Maximum Likelihood Tree Research Articles

First Report of Anthracnose Crown Rot on Strawberry (Fragaria × ananassa Duch.) Caused by Colletotrichum pandanicola in Yunnan Provence, China.

Strawberry (Fragaria × ananassa Duch.), a widely grown octoploid species, is one of the most important economic fruit crops and has been widely cultivated in the world, including China. In December 2021, a serious crown rot disease (approximately 50% incidence) was observed in strawberry (cultivar Miaoxiang) plantations in Qujing City, Yunnan Province, China. Symptoms observed on aboveground part withered rapidly, reddish-brown marbled necrosis on crown. The roots were healthy and strong, but the plants finally died. To isolate the causal agent of this disease, crown tissues from five strawberry plants showing typical symptoms were cut into pieces of 5×5 mm, and the pieces were surface-sterilized with 75% ethanol for 45 s followed by 2.5% NaClO for 3 min and rinsed thrice with sterile water, and then placed onto potato dextrose agar (PDA) for 7 days at 25 ºC. After 3 to 4 days, extended single hyphal tips from the tissues were transferred to PDA and incubated for 7 days at 25 ºC. The colonies were initially white, later became somewhat zonate, velvety, cyan gray on the upper side and cyan ink pigment ring on the reverse side of plates, with concentric rings of salmon sporodochia. Many yellowish or orange creamy conidial droplets formed on PDA after 14 days at 25 ºC. Fifty-nine isolates were obtained, and three isolates QLYRR1, QLMCR9, and QLMCR39 were selected for further experiments. Conidia were hyaline, cylindrical with rounded ends, 12.17-19.35×3.71-6.30 μm (average±SD, 15.24±1.37×5.09±0.45 μm, n=150), L/W ratio = 2.99. The three isolates were molecularly identified using the genomic regions of internal transcribed spacer (ITS), actin (ACT), chitin synthase (CHS-1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and beta-tubulin (TUB2) genes, and the sequences were deposited in GenBank (accession nos. QLYRR1, QLMCR9, QLMCR39: ON668272, ON668256, ON668257[ITS], ON684302, ON684300, ON684301[ACT], ON684316, ON684314, ON684315[CHS-1], ON684292, ON684290, ON684291[GAPDH], ON684286, ON684284, ON684285[TUB2]). The phylogenetic analysis of experimental strains was performed by Maximum-likelihood (ML) tree and Bayesian inference (BI) method. Nucleotide sequences exhibited three isolates were clustered with the ex-type strain C. pandanicola strain MFLUCC 170571T found in Thailand, C. pandanicola strains (SAUCC201152, SAUCC200204) found in Shandong Province, and the holotype stain C. parvisporum YMF 1.06942T found in Guangxi Province, China. Morphologically, isolates were easily distinguished from C. parvisporum by the colony on PDA and the size of conidia (Yu et al. 2022). Morphological characteristics and phylogenetic analyses revealed that QLYRR1, QLMCR9, and QLMCR39 belong to C. pandanicola, the members of the C. gloeosporioides species complex (Tibpromma et al. 2018; Mu et al. 2021). Koch's postulates were tested by strawberry plants (two cultivars, Akihime and Miaoxiang) in vivo, strawberry plants were tested for the three isolates by spraying 1×106 conidia/mL suspension on three seedlings. Three seedlings sprayed with sterile distilled water were served as control. All of the plants were transferred to a glasshouse with a 28/20 °C day/night temperature range and natural sunlight. After 6 weeks, QLYRR1-, QLMCR9-, and QLMCR39-sprayed seedlings were stunted and developed typical wilt symptoms similar to those observed in the field with the incidence for 3, 3, and 3 seedlings, respectively. The negative control remained asymptomatic. The fungi were reisolated again from lesions of diseased plants and leaves with 100% frequency, and morphological characteristics and tested gene sequences were identical to the original isolates in this note, thus fulfilling Koch's postulates. C. pandanicola was described from the healthy leaves of Pandanus sp. and the lesion fruits of Juglans regia. To our knowledge, this is the first report confirming C. pandanicola causes anthracnose crown rot on strawberries in China. C. pandanicola has the potential for causing serious losses to the strawberry industry, and research is needed on management strategies to minimize losses.

First Report of Anthracnose on Chili Pepper Caused by Colletotrichum sojae in Hebei Province, China.

China is the largest chili pepper producing country, and Hebei Province stands out as the forth with planting area at about 1500 km2 in China. Pepper (Capsicum annuum L.) is susceptible to Colletotrichum spp. infection during its growth, which seriously affects production yield and quality. In September 2020, widespread anthracnose was observed on pepper in Hebei (115.48° N, 38.77° E), China. Necrotic lesions on pepper fruits were suborbcular, sunken, with acervuli arranged in the middle of lesion (e-Xtra 1A). To perform fungal isolation, small tissue with 0.3 cm2 in size at the symptomatic tissue margin was surface disinfested with 75% ethanol for 10 s, and 0.1% HgCl2 for 40 s, then washed three times with sterile ddH2O. Fragments were placed on potato dextrose agar (PDA) amended with 100 mg·L-1 chloramphenicol and incubated at 28 ºC under darkness for 4 days. One of the strains of Colletotrichum spp., named HQY157, was purified by single-spore isolation, then used for morphological characterization, phylogenetic analysis, and pathogenicity tests. Colonies presented light grey aerial mycelium, occasionally mixed with gray-black strips, and the reverse was similar to the surface on PDA (e-Xtra 1B). Conidia were smooth-walled, aseptate, straight with obtuse to slightly rounded ends, 17.3-28.5 × 3.1-7.4 μm (n=50) (e-Xtra 1C). For molecular identification, the internal transcribed spacer (ITS) region, partial sequences of actin (ACT), β-tublin (TUB), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and chitin synthase (CHS) were sequenced using the specific primers (Weir et al. 2012). Sequences were deposited in GenBank with the following accession numbers OM317600-OM317604. A Maximum-Likelihood phylogenetic tree was constructed, based on the concatenated sequences (ACT, CHS, GAPDH, TUB, and ITS) of HQY157 and other closely matching Colletotrichum species obtained from GenBank, by using MEGA-X. It showed that HQY157 was grouped with the C. sojae with bootstrap values of 100% (e-Xtra 2). To confirm the pathogenicity, surface-sterilized healthy pepper fruits and healthy fruits with wounds (deal with a sterile toothpick after surface-sterilized) were then inoculated with 2 μL of conidial suspension (106 conidia/mL). The fruits inoculated with 2 μL sterile distilled water were taken as negative controls. After inoculation, the fruits were kept in a plastic box with sterilized filter paper moistened with sterilized water, and maintained at 25°C in the dark. The experiment was repeated three times. Anthracnose symptoms were observed 7 days after inoculation on the wounded pepper fruits, whereas the unwounded and negative control fruits remained symptomless (e-Xtra 1D). Colletotrichum sojae was re-isolated from the infected pepper fruits and identified by morphological and molecular analysis, fulfilling Koch's postulates. Colletotrichum sojae occurs mainly on Fabaceae plants such as Glycine max, Medicago sativa, Phaseolus vulgaris, and Vigna unguiculata (Damm et al. 2019, Talhinhas and Baroncelli, 2021), and Panax quinquefolium (Guan et al. 2021). To our knowledge, this is the first report of C. sojae causing anthracnose on pepper in China. This study provided crucial information for epidemiologic studies and appropriate control strategies for this chili pepper disease.

Evidence of international transmission of mobile colistin resistant monophasic Salmonella Typhimurium ST34

S. 4,[5],12:i:-, a monophasic variant of S. enterica serovar Typhimurium, is an important multidrug resistant serovar. Strains of colistin-resistant S. 4,[5],12:i:- have been reported in several countries with patients occasionally had recent histories of travels to Southeast Asia. In the study herein, we investigated the genomes of S. 4,[5],12:i:- carrying mobile colistin resistance (mcr) gene in Thailand. Three isolates of mcr-3.1 carrying S. 4,[5],12:i:- in Thailand were sequenced by both Illumina and Oxford Nanopore platforms and we analyzed the sequences together with the whole genome sequences of other mcr-3 carrying S. 4,[5],12:i:- isolates available in the NCBI Pathogen Detection database. Three hundred sixty-nine core genome SNVs were identified from 27 isolates, compared to the S. Typhimurium LT2 reference genome. A maximum-likelihood phylogenetic tree was constructed and revealed that the samples could be divided into three clades, which correlated with the profiles of fljAB-hin deletions and plasmids. A couple of isolates from Denmark had the genetic profiles similar to Thai isolates, and were from the patients who had traveled to Thailand. Complete genome assembly of the three isolates revealed the insertion of a copy of IS26 at the same site near iroB, suggesting that the insertion was an initial step for the deletions of fljAB-hin regions, the hallmark of the 4,[5],12:i:- serovar. Six types of plasmid replicons were identified with the majority being IncA/C. The coexistence of mcr-3.1 and blaCTX-M-55 was found in both hybrid-assembled IncA/C plasmids but not in IncHI2 plasmid. This study revealed possible transmission links between colistin resistant S. 4,[5],12:i:- isolates found in Thailand and Denmark and confirmed the important role of plasmids in transferring multidrug resistance.

Morphology and molecular phylogeny of the marine diatom genus Nagumoea (Bacillariophyceae) from Japan

SUMMARYThe canal‐bearing diatom genus Nagumoea, described based on only morphological evidence, was tentatively assigned to the order Bacillariales, although its phylogenetic position remained unclear. Because three isolates of Nagumoea (SK002, SK024 and SK053) were successfully established from Japanese coasts, we performed their morphological observations and molecular phylogenetic analyses to discuss the phylogeny and taxonomic position of this genus. Strains SK002 and SK024 were identified as Nagumoea africana, whereas SK053 conformed with Nagumoea serrata. There was high interspecific divergence between N. africana and N. serrata in the rbcL sequences (8.03–8.17%), indicating their distinctness. Furthermore, intraspecific variations were detected within N. africana (2.35%) in the rbcL, implying its cryptic diversity. The maximum likelihood and Bayesian phylogenetic trees inferred from the plastid rbcL, psbC and nuclear 18S rDNA genes recovered Nagumoea as monophyletic with strong statistical support and embedded within an unresolved, poorly supported lineage containing Achnanthes, Craspedostauros, Staurotropis and Undatella in the canal‐bearing order Bacillariales (= the family Bacillariaceae). Although the constrained tree based on the monophyly of Nagumoea and the other canal‐bearing clade (Surirellales and Rhopalodiales) was statistically rejected by the topology tests, the phylogenetic position of Nagumoea with other Bacillarialean members remains equivocal. The possession of two plastids positioned fore and aft, observed in the present study, and lack of keel, typical of the Bacillariales, indicate the possibility of Nagumoea being part of the ingroup of the Bacillariales or its closely related outgroup.

The Complete Mitochondrial Genome of Northeast Asian Rove Beetle, Lordithon arcuatus (Solsky, 1871) and Performance of Site-Specific Mixture Models in Building the Mitogenomic Phylogeny of Staphylinidae (Insecta: Coleoptera)

Lordithon species are typically mushroom-dwelling rove beetles that devour maggots. This study presents the mitogenome of a Lordithon arcuatus specimen that was procured from Changbai Mountain in the Jilin Province of China. The mitogenome is 18,290 bp long and comprises 13 protein-coding genes, 22 tRNAs, and 2 rRNAs. The base composition of the mitogenome is as follows: A = 38.80%, T = 37.93%, G = 8.94%, and C = 14.32%. Maximum likelihood and Bayesian phylogenetic trees were constructed using 68 representative staphylinid species, which showed that Lordithon, Bolitobius, and Ischnosoma form a stable and fully supported Mycetoporinae clade, whereas there was no consensus regarding the relationships among Tachyporinae taxa. Additionally, the performance of site-specific mixture models for inferring the phylogeny of staphylinids using mitogenomic data was assessed. The results suggest that heterotachy models should be used with caution, as they may result in incorrect topology with delusive precedence in AIC- or BIC-based model selection.

The epidemiology and evolutionary dynamics of massive dengue outbreak in China, 2019.

In 2019, China experienced massive dengue outbreaks with high incidence and expanded outbreak areas. The study aims to depict dengue's epidemiology and evolutionary dynamics in China and explore the possible origin of these outbreaks. Records of confirmed dengue cases in 2019 were obtained from the China Notifiable Disease Surveillance System. The sequences of complete envelope gene detected from the outbreak provinces in China in 2019 were retrieved from GenBank. Maximum Likelihood trees were constructed to genotype the viruses. The median-joining network was used to visualize fine-scale genetic relationships. Four methods were used to estimate the selective pressure. A total of 22,688 dengue cases were reported, 71.4% of which were indigenous cases and 28.6% were imported cases (including from abroad and from other domestic provinces). The abroad cases were predominantly imported from Southeast Asia countries (94.6%), with Cambodia (3,234 cases, 58.9%), and Myanmar (1,097 cases, 20.0%) ranked as the top two. A total of 11 provinces with dengue outbreaks were identified in the central-south of China, of which Yunnan and Guangdong provinces had the highest number of imported and indigenous cases. The primary source of imported cases in Yunnan was from Myanmar, while in the other ten provinces, the majority of imported cases were from Cambodia. Guangdong, Yunnan and Guangxi provinces were China's primary sources of domestically imported cases. Phylogenetic analysis of the viruses in outbreak provinces revealed three genotypes: (I, IV, and V) in DENV 1, Cosmopolitan and Asian I genotypes in DENV 2, and two genotypes (I and III) in DENV 3. Some genotypes concurrently circulated in different outbreak provinces. Most of the viruses were clustered with those from Southeast Asia. Haplotype network analysis showed that Southeast Asia, possibly Cambodia and Thailand, was the respective origin of the viruses in clade 1 and 4 for DENV 1. Positive selection was detected at codon 386 in clade 1. Dengue importation from abroad, especially from Southeast Asia, resulted in the dengue epidemic in China in 2019. Domestic transmission between provinces and positive selection on virus evolution may contribute to the massive dengue outbreaks.

Phylogenomic evolutionary insights in the fern family Gleicheniaceae

The pantropical fern family Gleicheniaceae comprises approximately 157 species. Seven genera are currently recognized in the family, although their monophyly is still uncertain due to low sampling in phylogenetic studies. We examined the monophyly of the genera through extended sampling, using the first phylogenomic inference of the family including data from both nuclear and plastid genomes. Seventy-six samples were sequenced (70 Gleicheniaceae species and six outgroups) using high throughput sequencing, including all seven currently recognized genera. Plastid and nuclear data were recovered and assembled; the nuclear data was phased to reduce paralogy as well as hybrid noise in the final recovered topology. Maximum likelihood trees were built for each locus, and a concatenated dataset was built for both datasets. A species tree based on a multispecies coalescent model was generated, and divergence time analyses performed. We here present the first genomic phylogenetic inferences concerning Gleicheniaceae, confirming the monophyly of most genera except Sticherus, which we recovered as paraphyletic. Although most of the extant genera of Gleicheniaceae originated during the Mesozoic, several genera show Neogene and even Quaternary diversifications, and our results suggest that reticulation and polyploidy may have played significant roles during this diversification. However, some genera, such as Rouxopteris and Stromatopteris, appear to represent evolutionary relicts.

MutaGAN: A sequence-to-sequence GAN framework to predict mutations of evolving protein populations.

The ability to predict the evolution of a pathogen would significantly improve the ability to control, prevent, and treat disease. Machine learning, however, is yet to be used to predict the evolutionary progeny of a virus. To address this gap, we developed a novel machine learning framework, named MutaGAN, using generative adversarial networks with sequence-to-sequence, recurrent neural networks generator to accurately predict genetic mutations and evolution of future biological populations. MutaGAN was trained using a generalized time-reversible phylogenetic model of protein evolution with maximum likelihood tree estimation. MutaGAN was applied to influenza virus sequences because influenza evolves quickly and there is a large amount of publicly available data from the National Center for Biotechnology Information's Influenza Virus Resource. MutaGAN generated 'child' sequences from a given 'parent' protein sequence with a median Levenshtein distance of 4.00 amino acids. Additionally, the generator was able to generate sequences that contained at least one known mutation identified within the global influenza virus population for 72.8 per cent of parent sequences. These results demonstrate the power of the MutaGAN framework to aid in pathogen forecasting with implications for broad utility in evolutionary prediction for any protein population.

Diexanthema hakuhomaruae sp. nov. (Copepoda: Siphonostomatoida: Nicothoidae) from the Hadal Zone in the Northwestern Pacific, with an 18S Molecular Phylogeny.

Diexanthema copepods are ectoparasites on deep-sea isopods. This genus currently contains six species, all reported from the North Atlantic. Our study describes a new species of Diexanthema found on isopods from 7184 to 7186m depth in the Kuril-Kamchatka Trench, northwestern Pacific. We observed the copepod's morphology, made camera-lucida drawings, and compared our species with congeners. We determined partial sequences for its 16S rRNA and 18S rRNA genes and constructed an 18S-based maximum-likelihood copepod tree to place it phylogenetically. We identified the host isopod species through morphology and cytochrome c oxidase subunit I (COI, cox1) and 18S sequences. We described the copepod as Diexanthema hakuhomaruae sp. nov. and identified its host as Eugerdella cf. kurabyssalis Golovan, 2015 (Desmosomatidae). This is the first Diexanthema copepod from the Pacific and also from hadal depths. Diexanthema hakuhomaruae most closely resembles D. bathydiaita Richie, 1975, parasitic on Nannoniscus sp. (Nannoniscidae) in the Atlantic, but differs from the latter in having a smooth body surface and leg 5 in the ventrolateral region of the urosome. In the 18S tree, D. hakuhomaruae was the sister group to the Rhizorhina clade, which is consistent with the morphology-based hypothesis that they are closely related.

First report of apple latent spherical virus infecting Angelica sinensis.

Angelica sinensis (Oliv.) Diels is a perennial herb of the genus Angelica in the family Umbelliferae. The dried root of A. sinensis has have long been used medicinally (Zhang et al., 2016). Several plant viruses have been reported to infect A. sinensis: tomato mosaic virus, Japanese hornwort mosaic virus, and konjak mosaic virus (Zhang et al., 2020). In July 2019, we collected A. sinensis samples exhibiting symptoms of yellowing, mottling, and wrinkling from fields in Gansu Province. Seven plants were mixed in a composite sample and were commissioned to Biotech Bioengineering (Shanghai) Co., Ltd. for small RNA sequencing. Total RNA of A. sinensis was extracted according to the manufacturer's directions using the total RNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.). The library was constructed using the TruSeq™ Small RNA Sample Prep Kits (Illumina, San Diego, USA) kit and was sequenced using the Illumina Hiseq2000/2500 with a single-end read length of 1X50bp. Samples were sequenced to obtain 1199561625 raw reads and 281093971 clean reads by removing low quality reads. Quality-controlled qualified reads were assembled using SPAdes (Bankevich et al., 2012) with a k-mer value of 17 and the obtained results were compared with NCBI's nucleotide database. Eight contigs were annotated as homologous to apple latent spherical virus (ALSV, AB030940.1 and AB030941.1). The similarity between the eight contigs and the reference genome ranged from 84% to 90%. The sequencing coverage of RNA1 and RNA2 of ALSV were 23.00% and 32.36%, respectively.The specific primers F 5`-CAGGGCCCAGATTTCACTAGAATTA-3` and R 5`- CTAAGTGTAGCCAGCCTTGAGCAATC -3` were designed based on acquired contigs to validate the sequencing results in the individual samples. One of the original composite samples was ALSV positive. Polymerase chain reaction products were detected in 1.5% agarose geland 1761 bp target band was obtained. The obtained sequence (OP038546) was searched against the NCBI nucleotide database using the BLASTn algorithm. Results showed that it shared 81.53% nucleotide sequence identities with the genome of ALSV ((AB030941.1) and this is the first time that ALSV was found to naturally infect A. sinensis. ALSV belongs to the genus Cheravirus in the family Secoviridae that was first identified in apple leaves (Li et al., 2000). To analyze the phylogenetic relationships of ALSV, all the coat protein genes of genus Cheravirus were downloaded from NCBI and a phylogenetic tree was constructed using the Construct/Test Maximum Likelihood Tree method using MEGA7.0 software. The self-extension value was 1000, and the branches with evolutionary numbers below 50% were removed. The ALSV isolate obtained from Gansu A. sinensis in this experiment aggregated in the same branch as the ALSV infested apple, again proving that the virus is ALSV (Fig.1A). Additionally, a total of 111 A. sinensis samples were collected and validated by RT-PCR with primers ALSV-F and ALSV-R. Among these samples, 15 were positive for ALSV. The overall infection rate of ALSV on A. sinensis was 13.51%. The detection rates of Weiyuan, Zhangxian, Tanchang, Minxian and Yuzhong were 15.38%, 40.00%, 23.08%, 7.84% and 8.33%, respectively (Table.1). A. sinensis infested with ALSV may produce symptoms of chlorotic and mottle (Fig.1C and D), which is similar to that in quinoa. Accordingly, larger scale A. sinensis investigations must be conducted to determine the distribution and prevalence of ALSV in China.

First report of leaf spot disease caused by Xenodidymella glycyrrhizicola on Glycyrrhiza glabra

Glycyrrhiza glabra (liquorice) is a perennial shrub belonging to the Fabaceae family. It is a native of Mediterranean areas and primarily cultivated for its extracts which are used in the pharmaceutical and food industries, and in the manufacture of food supplements (Hayashi & Sudo, 2009). Several foliar diseases, such as powdery mildew, rust and leaf spots, have been reported to endanger the long-term viability and production of liquorice (Farr & Rossman, 2023). In 2022, a leaf spot disease was observed on c. 40% of the two-year-old plants in a liquorice field in Ankara, Turkey. Leaf spots were brown-to-black in colour, sometimes with a light brown centre. Lesions coalesced to large areas of blighted tissue with age (Figure 1a). Branches and petioles also became covered in oval lesions (Figure 1b). Pieces (5 × 5 mm) from lesion margins were surface sterilised in 70% ethanol (30 seconds) and 1% NaOCl (1 minute) and rinsed three times with sterile water. Phoma-like colonies were isolated from surface-sterilised parts of diseased tissues on potato dextrose agar (PDA). One representative isolate (Xg_Gg01), purified using the hyphal tip method, was selected for molecular, morphological and pathogenic characterisation and transferred to plates containing fresh PDA, oatmeal agar (OA), and malt extract agar (MEA) for seven days at 25°C with 12 hr light and 12 hr dark cycles. Colonies on MEA reached about 45 mm in diameter, margin regular and white, brown towards the centre, which was brown and orange due to conidial discharge from pycnidia (Figure 2a). Colonies reaching about 50 mm in diameter on the OA were marginally regular and olivaceous, with a colour change to black due to pycnidia formed towards the centre (Figure 2b). