Melanin Biosynthesis Genes Research Articles

Bioactive Fractions Isolated from Harungana madagascariensis Lam. and Psorospermum aurantiacum Engl. Regulate Collagen and Melanin Biosynthesis Gene Expression in UVB-Irradiated Cells with Additional Anti-Inflammatory Potential.

Harungana madagascariensis (HM) and Psorospermum aurantiacum (PA), used traditionally for skin care, have been reported to upregulate the expression of intracellular antioxidant genes, thereby preventing melanoma and protecting fibroblast cell lines from Ultraviolet B (UVB)-induced intracellular oxidative stress. This investigation aimed to identify major compounds in bioactive fractions using bioassay- guided fractionation. The anti-inflammatory effect of fractions was determined by measuring their inhibitory activity on 15-lipoxygenase and nitric oxide (NO) in lipopolysaccharide-stimulated RAW 264.7 macrophage cells. Additionally, the anti-aging efficacy of the fractions was determined by assessing the expression of markers for the aging process, i.e., expression of tyrosinase (TYR), tyrosinase-related protein-1 (TRP-1), procollagen type-1 (COL1A1), and matrix metalloproteinase- 1 (MMP-1) in UVB-induced photoaging in skin cell-lines. Furthermore, UHPLCMS- based identification of the bioactive compounds from the most prominent fraction was also carried out. Hexane fraction of HM significantly inhibited (p <0.05) the 15-lipoxygenase (IC50 = 46.80 μg/mL) and NO production (IC50 = 66.55 μg/mL), whereas hexane fraction of PA was effective (p <0.05) in inhibiting 15-lipoxygenase activity (IC50 = 27.55 μg/mL). Furthermore, the hexane fraction of HM and methanol fraction of PA were significantly effective (p <0.05) in reverting the UVB-mediated altered expressions of MMP-1, TYR, TRP-1, and COL1A1. Furthermore, hexane fraction of HM revealed the presence of harunganin and betulinic acid, whereas vismion D, vismin, kenganthranol B, and bianthrone 1a were identified from the methanol fraction of PA. Overall, the hexane fraction of HM and methanol fraction of PA displayed effective anti-aging activities, with additional anti-inflammatory effects.

Genetic and dermoscopic findings in a case series of children with oculocutaneous albinism.

Oculocutaneous albinism (OCA) is a genetic disease caused by disorders in melanin synthesis or distribution. In this descriptive study conducted in a tertiary care pediatric hospital, patients with a clinical diagnosis of OCA and genetic study were retrospectively recruited and underwent dermatological and ophthalmological exam, including optical coherence tomography (OCT) and digital dermoscopy. Our findings revealed milder OCA phenotypic expression in individuals harboring single pathogenic mutations in conjunction with polymorphisms, as well as in those with mutations of uncertain significance. Regardless OCA subgroup, severe phenotypes of OCA were associated with a higher number of mutations/polymorphisms in melanin biosynthesis genes and paler dermoscopic patterns, such as vascular pattern, which was the most common pattern in our series.

Deficiency of the melanin biosynthesis genes CfSCD1 impedes appressoria formation and disrupts Colletotrichum fructicola infection on apple

Deficiency of the melanin biosynthesis genes CfSCD1 impedes appressoria formation and disrupts Colletotrichum fructicola infection on apple

Efficient multiple gene knockout in Colletotrichum higginsianum via CRISPR/Cas9 ribonucleoprotein and URA3-based marker recycling.

Colletotrichum higginsianum is a hemibiotrophic pathogen that causes anthracnose disease on crucifer hosts, including Arabidopsis thaliana. Despite the availability of genomic and transcriptomic information and the ability to transform both organisms, identifying C. higginsianum genes involved in virulence has been challenging due to recalcitrance to gene targeting and redundancy of virulence factors. To overcome these obstacles, we developed an efficient method for multiple gene disruption in C. higginsianum by combining CRISPR/Cas9 and a URA3-based marker recycling system. Our method significantly increased the efficiency of gene knockout via homologous recombination by introducing genomic DNA double-strand breaks. We demonstrated the applicability of the URA3-based marker recycling system for multiple gene targeting in the same strain. Using our technology, we successfully targeted two melanin biosynthesis genes, SCD1 and PKS1, which resulted in deficiency in melanization and loss of pathogenicity in the mutants. Our findings demonstrate the effectiveness of our methods in analysing virulence factors in C. higginsianum, thus accelerating research on plant-fungus interactions.

Influence of Cmr1 in the Regulation of Antioxidant Function Melanin Biosynthesis in Aureobasidium pullulans.

We have successfully identified the transcription factor Cmr1 from the fungus Aureobasidium pullulans Hit-lcy3T, which regulates melanin biosynthesis genes. Bioinformatics analysis revealed that the Cmr1 gene encodes a protein of 945 amino acids, containing two Cys2His2 zinc finger domains and a Zn(II)2Cys6 binuclear cluster domain located at the N-terminus of Cmr1. To investigate the function of the Cmr1 gene, we performed gene knockout and overexpression experiments. Our results showed that Cmr1 is a key regulator of melanin synthesis in Hit-lcy3T, and its absence caused developmental defects. Conversely, overexpression of Cmr1 significantly increased the number of chlamydospores in Hit-lcy3T and improved melanin production. RT-qPCR analysis further revealed that overexpression of Cmr1 enhanced the expression of several genes involved in melanin biosynthesis, including Cmr1, PKS, SCD1, and THR1. Melanin extracted from the Hit-lcy3T was characterized using UV and IR spectroscopy. Furthermore, we assessed the antioxidant properties of Hit-lcy3T melanin and found that it possesses strong scavenging activity against DPPH·, ABTS·, and OH·, but weaker activity against O2-·. These findings suggest that Hit-lcy3T melanin holds promise for future development as a functional food additive.

Comparative Transcriptome Analysis Reveals the Effect of the DHN Melanin Biosynthesis Pathway on the Appressorium Turgor Pressure of the Poplar Anthracnose-Causing Fungus Colletotrichum gloeosporioides.

Anthracnose of poplar caused by Colletotrichum gloeosporioides is a leaf disease that seriously affects poplar growth. The pathogen invades the host in the form of adherent cells, which generate turgor pressure through the metabolism of intracellular substances prior to penetrating the epidermis of poplar leaves. In this study, the expansion-related pressure of the mature appressorium of the wild-type C. gloeosporioides was approximately 13.02 ± 1.54 MPa at 12 h, whereas it was 7.34 ± 1.23 MPa and 9.34 ± 2.22 MPa in the melanin synthesis-related gene knockout mutants ΔCgCmr1 and ΔCgPks1, respectively. The CgCmr1 and CgPks1 genes were highly expressed at 12 h in the wild-type control, implying that the DHN melanin biosynthesis pathway may play an important role in the mature appressorium stage. The transcriptome sequencing analysis indicated that the upregulated melanin biosynthesis genes in C. gloeosporioides, such as CgScd1, CgAyg1, CgThr1, CgThr2, and CgLac1, are involved in specific KEGG pathways (i.e., fatty acid biosynthesis, fatty acid metabolism, and biotin metabolism). Therefore, we speculate that the melanin synthesis-related genes and fatty acid metabolism pathway genes contribute to the regulation of the turgor pressure in the mature C. gloeosporioides appressorium, ultimately leading to the formation of infection pegs that enter plant tissues. These observations may reflect the co-evolution of C. gloeosporioides and its host.

1,8-Dihydroxynaphthalene Melanin Biosynthesis in Colletotrichum fructicola Is Developmentally Regulated and Requires the Cooperative Function of Two Putative Zinc Finger Transcription Factors.

In ascomycetes, 1,8-dihydroxynaphthalene (DHN) melanin plays important protective functions and its production is usually coupled with development and environmental stress responses. The regulation of melanin biosynthesis, however, remains obscure. Colletotrichum fructicola is a phytopathogen with a broad host range that produces melanized appressoria and perithecia. In this study, we annotated melanin genes in a high-quality C. fructicola genome and characterized two zinc finger transcription factors (TFs) (cmr1 and cmr2) that form a loosely organized gene cluster with several melanin biosynthesis genes. Deleting either TF abolished melanization in both mycelia and perithecia but did not affect appressoria. The deletion mutants also showed perithecial development defects. Overexpressing cmr1 in Δcmr2 strongly activated the expression of melanin biosynthesis genes including pks1, scd1, t4hr1, and thr1 and caused hyper-accumulation of charcoal to black pigment(s). On the other hand, overexpressing cmr2 in Δcmr1 activated pks1, t4hr1, and thr1, but not scd1. We conclude that proper DHN melanin accumulation in C. fructicola requires the cooperative function of two in-cluster TFs that also regulate perithecial development. The study clarifies DHN melanin regulations in C. fructicola and expands the function of melanin in-cluster TFs to sex regulation.

Characterization of Transcriptional Responses to Genomovirus Infection of the White Mold Fungus, Sclerotinia sclerotiorum.

Soybean leaf-associated gemygorvirus-1 (SlaGemV−1) is a CRESS-DNA virus classified in the family Genomoviridae, which causes hypovirulence and abolishes sclerotia formation in infected fungal pathogens under the family Sclerotiniaceae. To investigate the mechanisms involved in the induction of hypovirulence, RNA-Seq was compared between virus-free and SlaGemV−1-infected Sclerotinia sclerotiorum strain DK3. Overall, 4639 genes were differentially expressed, with 50.5% up regulated and 49.5% down regulated genes. GO enrichments suggest changes in integral membrane components and transmission electron microscopy images reveal virus-like particles localized near the inner cell membrane. Differential gene expression analysis focused on genes responsible for cell cycle and DNA replication and repair pathways, ubiquitin proteolysis, gene silencing, methylation, pathogenesis-related, sclerotial development, carbohydrate metabolism, and oxalic acid biosynthesis. Carbohydrate metabolism showed the most changes, with two glycoside hydrolase genes being the most down regulated by −2396.1- and −648.6-fold. Genes relating to pathogenesis showed consistent down regulation with the greatest being SsNep1, SsSSVP1, and Endo2 showing, −4555-, −14.7-, and −12.3-fold changes. The cell cycle and DNA replication/repair pathways were almost entirely up regulated including a putative cyclin and separase being up regulated 8.3- and 5.2-fold. The oxalate decarboxylase genes necessary for oxalic acid catabolism and oxalic acid precursor biosynthesis genes and its metabolism show down regulations of −17.2- and −12.1-fold changes. Sclerotial formation genes also appear differentially regulated including a melanin biosynthesis gene Pks1 and a sclerotia formation gene Sl2 with fold changes of 3.8 and −2.9.

Pseudo-Chromosomal Genome Assembly in Combination with Comprehensive Transcriptome Analysis in Agaricus bisporus Strain KMCC00540 Reveals Mechanical Stimulus Responsive Genes Associated with Browning Effect.

Agaricus bisporus is one of the world’s most popular edible mushrooms, including in South Korea. We performed de novo genome assembly with a South Korean white-colored cultivar of A. bisporus, KMCC00540. After generating a scaffold-level genomic sequence, we inferred chromosome-level assembly by genomic synteny analysis with the representative A. bisporus strains H97 and H39. The KMCC00540 genome had 13 pseudochromosomes comprising 33,030,236 bp mostly covering both strains. A comparative genomic analysis with cultivar H97 indicated that most genomic regions and annotated proteins were shared (over 90%), ensuring that our cultivar could be used as a representative genome. However, A. bisporus suffers from browning even from only a slight mechanical stimulus during transportation, which significantly lowers its commercial value. To identify which genes respond to a mechanical stimulus that induces browning, we performed a time-course transcriptome analysis based on the de novo assembled genome. Mechanical stimulus induces up-regulation in long fatty acid ligase activity-related genes, as well as melanin biosynthesis genes, especially at early time points. In summary, we assembled the chromosome-level genomic information on a Korean strain of A. bisporus and identified which genes respond to a mechanical stimulus, which provided key hints for improving the post-harvest biological control of A. bisporus.

Transcriptional regulation of secondary metabolism and autophagy genes in response to DNA replication stress in Setosphaeria turcica

The fungal pathogen Setosphaeria turcica causes northern corn leaf blight (NCLB), which leads to considerable crop losses. Setosphaeria turcica elaborates a specialized infection structures called appressorium for maize infection. Previously, we demonstrated that the S. turcica triggers an S-phase checkpoint and ATR (Ataxia Telangiectasia and Rad3 related)-dependent self-protective response to DNA genotoxic insults during maize infection. However, how the regulatory mechanism works was still largely unknown. Here, we report a genome wide transcriptional profile analysis during appressorium formation in the present of DNA replication stress. We performed RNA-Seq analysis to identify S. tuicica genes responsive to DNA replication stress. In the current work, we found that appressorium-mediated maize infection by S. turcica is significantly blocked by S-phase checkpoint. A large serial of secondary metabolite and melanin biosynthesis genes were blocked in appressorium formation of S. turcica during the replication stress. The secondary metabolite biosynthesis genes including alcohol dehydrogenase GroES-like domain, multicopper oxidase, ABC-transporter families, cytochrome P450 and FAD-containing monooxygenase were related to plant pathogen infection. In addition, we demonstrated that autophagy in S. turcica is up-regulated by ATR as a defense response to stress. We identified StATG3, StATG4, StATG5, StATG7 and StATG16 genes for autophagy were induced by ATR-mediated S-phase checkpoint. We therefore propose that in response to genotoxic stress, S. turcica utilizes ATR-dependent pathway to turn off transcription of genes governing appressorium-mediated infection, and meanwhile inducing transcription of autophagy genes likely as a mechanism of self-protection, aside from the more conservative responses in eukaryotes.

Novel GSK-3 kinase inhibitor Pym-5 induces GSK-3β rather than GSK-3α-dependent melanogenesis in murine melanoma cells

BackgroundGlycogen synthase kinase-3 (GSK-3) inhibitors are considered to activate Wnt/β-Catenin, which remains a controversial topic in melanoma treatment. ObjectiveHere, we have developed Pym-5, an attractive GSK-3 inhibitor. Using Pym-5 as a chemical tool to probe the GSK-3 biology, we aimed to investigate the potential of GSK-3 inhibition as a strategy of melanoma treatment and underlying mechanisms. MethodsUsing pigment B16 and B16BL6 murine melanoma model in vitro and a zebrafish pigmentation model in vivo, we investigated Pym-5-meditaed activation of Wnt/β-Catenin, melanogenesis and antitumor response in melanoma treatment. ResultsWe found that Pym-5 delayed the growth and promoted melanogenesis of melanoma cells. Pym-5 activated the transcription of β-Catenin and responsive targets genes (AXIN2 and MITF), melanin biosynthesis genes (TYR, TYRP1 and TYRP2) and eventually elevated the production of melanin. Interestingly, genetic inactivation of GSK-3β, but not its paralogue GSK-3α, compromised Pym-5-mediated melanogenesis in B16 and B16BL6 cells. ConclusionThese data provide insight into the potential therapeutic benefits obtained from activation of Wnt/β-Catenin signaling pathway and how Pym-5 can regulate melanin production and the rationale for future clinical application of GSK-3 inhibitor in melanoma patients.

Biological characterization of the melanin biosynthesis gene Bcscd1 in the plant pathogenic fungus Botrytis cinerea

The gray mold fungus Botrytis cinerea produces dark-colored conidia and sclerotia due to deposition of melanin on the cell wall of these structures. However, the role of melanin biosynthesis on development and function of conidia and sclerotia have not been well elucidated in this fungus. This study disrupted the melanin biosynthesis gene Bcscd1 (for scytalone dehydratase) in the wild type B05.10, and the resulting mutants were compared with B05.10 and complementary mutants (COM) for growth and development, virulence and response to biotic/abiotic stresses. Three disruption mutants were obtained, and they did not differ from B05.10 and COM in mycelial growth rate on potato dextrose agar, however, they formed brownish conidia and scleotia deficient in melanogenesis, whereas B05.10 and COM formed grayish conidia and black sclerotia with normal melanogenesis. The disruption mutants were as aggressive as B05.10 and COM in infection of tobacco leaves. TEM observation showed that the disruption mutant ΔScd1-85 formed numerous tiny grooves in the conidial cell wall, thereby causing uneven thickness in the cell wall. In contrast, B05.10 and COM rarely formed tiny grooves in their conidial cell wall with even thickness. Moreover, the sclerotial cortex cell wall of ΔScd1-85 lost rigidity and the cells became collapsed, whereas the sclerotial cortex cell wall of B05.10 and COM appeared rigid, and the cells appeared plump in shape. The disruption mutants were more sensitive than B05.10 and COM in response to chemical stresses (H2O2, NaCl, SDS, sorbitol) for conidial germination and sclerotial survival. The sclerotia of the disruption mutants were more susceptible than the sclerotia of B05.10 and COM to infection by the mycoparasite Trichoderma koningiopsis. These results confirmed previous studies about the effect of melanin production on pathogenicity of B. cinerea, and expanded our knowledge about the role of Bcscd1 in cell wall integrity and in response to biotic and abiotic stresses.

Toxicity of Ribavirin to Spodoptera litura by Inhibiting the Juvenile Hormone.

Ribavirin is an antiviral drug showing high and delayed toxicity to the destructive agricultural pest Spodoptera litura. Larvae fed with artificial diets containing ribavirin could not molt successfully and showed abnormal phenotypes, including cuticle melanization and heavy wrinkle of the newly formed procuticle. RNA-Seq analysis suggested that ribavirin has great negative influence on cuticle. Quantitative real-time-polymerase chain reaction results indicated that ribavirin treatment decreased the expression of key genes in juvenile hormone (JH) biosynthesis (CYP15C1 and JH acid methyltransferase) and most cuticle protein genes, whereas the genes in melanin biosynthesis and bursicon genes were upregulated by ribavirin treatment. These results coincided with the decreased titer of JH I, JH II, and JH III determined by enzyme-linked immunosorbent assay, the much thinner procuticle layer exhibited by histopathological examination, and the cuticle melanization after ribavirin treatment. These results provided a valuable theoretical basis for the creation of green insecticides targeting JH and the development of new insecticide derivatives from 1,2,4-triazole.

Integrated application of transcriptomics and metabolomics provides insights into the antifungal activity of α-phenylcinnamic acid against Colletotrichum gloeosporioides

Anthracnose caused by Colletotrichum gloeosporioides leads to significant economic loss of varieties of tropical and subtropical fruit. In the present study, a cinnamic acid derivative α-phenylcinnamic acid (α-PA) was found effective in control of postharvest anthracnose on mango fruit. α-PA strongly inhibited conidia germination, germ tube elongation, and appressorium formation. To elucidate the underlying molecular mechanisms by which α-PA shows antifungal activity, a transcriptomics and a widely targeted metabolomics analysis were conducted to study the changes in gene expression and metabolic profile. The result showed that the expression of 1477 genes and content of 198 metabolites were changed by α-PA. The following KEGG enrichment and correlation analysis suggested that biosynthesis of amino acids and some secondary metabolites were interfered by α-PA, including indoles which are one group of melanin precursors. In addition, qRT-PCR analysis and measurement of melanin revealed that α-PA down-regulated the expression of melanin biosynthesis genes and reduced melanin biosynthesis. Taken together, these data suggest that α-PA could decrease anthracnose in postharvest fruit by interfere with amino acid and secondary metabolite metabolism of C. gloeosporioides.

Transcription Factors Pmr1 and Pmr2 Cooperatively Regulate Melanin Biosynthesis, Conidia Development and Secondary Metabolism in Pestalotiopsis microspora.

Melanins are the common fungal pigment, which contribute to stress resistance and pathogenesis. However, few studies have explored the regulation mechanism of its synthesis in filamentous fungi. In this study, we identified two transcription factors, Pmr1 and Pmr2, in the filamentous fungus Pestalotiopsis microspora. Computational and phylogenetic analyses revealed that Pmr1 and Pmr2 were located in the gene cluster for melanin biosynthesis. The targeted deletion mutant strain Δpmr1 displayed defects in biosynthesis of conidia pigment and morphological integrity. The deletion of pmr2 resulted in reduced conidia pigment, but the mycelial morphology had little change. Moreover, Δpmr2 produced decreased conidia. RT-qPCR data revealed that expression levels of genes in the melanin biosynthesis gene cluster were downregulated from the loss of Pmr1 and Pmr2. Interestingly, the yield of secondary metabolites in the mutant strains Δpmr1 and Δpmr2 increased, comparing with the wild type, and additionally, Pmr1 played a larger regulatory role in secondary metabolism. Taken together, our results revealed the crucial roles of the transcription factors Pmr1 and Pmr2 in melanin synthesis, asexual development and secondary metabolism in the filamentous fungus P. microspora.

Transcriptome Analysis Reveals Genes Associated With Sexual Dichromatism of Head Feather Color in Mallard.

Sexual dimorphism of feather color is typical in mallards, in which drakes exhibit green head feathers, while females show dull head feather color. We showed that more melanosomes deposited in the males’ head’s feather barbules than females and further form a two-dimensional hexagonal lattice, which conferred the green feather coloration of drakes. Additionally, transcriptome analysis revealed that some essential melanin biosynthesis genes were highly expressed in feather follicles during the development of green feathers, contributing to melanin deposition. We further identified 18 candidate differentially expressed genes, which may affect the sharp color differences between the males’ head feathers, back feathers, and the females’ head feathers. TYR and TYRP1 genes are associated with melanin biosynthesis directly. Their expressions in the males’ head feather follicles were significantly higher than those in the back feather follicles and females’ head feather follicles. Most clearly, the expression of TYRP1 was 256 and 32 times higher in the head follicles of males than in those of the female head and the male back, respectively. Hence, TYR and TYRP1 are probably the most critical candidate genes in DEGs. They may affect the sexual dimorphism of head feather color by cis-regulation of some transcription factors and the Z-chromosome dosage effect.

PoRal2 Is Involved in Appressorium Formation and Virulence via Pmk1 MAPK Pathways in the Rice Blast Fungus Pyricularia oryzae.

Pyricularia oryzae is an important plant pathogenic fungus that can severely damage rice and wheat crops, leading to significant reductions in crop productivity. To penetrate into and invade tissues of its plant host, this fungus relies on an invasive structure known as an appressorium. Appressorium formation is rigorously regulated by the cAMP-PKA and Pmk1 MAPK pathways. Here, we identified PoRal2, a homologous protein of Schizosaccharomyces pombe Ral2, and characterized its roles in fungal development and virulence in P. oryzae. PoRal2 contains N-terminal kelch repeats and C-terminal BTB domains. PoRal2 is involved in sporulation, aerial hypha and conidiophore differentiation, appressorium formation, plant penetration, and virulence. During appressorium formation, ∆Poral2 mutants generate appressoria with long germ tubes on hydrophobic surfaces. ∆Poral2 mutants exhibited a defective response to exogenous cAMP and the activated RAS2G18V on a hydrophilic surface, indicating impairment in the cAMP-PKA or Pmk1 MAPK signaling pathways. Deletion of PoRAL2 leads to lowered Pmk1 phosphorylation level in the mutant. Moreover, PoRal2 is found to interact with Scd1, Smo1, and Mst50, which are involved in activation of Pmk1. In addition, the expression levels of MPG1, WISH, and PDEH in the cAMP-PKA pathway, RAS2 in both the cAMP-PKA and Pmk1 MAPK pathways, and melanin biosynthesis genes (ALB1, BUF1, and RSY1) were significantly down-regulated in the ∆Poral2. Therefore, PoRal2 is involved in fungal development and virulence by its crosstalk in the cAMP-PKA and Pmk1 MAPK signaling pathways.

First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Two Splice Isoforms of Leptinotarsa Ecdysis Triggering Hormone Receptor Have Distinct Roles in Larva-Pupa Transition.

Insect ecdysis triggering hormone (ETH) receptors (ETHRs) are rhodopsin-like G protein-coupled receptors. Upon binding its ligand ETH, ETHR initiates a precisely programed ecdysis behavior series and physiological events. In Drosophila melanogaster, the ethr gene produces two functionally distinct splicing isoforms, ethra and ethrb. ETH/ETHRA activates eclosion hormone (EH), kinin, crustacean cardioactive peptide (CCAP), and bursicon (burs and pburs) neurons, among others, in a rigid order, to elicit the behavioral sequences and physiological actions for ecdysis at all developmental stages, whereas ETH/ETHRB is required at both pupal and adult ecdysis. However, the role of ETHRB in regulation of molting has not been clarified in any non-drosophila insects. In the present paper, we found that 20-hydroxyecdysone (20E) signaling triggers the expression of both ethra and ethrb in a Coleopteran insect pest, the Colorado potato beetle Leptinotarsa decemlineata. RNA interference (RNAi) was performed using double-stranded RNAs (dsRNAs) targeting the common (dsethr) or isoform-specific (dsethra, dsethrb) regions of ethr. RNAi of dsethr, dsethra, or dsethrb by the final-instar larvae arrested larva development. The arrest was not rescued by feeding 20E. All the ethra depleted larvae stopped development at prepupae stage; the body cavity was expanded by a large amount of liquid. Comparably, more than 80% of the ethrb RNAi larvae developmentally halted at the prepupae stage. The remaining Ldethrb hypomorphs became pupae, with blackened wings and highly-expressed burs, pburs and four melanin biosynthesis genes. Therefore, ETHRA and ETHRB play isoform-specific roles in regulation of ecdysis during larva-pupa transition in L. decemlineata.

First description of the sexual stage of Venturia effusa, causal agent of pecan scab

ABSTRACT Pecan scab, caused by Venturia effusa, is the most prevalent disease of pecan in the southeastern United States. Recent characterization of the mating type (MAT) distribution of V. effusa revealed that the MAT idiomorphs are in equilibrium at various spatial scales, indicative of regular sexual recombination. However, the occurrence of the sexual stage of V. effusa has never been observed, and the pathogen was previously considered to rely entirely on asexual reproduction. We were able to generate the sexual stage by pairing isolates of opposite mating types on oatmeal culture media. Cultures were incubated at 24 C for 2 mo to allow hyphae from isolates of each mating type to interact. Culture plates were then incubated at 4 C for 4 mo, after which immature pseudothecia were observed. Following exposure to a 12-h photoperiod for 2 wk at 24 C, asci and ascospores readily developed. Pseudothecium and ascospore production was optimal when incubated for 4 mo at 4 C. We utilized progeny from a cross of an albino isolate and wild-type (melanized) isolates to determine that recombination had occurred. Multilocus genotyping using 32 microsatellite markers confirmed that progeny were the result of recombination, which was further supported by segregation of mating types and culture pigmentation. Albino progeny were all confirmed to contain the same mutation in the polyketide synthase (PKS1) melanin biosynthesis gene as the albino parent. The results of this study demonstrate the heterothallic nature of V. effusa. The impact of determining the source of the overwintering ascostroma will aid in management decisions to reduce the primary inoculum in the disease cycle.