levels, such as short-chain fatty acids and amino acids. we comprehensively explored the changes in the gut microbes and fecal metabolites in patients with PTB and LTBI from the perspective of the gut microbiota, which may provide potential diagnostic biomarkers and therapeutic targets for TB diagnosis and treatment.

DMSO suppresses duclauxin biosynthetic pathway in Talaromyces sp. (strain IQ-313) and untaps terpenoids, polyketides and meroterpenoids biosynthesis

Talaromyces sp. (strain IQ-313) produces duclauxin-type molecules under standard fermentation conditions in rice and oat cereal. Such molecules are of great interest due to their structural complexity and biological activity. Interestingly, application of an OSMAC (One Strain Many Compounds) approach, revealed that the biosynthetic machinery of this fungus can be directed towards the production of other types of molecules, while completely suppressing the biosynthesis of duclauxin (1). To exploit the metabolic potential of Talaromyces sp. (strain IQ-313), it was grown on solid media supplemented with dimethyl sulfoxide (DMSO), an ectopic epigenetic modulator. Metabolomic analysis of the fermentation extract from the strain grown under standard and DMSO-supplemented conditions, using molecular networking, revealed notable differences in the profiles. Chemical investigation of the extract obtained under abiotic stress led to the isolation and characterization of 15 molecules not detected under standard conditions, including nine polyketides, one sesquiterpenoid, two sesterterpenoids, and three meroterpenoids. Among these, talaromophylane (2) an eremophilane sesquiterpenoid, and talaroisochromane (8), an oxoisochromen, have not been previously reported in the literature. The structures of all isolates were established using a combination of spectroscopic and spectrometric data. The absolute configuration of compound 1 was established based on the analysis of NOESY interactions and by comparison of the experimental and theoretical electronic circular dichroism (ECD) curves.

Integrated physiological, transcriptomics and metabolomics analyses provide insights into thermal stress of razor clam, Sinonovacula constricta

Integrated physiological, transcriptomics and metabolomics analyses provide insights into thermal stress of razor clam, Sinonovacula constricta

Mediterranean Diet Pattern: Potential Impact on the Different Altered Pathways Related to Cardiovascular Risk in Advanced Chronic Kidney Disease.

Cardiovascular disease (CVD) remains the most common cause of mortality in chronic kidney disease (CKD) patients. Several studies suggest that the Mediterranean diet reduces the risk of CVD due to its influence on endothelial function, inflammation, lipid profile, and blood pressure. Integrating metabolomic and proteomic analyses of CKD could provide insights into the pathways involved in uremia-induced CVD and those pathways modifiable by the Mediterranean diet. We performed metabolomic and proteomic analyses on serum samples from 19 patients with advanced CKD (aCKD) and 27 healthy volunteers. The metabolites were quantified using four different approaches, based on their properties. Proteomic analysis was performed after depletion of seven abundant serum proteins (Albumin, IgG, antitrypsin, IgA, transferrin, haptoglobin, and fibrinogen). Integrative analysis was performed using MetaboAnalyst 4.0 and STRING 11.0 software to identify the dysregulated pathways and biomarkers. A total of 135 metabolites and 75 proteins were differentially expressed in aCKD patients, compared to the controls. Pathway enrichment analysis showed significant alterations in the innate immune system pathways, including complement, coagulation, and neutrophil degranulation, along with disrupted linoleic acid and cholesterol metabolism. Additionally, certain key metabolites and proteins were altered in aCKD patients, such as glutathione peroxidase 3, carnitine, homocitrulline, 3-methylhistidine, and several amino acids and derivatives. Our findings reveal significant dysregulation of the serum metabolome and proteome in aCKD, particularly in those pathways associated with endothelial dysfunction and CVD. These results suggest that CVD prevention in CKD may benefit from a multifaceted approach, including dietary interventions such as the Mediterranean diet.

Integrative Analysis of Transcriptome and Metabolome Reveals the Regulatory Network Governing Aroma Formation in Grape

The aroma metabolites in grape berries have received attention in recent years, but a global analysis of gene-regulated metabolites is still lacking. In this study, three grape cultivars, “Kyoho”, “Adenauer Rose”, and “Mei Xiangbao”, were used to determine the differential accumulation of metabolites and identify candidate genes related to grape berry aroma. A total of 27,228 genes were detected from the transcriptome, and 128 differentially accumulated metabolites (DAMs) were identified. Terpenoids and ester were the major substances in these three cultivars. KEGG enrichment showed that 12, 8, and 5 compounds were significantly enriched during the maturation process of these three grape cultivars, with most being terpenoids. A combined transcriptome and metabolome analysis found that the associated genes and metabolites were enriched in the following pathways: “Glycine, serine, and threonine metabolism”, “Cysteine and methionine metabolism”, “Tyrosine metabolism”, “Phenylalanine metabolism”, and “Phenylalanine, tyrosine, and tryptophan biosynthesis”. Seven structural genes (VvOMR1, VvGLYK, VvLPD2, VvAK2, VvSHM7, VvASP3, and VvASP1) and four transcription factors (VvERF053, VvERF4, VvMYB46, and VvMYB340) related to grape berry aroma accumulation were discovered. Our findings provide new insights into grape aroma formation and regulatory mechanism research, and the results will be beneficial for grape aroma breeding in the future.

Mechanisms by Which Increased pH Ameliorates Copper Excess in Citrus sinensis Roots: Insight from a Combined Analysis of Physiology, Transcriptome, and Metabolome.

Limited data are available on copper (Cu)-pH interaction-responsive genes and/or metabolites in plant roots. Citrus sinensis seedlings were treated with 300 μM (Cu toxicity) or 0.5 μM (control) CuCl2 at pH 3.0 or 4.8 for 17 weeks. Thereafter, gene expression and metabolite profiles were obtained using RNA-Seq and widely targeted metabolome, respectively. Additionally, several related physiological parameters were measured in roots. The results indicated that elevating the pH decreased the toxic effects of Cu on the abundances of secondary metabolites and primary metabolites in roots. This difference was related to the following several factors: (a) elevating the pH increased the capacity of Cu-toxic roots to maintain Cu homeostasis by reducing Cu uptake and Cu translocation to young leaves; (b) elevating the pH alleviated Cu toxicity-triggered oxidative damage by decreasing reactive oxygen species (ROS) formation and free fatty acid abundances and increasing the ability to detoxify ROS and maintain cell redox homeostasis in roots; and (c) increasing the pH prevented root senescence and cell wall (CW) metabolism impairments caused by Cu toxicity by lowering Cu levels in roots and root CWs, thus improving root growth. There were some differences and similarities in Cu-pH interaction-responsive genes and metabolites between leaves and roots.

Integrated Metabolome and Transcriptome Analysis Reveals the Key Bitter Substances of Pleioblastus amarus Shoots at Different Developmental Stages

Pleioblastus amarus (bitter bamboo) shoots are a traditional forest vegetable in China, renowned for its nutritional composition and associated health benefits. This study aimed to investigate the dynamic changes in nutritional quality and bitterness-related metabolites, as well as corresponding gene expression in P. amarus shoots at three distinct growth stages, specifically at heights of 10 cm (BT1), 20 cm (BT2), and 40 cm (BT3). The results showed that the content of soluble sugars decreased while the content of total phenols and flavonoids, which contribute to bitterness, increased during the growth of P. amarus shoots. In addition, comparative analysis of BT2 vs. BT1, BT3 vs. BT1, and BT3 vs. BT2 revealed 14, 43, and 36, respectively, differentially accumulated metabolites (DAMs). Notably, BT2 exhibited upregulation of flavonoids, such as apigenin, while bitter amino acids, including phenylalanine and arginine, showed a marked increase in BT3. Moreover, differential gene expression analysis revealed 3161, 13268, and 3742 differentially expressed genes (DEGs) in the BT2 vs. BT1, BT3 vs. BT1, and BT3 vs. BT2 comparisons, respectively. An integrated analysis of metabolomic and transcriptomic data indicated that the metabolites and genes associated with the biosynthesis pathways of phenylalanine, tyrosine, tryptophan, arginine, and the branched-chain amino acids valine, leucine, and isoleucine were significantly enriched during the growth of P. amarus shoots. The study indicates that early-stage (≤20 cm) P. amarus shoots are mainly bitter due to flavonoids like apigenin, while the bitterness in later-stage (around 40 cm) shoots is largely due to bitter amino acids such as phenylalanine, arginine, valine, and isoleucine. This research highlights key compounds and genes related to bitterness, providing a basis for future research on enhancing the nutritional value and flavor of P. amarus shoots.

Integrative Metabolomic and Transcriptomic Analysis Provides Novel Insights into the Effects of SO2 on the Postharvest Quality of 'Munage' Table Grapes.

