Mediates Platelet Aggregation Research Articles

Molecular dynamics simulations involving different β-propeller mutations reported in Swiss and French patients correlate with their disease phenotypes

Integrin αIIbβ3 is the predominant receptor for fibrinogen which mediates platelet aggregation, an important step in hemostasis and thrombosis. Several mutations have been reported in the genes encoding αIIb and β3 subunits among patients with Glanzmann thrombasthenia, of which 177 are in the β-propeller domain. The two subunits form a heterodimer at the interface between β-propeller and β-I domains of αIIb and β3, respectively with their stability critical for intracellular trafficking, surface expression, and ligand binding. Our study was aimed at retrieving the β-propeller mutations from various databases and studying structural variations due to select mutations upon interaction with fibrinogen using molecular docking and molecular dynamics. Mutations were studied for their impact on phenotypic severity, structural stability, and evolutionary conservation. Molecular docking analysis and molecular dynamics simulations were carried out for αIIb-β3 complexes as well as αIIbβ3-fibrinogen complexes; in particular, E355K structure had more deviations, fluctuations, and other changes which compromised its structural stability and binding affinity when compared to both wild-type and G401C structures. Our comprehensive in silico analysis clearly reiterates that mutations in the β-propeller are not only responsible for structural changes in this domain but also have implications on the overall structure and function of integrin αIIbβ3.

Application of Funnel Metadynamics to the Platelet Integrin αIIbβ3 in Complex with an RGD Peptide.

Integrin αIIbβ3 mediates platelet aggregation by binding the Arginyl-Glycyl-Aspartic acid (RGD) sequence of fibrinogen. RGD binding occurs at a site topographically proximal to the αIIb and β3 subunits, promoting the conformational activation of the receptor from bent to extended states. While several experimental approaches have characterized RGD binding to αIIbβ3 integrin, applying computational methods has been significantly more challenging due to limited sampling and the need for a priori information regarding the interactions between the RGD peptide and integrin. In this study, we employed all-atom simulations using funnel metadynamics (FM) to evaluate the interactions of an RGD peptide with the αIIb and β3 subunits of integrin. FM incorporates an external history-dependent potential on selected degrees of freedom while applying a funnel-shaped restraint potential to limit RGD exploration of the unbound state. Furthermore, it does not require a priori information about the interactions, enhancing the sampling at a low computational cost. Our FM simulations reveal significant molecular changes in the β3 subunit of integrin upon RGD binding and provide a free-energy landscape with a low-energy binding mode surrounded by higher-energy prebinding states. The strong agreement between previous experimental and computational data and our results highlights the reliability of FM as a method for studying dynamic interactions of complex systems such as integrin.

Pharmacological Studies on the Ca2+ Influx Pathways in Platelet-Activating Factor (PAF)-Induced Mouse Urinary Bladder Smooth Muscle Contraction.

Platelet-activating factor (PAF) not only acts as a mediator of platelet aggregation, inflammation, and allergy responses but also as a constrictor of various smooth muscle (SM) tissues, including gastrointestinal, tracheal/bronchial, and pregnancy uterine SMs. Previously, we reported that PAF induces basal tension increase (BTI) and oscillatory contraction (OC) in mouse urinary bladder SM (UBSM). In this study, we examined the Ca2+ influx pathways involved in PAF-induced BTI and OC in the mouse UBSM. PAF (10-6 M) induced BTI and OC in mouse UBSM. However, the PAF-induced BTI and OC were completely suppressed by extracellular Ca2+ removal. PAF-induced BTI and OC frequencies were markedly suppressed by voltage-dependent Ca2+ channel (VDCC) inhibitors (verapamil (10-5 M), diltiazem (10-5 M), and nifedipine (10-7 M)). However, these VDCC inhibitors had a minor effect on the PAF-induced OC amplitude. The PAF-induced OC amplitude in the presence of verapamil (10-5 M) was strongly suppressed by SKF-96365 (3 × 10-5 M), an inhibitor of receptor-operated Ca2+ channel (ROCC) and store-operated Ca2+ channel (SOCC), but not by LOE-908 (3 × 10-5 M) (an inhibitor of ROCC). Overall, PAF-induced BTI and OC in mouse UBSM depend on Ca2+ influx and the main Ca2+ influx pathways in PAF-induced BTI and OC may be VDCC and SOCC. Of note, VDCC may be involved in PAF-induced BTI and OC frequency, and SOCC might be involved in PAF-induced OC amplitude.

Elabela-apelin-12, 17, 36/APJ system promotes platelet aggregation and thrombosis via activating the PANX1-P2X7 signaling pathway.

The elabela-apelin/angiotensin domain type 1receptor-associated protein(APJ) system is an important regulator in certain thrombosis-related diseases such as atherosclerosis, myocardial infarction, and cerebral infarction. Our previous reports have revealed that apelin exacerbates atherosclerotic lesions. However, the relationship between the elabela-apelin/APJ system and platelet aggregation and atherothrombosis is unclear. The results of the present study demonstrate that elabela and other endogenous ligands such as apelin-12, -17, and -36 induce platelet aggregation and thrombosis by activating the pannexin1(PANX1)-P2X7 signaling pathway. Interestingly, the diuretic, spironolactone, a novel PANX1 inhibitor, alleviated elabela- and apelin isoforms-induced platelet aggregation and thrombosis. Significantly, two potential antithrombotic drugs were screened out by targeting APJ receptors, including the anti-HIV ancillary drug cobicistat and the traditional Chinese medicine monomer Schisandrin A. Both cobicistat and Schisandrin A abolished the effects of elabela and apelin isoforms on platelet aggregation, thrombosis, and cerebral infarction. In addition, cobicistat significantly attenuated thrombosis in a ponatinib-induced zebrafish trunk model. Overall, the elabela-apelin/APJ axis mediated platelet aggregation and thrombosis via the PANX1-P2X7 signaling pathway in vitro and in vivo. Blocking the APJ receptor with cobicistat/Schisandrin A or inhibiting PANX1 with spironolactone may provide novel therapeutic strategies against thrombosis.

Dual roles of fucoidan-GPIbα interaction in thrombosis and hemostasis: implications for drug development targeting GPIbα

BackgroundPlatelet GPIbα–von Willebrand factor (VWF) interaction initiates platelet adhesion, activation, and thrombus growth, especially under high shear conditions. Therefore, the GPIb–VWF axis has been suggested as a promising target against arterial thrombosis. The polysaccharide fucoidan has been reported to have opposing prothrombotic and antithrombotic effects; however, its binding mechanism with platelets has not been adequately studied. ObjectiveThe objective of this study was to explore the mechanism of fucoidan and its hydrolyzed products in thrombosis and hemostasis. MethodsNatural fucoidan was hydrolyzed by using hydrochloric acid and was characterized by using size-exclusion chromatography, UV-visible spectroscopy, and fluorometry techniques. The effects of natural and hydrolyzed fucoidan on platelet aggregation were examined by using platelets from wild-type, VWF and fibrinogen-deficient, GPIbα-deficient, and IL4Rα/GPIbα-transgenic and αIIb-deficient mice and from human beings. Platelet activation markers (P-selectin expression, PAC-1, and fibrinogen binding) and platelet-VWF A1 interaction were measured by using flow cytometry. GPIbα–VWF A1 interaction was evaluated by using enzyme-linked immunosorbent assay. GPIb-IX–induced signal transduction was detected by using western blot. Heparinized whole blood from healthy donors was used to test thrombus formation and growth in a perfusion chamber. ResultsWe found that GPIbα is critical for fucoidan-induced platelet activation. Fucoidan interacted with the extracellular domain of GPIbα and blocked its interaction with VWF but itself could lead to GPIbα-mediated signal transduction and, subsequently, αIIbβ3 activation and platelet aggregation. Conversely, low-molecular weight fucoidan inhibited GPIb-VWF–mediated platelet aggregation, spreading, and thrombus growth at high shear. ConclusionFucoidan-GPIbα interaction may have unique therapeutic potential against bleeding disorders in its high-molecular weight state and protection against arterial thrombosis by blocking GPIb–VWF interaction after fucoidan is hydrolyzed.

Oligosaccharide Blocks PAR1 (Proteinase-Activated Receptor 1)-PAR4-Mediated Platelet Activation by Binding to Thrombin Exosite II and Impairs Thrombosis.

Inappropriate activation and aggregation of platelets can lead to arterial thrombosis. Thrombin is the most potent platelet agonist that activates human platelets via two PARs (proteinase-activated receptors), PAR1 and PAR4. The aim is to study the activity and mechanism of an oligosaccharide HS-11 (the undecasaccharide, derived from sea cucumber Holothuria fuscopunctata) in inhibiting thrombin-mediated platelet activation and aggregation and to evaluate its antithrombotic activity. Platelet activation was analyzed by detecting CD62P/P-selectin expression using flow cytometry. The HS-11-thrombin interaction and the binding site were studied by biolayer interferometry. Intracellular Ca2+ mobilization of platelets was measured by FLIPR Tetra System using Fluo-4 AM (Fluo-4 acetoxymethyl). Platelet aggregation, thrombus formation, and bleeding Assay were assessed. An oligosaccharide HS-11, depolymerized from fucosylated glycosaminoglycan from sea cucumber Holothuria fuscopunctata blocks the interaction of thrombin with PAR1 and PAR4 complex by directly binding to thrombin exosite II, and completely inhibits platelet signal transduction, including intracellular Ca2+ mobilization and protein phosphorylation. Furthermore, HS-11 potently inhibits thrombin-PARs-mediated platelet aggregation and reduces thrombus formation in a model of ex vivo thrombosis. The study firstly report that the fucosylated glycosaminoglycan oligosaccharide has antiplatelet activity by binding to thrombin exosite II, and demonstrates that thrombin exosite II plays an important role in the simultaneous activation of PAR1 and PAR4, which may be a potential antithrombotic target for effective treatment of arterial thrombosis.

Mammalian STE20-like kinase-1/2 are activated in human platelets stimulated by collagen or thrombin and play a vital role in collagen-activated platelets

IntroductionMammalian ste20-like kinases-1/2 (MST1/2), the core kinases of the Hippo pathway, play critical roles in the biology of hematopoietic cells via noncanonical mechanisms and contributes to megakaryocyte differentiation, polyploidization, and maturation to produce platelets. However, the role of MST1/2 in platelet functions remains unclear. Materials and methodsIn this study, we investigated this topic by determining platelet aggregation and through flow cytometry, ATP release assay, clot retraction assay, and immunoblotting analysis. ResultsWe found that MST1/2 were rapidly phosphorylated and activated upon platelet stimulation by thrombin and collagen. XMU-MP-1, a specific inhibitor of MST1/2, blocks the activation of MST1/2 in platelets. Inhibitor-pretreated platelets showed impaired platelet aggregation and dense-granule secretion mediated by collagen, thrombin, and U46619, whereas ristocetin or ADP mediated platelet aggregation was unaffected by XMU-MP-1. Although platelet-mediated clot retraction was not affected by MST1/2 inhibitors, integrin αIIbβ3 activation was significantly attenuated in XMU-MP-1-treated platelets. Moreover, MST1/2 inhibition significantly attenuated the mobilization of platelet calcium ions and the secretion of α-granules induced by convulxin. ConclusionsThis study is the first to demonstrate that MST1/2 play vital roles in human platelets and contributes to collagen-induced platelet activation and aggregation.

Platelet Activation and Aggregation Induced by Streptococcus bovis/Streptococcus equinus Complex.

Streptococcus bovis/Streptococcus equinus complex (SBSEC) is a common cause of infective endocarditis (IE). For IE-pathogens, the capacity to activate and aggregate platelets is believed to be an important virulence mechanism. While the interactions between bacteria and platelets have been described in detail for many Gram-positive pathogens, little research has been carried out with SBSEC in this respect. Twenty-six isolates of the four most common species and subspecies of SBSEC identified in bacteremia were collected, and interactions with platelets were investigated in platelet rich plasma (PRP) from three donors. Aggregation was studied using light-transmission aggregometry and platelet activation using flow cytometry detecting surface upregulation of CD62P. Platelets and serum were treated with different inhibitors to determine mechanisms involved in platelet aggregation and activation. Twenty-two of 26 isolates induced aggregation in at least one donor, and four isolates induced aggregation in all three donors. In PRP from donor 1, isolate SL1 induced a rapid aggregation with a median time of 70 s to reach 50% aggregation. Blockade of the platelet Fc-receptor or enzymatic cleavage of IgG abolished platelet activation and aggregation. The capacity for bacteria-induced platelet aggregation was also shown to be transferable between donors through serum. SBSEC mediates platelet aggregation in an IgG and IgG-Fc-receptor dependent manner. Bacterial activation of platelets through this pathway is common for many bacteria causing IE and could be a potential therapeutic target for the prevention and treatment of this infection. IMPORTANCE The capacity of bacteria to activate and aggregate platelets is believed to contribute to the pathogenesis of IE. The Streptococcus bovis/Streptococcus equinus complex (SBSEC) contains known IE-pathogens, but there is limited research on the different subspecies ability to interact with platelets and what signaling pathways are involved. This study reports that 22 of 26 tested isolates of different subspecies within SBSEC can induce aggregation, and that aggregation is host dependent. The Fc-IgG-receptor pathway was shown essential for platelet activation and aggregation. To the best of our knowledge, this is the first study that reports on platelet interactions of SBSEC-isolates other than Streptococcus gallolyticus subspecies gallolyticus as well as the first study to report of mechanisms of platelet interaction of SBSEC-isolates. It adds SBSEC to a group of bacteria that activate and aggregate platelets via the platelet Fc-receptor. This could be a potential therapeutic target for prevention of IE.

Reversing thromboxane A2 receptor activity from calcium to cAMP signaling by shifting Gαq to Gαs covalently linked to the receptor

The conversion of a G-protein coupling receptor (GPCR) signaling from one G-protein to another could be a novel concept for drug designs. Thromboxane A2 (TXA2) receptor (TP) plays a key role in mediating platelet aggregation and thrombosis through its binding to TXA2 and coupling with Gαq-calcium signaling. To alter TP coupling from Gαq to Gαs, which mediates the opposite anti-platelet aggregation and vasodilation activities, we first created a recombinant single-chain (SC) TP-Gαq complex (SC-TP-Gαq) in which the Gαq N-terminus is covalently linked to the TP C-terminus. The SC-TP-Gαq expressed on HEK293 cells could perform identical functions of wild-type TP binding to agonist and activating Gαq triggering Ca2+ signal. The results were further confirmed by expressing the SC-TP-Gαq on CRISPR-edited Gαq-knocked-out HEK293 cells. A step further, by replacing Gαq using Gαs for SC-TP-Gαq, a second recombinant SC-TP-Gαs was created and expressed on wild type and CRISPR-edited Gαs-knocked-out HEK293 cells. Upon the binding of the same TXA2 agonist to the cells expressing SC-TP-Gαs, cAMP signaling was observed. The results have provided strong evidence that covalently linking TP with different Gα could control cell signaling. This study has opened a door to developing a method to redirect TP signaling from thrombotic calcium to anti-thrombotic cAMP, and apply it to that of other GPCRs.

Bio‐equivalence of Potency Adjusted Approved Heparin Solutions Compared to a Newly Developed Heparin Solution

IntroductionPorcine mucosal heparin solutions with a defined potency adjusted concentrations are widely used for the anticoagulation in medical, surgical and interventional indications. Recently, Sintetica has developed a 20.000 IU (48 ml, 416 IU/ml) solution. The active pharmaceutical ingredient used is a porcine mucosal origin with a specific activity of 194 U/mg. The purpose of this investigation is to compare the Sintetica heparin solution with other commercially available potency adjusted heparin solutions such as Fresenius, Roche, Hospira and Medefil heparins to demonstrate their bio‐equivalence in various biological assays.MethodCommercially available heparin solutions were obtained from Sintetica, Roche, Fresenius Kabi, Hospira and Medefil. USP reference standard was obtained from US Pharmacopeia. USP compliant anti‐Xa and anti‐IIa method based on chromogenic substrate assays were obtained from Aniara Diagnostics (Westchester, OH). Thrombin generation studies were carried out using a fluorokinetic method (Diagnostico France). The quantification of glycosaminoglycan (GAG) content was made by using a fluorescence probe (Red Probe, Munster, Germany). The clot based assays and amidolytic assays were carried out on ACL Elite analyzer. HIT mediated platelet aggregation studies were carried out using HIT antibodies from clinically diagnosed patient serum. All solutions were initially diluted to a working concentration of 100 USP U/ml in sterile saline. Working concentrations were prepared at 10 and 1 U/ml. For the potency measurements calibration curves were prepared with the USP standard for cross‐referencing. NHP was supplemented with each of these heparins in 0 to 1 U/ml concentrations. All other tests were carried out according to standard operating procedures.ResultsIn the USP compliant anti‐Xa and anti‐IIa assays all standardized solutions provided comparable results. Similarly in the clot‐based assays such as the aPTT, thrombin time, prothrombinase‐induced clotting time, all solutions produced comparable anticoagulant effects. Similarly in the thrombin generation assays all products produced comparable inhibitory responses of thrombin generation in terms of peak thrombin, area‐under‐the‐curve and the lag time. The HIT antibody mediated platelet aggregation was similar with all solutions. Total GAG content as measured by Red Probe was also comparable with calculated amounts of 0.520 mg/100U for Sintetica, 0.540 mg/100U for Fresenius, 0.510 mg/100U for Hospira, 0.540 mg/100U for Medefil and 0.530 mg/100Us for Roche’s product.ConclusionThese result demonstrate that commercially available potency adjusted heparin solutions and the developed Sintetica heparin solution exhibit comparable anticoagulant and anti‐protease effects. Based on these results the Sintetica product is similar to the commercially available clinically approved potency adjusted heparin solutions. Furthermore these results suggest that these solutions are interchangeable for clinical use.

Abstract WP251: Long Term Outcome Prediction After Ischemic Stroke Using Gene Expression

Objective: Prediction of the long-term outcome in Ischemic Stroke (IS) patients can have a significant impact on design of clinical trials and on patients’ care. We studied gene expression (GE) as a novel biomarker to provide an accurate prediction of 90-day outcome in IS patients. Methods: RNA from 72 samples from 2 peripheral blood draws (at ≤3 and 24 hrs post IS onset) was analyzed on Affymetrix U133 Plus 2.0 microarrays. These represented samples from 36 CLEAR trial IS patients that had blood drawn within 3 hrs of stroke onset and were then treated with tPA with or without eptifibatide. The samples were split into derivation (n=25) and validation (n=11) sets. We identified the differential GE in blood at 24 hrs and the difference in GE between 24 hrs and 3 hrs post IS that was associated with 90-day post stroke outcome using the model: GE = μ + NIHSS_24hr+mRS_90day+ ε. Good outcome was defined as mRS 0-2; Poor - as mRS 3-5. Logistic regression was used to derive a biomarker classifier. Results: Using 24 hrs GE, we identified 14 probesets (12 genes) with the highest discriminative power for predicting outcome. The model achieved recall (the probability of correctly identifying the patients with Good outcome) of 0.88 and specificity (the probability of correctly identifying the patients with Poor outcome) of 0.67 in the validation set (The AUC-ROC = 0.88). The biomarker genes were enriched in immune responses such as IL and cytokine signaling. Among the predictors were genes important for stroke and repair after stroke (e.g., MACC1 , GDF11 ). MACC1 has been considered as a potential treatment target for IS with a protective role in hypoxia-induced human brain microvascular endothelial cells. GDF11 plays a role in brain repair after IS. We also determined how the change of GE from 3 hrs to 24 hrs would predict the 90-day outcome. A panel of ten genes was able to predict outcome in the validation set (recall= 1, specificity = 0.67, AUC-ROC=0.88). These included AVPR1A , which mediates platelet aggregation and release of coagulation factors and exacerbates brain inflammatory response to injury. Conclusion: This pilot study suggests gene expression can be used to predict stroke outcome. Some of the genes may serve as potential therapeutic targets.

The extracellular Ero1α/PDI electron transport system regulates platelet function by increasing glutathione reduction potential

Protein disulfide isomerase (PDI), an oxidoreductase, possesses two vicinal cysteines in the -Cys-Gly-His-Cys-motif that either form a disulfide bridge (S–S) or exist in a sulfhydryl form (-SH), forming oxidized or reduced PDI, respectively. PDI has been proven to be critical for platelet aggregation, thrombosis, and hemostasis, and PDI inhibition is being evaluated as a novel antithrombotic strategy. The redox states of functional PDI during the regulation of platelet aggregation, however, remain to be elucidated. Endoplasmic reticulum (ER) oxidoreductin-1α (Ero1α) and PDI constitute the pivotal oxidative folding pathway in the ER and play an important role in ER redox homeostasis. Whether Ero1α and PDI constitute an extracellular electron transport pathway to mediate platelet aggregation is an open question. Here, we found that oxidized but not reduced PDI promotes platelet aggregation. On the platelet surface, Ero1α constitutively oxidizes PDI and further regulates platelet aggregation in a glutathione-dependent manner. The Ero1α/PDI system oxidizes reduced glutathione (GSH) and establishes a reduction potential optimal for platelet aggregation. Therefore, platelet aggregation is mediated by the Ero1α-PDI-GSH electron transport system on the platelet surface. We further showed that targeting the functional interplay between PDI and Ero1α by small molecule inhibitors may be a novel strategy for antithrombotic therapy.

Novel disintegrin-like peptides derived from an amphibian skin cDNA sequence of Hypsiboas punctatus.

Disintegrins comprise a family of small proteins that bind to and alter the physiological function of integrins, especially integrins that mediate platelet aggregation in blood. Here, we report a lysine-glycine-aspartic acid (KGD) disintegrin-like motif present in a 15-amino acid residue peptide identified in a cDNA library of the amphibian Hypsiboas punctatus skin. The original peptide sequence was used as a template from which five new analogs were designed, chemically synthesized by solid phase, and tested for disintegrin activity and tridimensional structural studies using NMR spectroscopy. The original amphibian peptide had no effect on integrin-mediated responses. Nevertheless, derived peptide analogs inhibited integrin-mediated platelet function, including platelet spreading on fibrinogen.

The Role and Molecular Mechanism of P2Y12 Receptors in the Pathogenesis of Atherosclerotic Cardiovascular Diseases

The P2Y receptor family is a class of G protein-coupled receptors activated primarily by adenosine triphosphate (ATP), adenosine diphosphate (ADP), uridine triphosphate (UTP) and uridine diphosphate (UDP). The P2Y12 receptor is expressed on platelets which mediates platelet aggregation and morphological changes. At the same time, during the process of vascular remodeling and atherosclerosis, ADP can also promote the migration and proliferation of vascular smooth muscle and endothelial cells through P2Y12 receptor activating. Furthermore, P2Y12 is involved in many signal transductions processes, such as intimal hyperplasia, monocyte infiltration and so on, which play an important role in immune inflammation and brain injury. In order to solve the diseases induced by P2Y12 receptor, inhibitors such as ticagrelor, clopidogrel were widely used for cardiovascular diseases. However, there were some problems, such as limited antithrombotic effect, remain unsolved. This article summarizes the role and molecular mechanism of P2Y12 receptors in the pathogenesis of cardiovascular-related diseases, providing in-depth expounding on the molecular mechanism of P2Y12 receptor inhibitors and contributing to the treatment of diseases based on P2Y12 receptors.

Macrostachyols A-D, oligostilbenes from Gnetum macrostachyum inhibited in vitro human platelet aggregation

Introduction: Gnetum macrostachyum is a known Thai medicinal plant as a source of bioactive oligostilbenes, which possess platelet inhibitory activities. The study aimed to evaluate the in vitro human platelet aggregation inhibitory activities of macrostachyols A-D (compounds 1-4) isolated from the roots of G. macrostachyum. Methods: The in vitro human platelet aggregation assay was assayed with a 96-well microtiter plate format. The well-known aggregating agents were used to investigate the possible mechanism of inhibition, including adenosine diphosphate (ADP), arachidonic acid (AA), thromboxane A2 analog (U-46619), collagen, thrombin, and thrombin receptor-activating peptide-6 (TRAP-6). Results: Compound 1 was more potent than ibuprofen (positive control) on the adenosine diphosphate- induced platelet aggregation assay (P < 0.05). Compound 3 was more potent than 1, 2, and 4 (P < 0.05), but all active oligostilbenes were less potent than the positive control (P < 0.05) on the arachidonic acid-induced platelet aggregation assay. The oligostilbenes 1, 2, 3, and 4 also displayed the inhibitory effects on the U-46619-induced platelet aggregation. The tetrameric stilbenes 1 was the only compound that exhibited inhibitory effects on thrombin-induced platelet aggregation without TRAP-6 mediated platelet aggregation. Conclusion: The findings revealed the inhibitory effects of oligostilbenes on human platelet aggregation through a target-specific experimental design. It suggests that oligostilbenes from this plant might be applied as antiplatelet aggregation agents in platelet hyperreactivity- related diseases.

PAK Membrane Translocation and Phosphorylation Regulate Platelet Aggregation Downstream of Gi and G12/13 Pathways.

Platelet activation plays a pivotal role in physiological hemostasis and pathological thrombosis causing heart attack and stroke. Previous studies conclude that simultaneous activation of Gi and G12/13 signaling pathways is sufficient to cause platelet aggregation. However, using Gq knockout mice and Gq-specific inhibitors, we here demonstrated that platelet aggregation downstream of coactivation of Gi and G12/13 depends on agonist concentrations; coactivation of Gi and G12/13 pathways only induces platelet aggregation under higher agonist concentrations. We confirmed Gi and G12/13 pathway activation by showing cAMP (cyclic adenosine monophosphate) decrease and RhoA activation in platelets stimulated at both low and high agonist concentrations. Interestingly, we found that though Akt and PAK (p21-activated kinase) translocate to the platelet membrane upon both low and high agonist stimulation, membrane-translocated Akt and PAK only phosphorylate at high agonist concentrations, correlating well with platelet aggregation downstream of concomitant Gi and G12/13 pathway activation. PAK inhibitor abolishes Akt phosphorylation, inhibits platelet aggregation in vitro and arterial thrombus formation in vivo. We propose that the PAK-PI3K/Akt pathway mediates platelet aggregation downstream of Gi and G12/13, and PAK may represent a potential antiplatelet and antithrombotic target.

NTP42, a novel antagonist of the thromboxane receptor, attenuates experimentally induced pulmonary arterial hypertension

BackgroundNTP42 is a novel antagonist of the thromboxane prostanoid receptor (TP), currently in development for the treatment of pulmonary arterial hypertension (PAH). PAH is a devastating disease with multiple pathophysiological hallmarks including excessive pulmonary vasoconstriction, vascular remodelling, inflammation, fibrosis, in situ thrombosis and right ventricular hypertrophy. Signalling through the TP, thromboxane (TX) A2 is a potent vasoconstrictor and mediator of platelet aggregation. It is also a pro-mitogenic, pro-inflammatory and pro-fibrotic agent. Moreover, the TP also mediates the adverse actions of the isoprostane 8-iso-prostaglandin F2α, a free-radical-derived product of arachidonic acid produced in abundance during oxidative injury. Mechanistically, TP antagonists should treat most of the hallmarks of PAH, including inhibiting the excessive vasoconstriction and pulmonary artery remodelling, in situ thrombosis, inflammation and fibrosis. This study aimed to investigate the efficacy of NTP42 in the monocrotaline (MCT)-induced PAH rat model, alongside current standard-of-care drugs.MethodsPAH was induced by subcutaneous injection of 60 mg/kg MCT in male Wistar–Kyoto rats. Animals were assigned into groups: 1. ‘No MCT’; 2. ‘MCT Only’; 3. MCT + NTP42 (0.25 mg/kg BID); 4. MCT + Sildenafil (50 mg/kg BID), and 5. MCT + Selexipag (1 mg/kg BID), where 28-day drug treatment was initiated within 24 h post-MCT.ResultsFrom haemodynamic assessments, NTP42 reduced the MCT-induced PAH, including mean pulmonary arterial pressure (mPAP) and right systolic ventricular pressure (RSVP), being at least comparable to the standard-of-care drugs Sildenafil or Selexipag in bringing about these effects. Moreover, NTP42 was superior to Sildenafil and Selexipag in significantly reducing pulmonary vascular remodelling, inflammatory mast cell infiltration and fibrosis in MCT-treated animals.ConclusionsThese findings suggest that NTP42 and antagonism of the TP signalling pathway have a relevant role in alleviating the pathophysiology of PAH, representing a novel therapeutic target with marked benefits over existing standard-of-care therapies.

Effects of vorapaxar on clot characteristics, coagulation, inflammation, and platelet and endothelial function in patients treated with mono‐ and dual‐antiplatelet therapy

BackgroundVorapaxar is indicated with standard antiplatelet therapy (APT) in patients with a history of myocardial infarction (MI) or peripheral arterial disease (PAD). ObjectivesTo evaluate the comparative effects of vorapaxar on platelet‐fibrin clot characteristics (PFCC), coagulation, inflammation, and platelet and endothelial function during treatment with daily 81 mg aspirin (A), 75 mg clopidogrel (C), both (C + A), or neither. MethodsThrombelastography, conventional platelet aggregation (PA), ex vivo endothelial function by ENDOPAT, coagulation, platelet activation/inflammation marked by urinary 11‐dehydrothromboxane B2 (UTxB2) and safety were determined in patients who were APT naïve (n = 21), on C (n = 8), on A (n = 29), and on A + C (n = 23) during 1 month of vorapaxar therapy and 1 month of offset. ResultsVorapaxar had no effect on PFCC, ADP‐ or collagen‐induced PA, thrombin time, fibrinogen, PT, PTT, von Willebrand factor (vWF), D‐dimer, or endothelial function (P > .05 in all groups). Inhibition of SFLLRN (PAR‐1 activating peptide)‐stimulated PA by vorapaxar was accelerated by A + C at 2 hours (P < .05 versus other groups) with nearly complete inhibition by 30 days that persisted through 30 days after discontinuation in all groups (P < .001). SFLLRN‐induced PA during offset was lower in APT patients versus APT‐naïve patients (P < .05). Inhibition of UTxB2 was observed in APT‐naive patients treated with vorapaxar (P < .05). Minor bleeding was only observed in C‐treated patients. ConclusionVorapaxar had no influence on PFCC measured by thrombelastography, coagulation, or endothelial function irrespective of APT. Inhibition of protease activated receptor (PAR)‐1 mediated platelet aggregation by vorapaxar was accelerated by A + C and offset was prolonged by concomitant APT. Vorapaxar‐induced anti‐inflammatory effects were observed in non‐aspirin‐treated patients.

Alpha-Dystroglycan Supports Platelet Aggregation and Thrombus Formation

No relevant conflicts of interest to declare.

Mice Deficient in ß2-Glycoprotein I Have a Delayed Time to Thrombosis

Introduction: Antiphospholipid syndrome (APS) is an autoimmune disorder caused by "antiphospholipid" antibodies (aPL) directed in part against β2-glycoprotein I (β2GPI). Though β2GPI is proposed to have numerous anti- and procoagulant properties in vitro, its effect in vivo is not well studied. Β2GPI binds thrombin via exosite 1 and exosite 2 and impairs thrombin activity, in particular thrombin-mediated activation of FXI. Β2GPI also is found to inhibit thrombin mediated platelet aggregation and it inhibits phospholipid-dependent coagulation reactions, such as the prothrombinase and tenase complexes. β2GPI also may inhibit the activation of protein C, an effect potentiated by antiphospholipid antibodies. However, there is little direct information on β2GPI effects on thrombosis in vivo. Methods: We created β2GPI deficient mice using CRISPR-Cas9 technology. Two pairs of guide RNAs (sgRNAs) flanking upstream and downstream exons 2 and 3 on a C57BL/6J background were designed using the CRISPOR program (http://crispor.tefor.net/crispor.py). The PCR product spanning exons 2 and 3 was used to test the efficiency of SgRNA cleavage using the Guide-it Complete sgRNA Screening System. An efficient pair of sgRNAs, one upstream of exon-2 (sgRNA-UP: ATCTTTCCCTTATATGCTAG) and another downstream of exon-3 (sgRNA-DOWN: TCGAGTTAATCACGTGTAGG) were injected into the embryos of C57BL/6J mice with Cas9 protein. Founder mice were genotyped to identify mice with expected deletions in the APOH (encoding β2GPI) gene. Strong founder male mice containing mutated APOH were crossed with wild type C57BL/6J females. Male and female F1 heterozygotes were backcrossed and F2 homozygous knockouts (APOH-/-) were characterized. The Rose-Bengal carotid artery thrombosis assay was performed on 6 to 9 week old wild type and APOH-/- mice. In brief, mice were anesthetized using sodium pentobarbital intraperitoneally. Rose Bengal [isobenzofuran-1(3H)9[9H] xanthan)-3:1 dipotassium salt] was injected via tail vein at a concentration of 50 mg/kg in 0.9% saline in a 100 μl volume. Green laser light at 540 nm was applied to the carotid artery following injection of Rose Bengal. Continuous flow was monitored at the site of injury and time to occlusion was determined. Results: Genotyping of APOH-/- mice revealed complete deletion of exon 2 and 3 (1900 to 2000 bp deletion). Plasma derived from WT-mice, APOH+/- and APOH-/- mice was analyzed by immunoblotting: APOH-/- mice lacked β2GPI protein while heterozygotes had intermediate levels. APOH-/- mice appeared healthy with no obvious phenotype. Carotid artery occlusion times were compared in 5 WT and 5 APOH-/- male mice. In WT-mice, complete vessel occlusion occurred at a mean time of 19.2 +/- 3.1 min, whereas the occlusion time in APOH-/- mice was prolonged approximately 2-fold (38.6 +/- 7.1 min). The prolonged time to occlusion in APOH-/- mice was highly significant (p &lt;0.0005). Conclusion: These results indicate that APOH-/- mice have a net anticoagulant phenotype compared to WT mice, and suggest that β2GPI may have procoagulant properties in vivo. The mechanisms underlying this observation are not immediately apparent and are currently under investigation. However, given the reported effects of β2GPI on inhibition of thrombin generation and thrombin-mediated platelet activation, these findings are unexpected. Additional studies with other thrombosis models are in progress. Identification of β2GPI as a "procoagulant protein" suggests a reconsideration of its role in the pathogenesis of antiphospholipid syndrome. Disclosures McCrae: Sanofi Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees; Pfizer Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Rigel Pharmaceutical: Membership on an entity's Board of Directors or advisory committees; Dova Pharmaceuticals: Membership on an entity's Board of Directors or advisory committees.