Postharvest grapes exhibit a limited shelf life due to susceptibility to rot and deterioration, significantly reducing their nutritional and economic value. Sulfur dioxide (SO2) is a widely recognized preservative for extending grape storage life. This study performed a detailed analysis of 'Munage' table grapes treated with SO2 fumigation, employing transcriptomic and metabolomic approaches. Results indicate that SO2 fumigation significantly extends the shelf life of grapes, as demonstrated by improved visual quality, reduced decay rates, and increased fruit firmness. We identified 309 differentially accumulated metabolites (DAMs) and 1906 differentially expressed genes (DEGs), including 135 transcription factors (TFs). Both DEGs and DAMs showed significant enrichment of flavonoid-related metabolism compared with the control, and the relative content of four flavonoid metabolites (Wogonin-7-O-glucuronide, Acacetin-7-O-glucuronide, Apigenin-7-O-glucuronide, and Baicalein 7-O-glucuronide) were significantly increased in grapes upon SO2 treatment, suggesting that SO2 treatment had a substantial regulatory effect on grape flavonoid metabolism. Importantly, we constructed complex regulatory networks by screening key enzyme genes (e.g., PAL, 4CLs, CHS, CHI2, and UGT88F3) related to the metabolism of target flavonoid, as well as potential regulatory transcription factors (TFs). Overall, our findings offer new insights into the regulatory mechanisms by which SO2 maintains the postharvest quality of table grapes.

Mechanisms of Amomum villosum essential oil in enhancing tilapia (Oreochromis niloticus) intestinal health

Amomum villosum is a member of the ginger family to treat gastrointestinal diseases in humans. Supplementing the diet of tilapia (Oreochromis niloticus) with essential oil (EOA) can enhance digestive and intestinal antioxidant capacity. We conducted a comparative experiment using tilapia to further understand the potential molecular response mechanism to dietary EOA. Fish were divided into four groups with different feeding doses of EOA: L (2 g/Kg) group, M (4 g/Kg) group, and H (8 g/Kg) group, along with a control group without EOA supplementation. The level of inflammatory factors (TNF-α, IL-1) declined significantly in the EOA group. Comparative transcriptome of the intestines revealed differentially expressed genes (DEGs) in each group, which further revealed that enriched terms were closely related to important pathways such as PI3K-Akt signaling, cell adhesion molecules, regulation of actin cytoskeleton, and autoimmune thyroid disease. These pathways play significant roles in regulating various cellular processes and immune responses of intestines. Intestine metabolomic analysis indicated that dietary EOA caused changes in metabolic processes, particularly in nucleotide metabolism, indicating the potential impact of EOA on these processes. To identify key factors regulating the molecular response to EOA supplementation, a weighted gene co-expression network analysis combined with transcriptome and differential metabolites to identify key genes and metabolites. Glycitein and genistein are substances related to the metabolism of soybean meal were identified. Hmgb2, Parp11, Bcoll is considered to be the key genes, and has the immune regulation function. This study provides new insights into the molecular basis underlying the protective effects of dietary EOA in tilapia. The results can benefit the aquaculture industry by developing dietary strategies to improve the health and welfare of tilapia in intensive farming.

Metabolomic biomarkers in amniotic fluid for early diagnosis of preterm birth and fetal growth restriction.

Preterm birth, affecting about 10% of pregnancies, significantly contributes to perinatal morbidity and mortality. Recent research indicates that metabolomics could enhance pregnancy outcomes and reduce costs by identifying biomarkers related to common pregnancy complications. Our team focused on analyzing amniotic fluid collected during the second trimester to identify potential biomarkers for preterm birth using 1H-NMR metabolomic analysis. We compared amniotic fluid samples from women who delivered prematurely with those who delivered at term. Multivariate principal component analysis revealed dimethylglycine, glucose, myo-inositol, and succinic acid as potential biomarkers for preterm birth prognosis and early diagnosis. Further analysis demonstrated distinct regulation patterns of these metabolites in relation to fetal growth centiles. For instance, dimethylglycine and glucose were upregulated in fetuses above the 20th centile, while citrate and succinate were upregulated in those below it. With Area Under the Curve (AUROC) values over 0.75 and p-values less than 0.05, these metabolites show promise as reliable biomarkers for predicting fetal growth restriction. This approach could significantly impact maternal-fetal medicine by facilitating early diagnosis and personalized interventions. Future research should focus on validating these findings in larger populations and exploring the underlying mechanisms of metabolite regulation.

Serum metabolomics signature of maternally inherited diabetes and deafness by gas chromatography-time of flight mass spectrometry.

The aim of this study was to identify a metabolic signature of MIDD as compared to healthy controls and other types of diabetes. We performed a comprehensive serum metabolomic analysis using gas chromatography-time of flight mass spectrometry (GC-TOFMS) in participants diagnosed with MIDD (n = 14), latent autoimmune diabetes in adults (LADA) (n = 14), type 2 diabetes mellitus (n = 14), and healthy controls (n = 14). Each group was matched for gender and age. There were significant metabolic differences among MIDD and other diabetic and control groups. Compared with control, MIDD patients had high levels of carbohydrates (glucose, galactose, mannose, sorbose, and maltose), fatty acids (2-Hydroxybutyric acid, eicosapentaenoic acid, and octadecanoic acid), and other metabolites (alanine, threonic acid, cholesterol, lactic acid, and gluconic acid), but low level of threonine. Compared with LADA, MIDD patients had high levels of threonic acid and some amino acids (alanine, tryptophan, histidine, proline, glutamine, and creatine) but low levels of serine. Compared with type 2 diabetes mellitus, MIDD patients had high levels of citrulline, creatine, 3-Amino-2-piperidone, but low levels of ornithine, fatty acids (arachidonic acid and octadecanoic acid), and intermediates of the tricarboxylic acid cycle (malic acid and succinic acid). Our study identified a specific metabolic profile related to glycolysis and the tricarboxylic acid cycle in MIDD that differs from healthy controls and other types of diabetes. This unique metabolic signature provides new perspectives for understanding the pathophysiology and underlying mechanisms of MIDD.

Revealing the dynamic changes of metabolites and molecular mechanisms of chlorogenic acid accumulation during the leaf development of Vaccinium dunalianum based on multi-omic analyses.

Vaccinium dunalianum, a medicinal plant, is utilized for Quezui Tea production from its leaf buds and young leaves. Despite prior research on V. dunalianum revealing several medicinal compounds, the comprehensive variations in metabolites during its growth and development, along with the molecular mechanisms underlying high chlorogenic acid (CGA) yield, remain unclear. Through a joint analysis of transcriptomics and proteomics, our study first identified 15 key structural genes and 3 transcription factors influencing CGA biosynthesis in V. dunalianum, offering new evidence to understand its regulatory network. Furthermore, non-targeted metabolomics analysis provides the first extensive report on the metabolic profile of V. dunalianum, furnishing a valuable dataset for deeper exploration of its nutritional and medicinal value, and the development of a quality evaluation system for its product Quezui Tea. This study offers the most comprehensive molecular information on V. dunalianum, marking a significant step toward understanding and enhancing the plant's potential for medicinal and nutritional applications. Additionally, this study also reveals V. dunalianum holds promise as a natural antioxidant source for functional foods, providing data support for network pharmacology.

Dielectric Barrier Discharge Cold Plasma Improves Storage Stability in Paddy Rice by Activating the Phenylpropanoid Biosynthesis Pathway.

A nonthermal pretreatment using dielectric barrier discharge cold plasma (DBD-CP) was developed to improve the stress resistance of paddy rice during postharvest storage. The physicochemical properties, bioactive characteristics, and secondary metabolites of paddy rice were assessed after applying an optimized DBD-CP procedure, with enzyme activities and gene expression monitored over a 60 day storage period at 35 °C. A 17.06% reduction in the total color change index was noted in the DBD-CP group. Bioactive compounds, particularly gallic acid, were significantly increased, enhancing the defense mechanisms against high-temperature stress. Nontargeted metabolomics analysis indicated an upregulation of phenylpropanoid metabolism in DBD-CP-treated rice compared to controls, with notable increases in secondary metabolites such as coumaric acid, caffeic acid, and sinapic acid, suggesting potential biomarkers for stress resistance. Further verification showed significant enhancements in key enzymes of phenylpropanoid metabolism, including phenylalanine ammonia lyase (PAL), cinnamic acid-4-hydroxylase (C4H), plant coumaric acid-3-hydroxylase (C3H), and cinnamyl alcohol dehydrogenase (CAD), with increases ranging from 1.71 to 2.28 times. Gene expression levels of OsPAL7, OsC4H4, and OsCAD2 aligned with these enzymatic changes post-DBD-CP treatment. In conclusion, DBD-CP treatment can modulate phenylpropanoid metabolism in paddy rice, thereby enhancing bioactive compound levels to reduce stress damage during high-temperature storage.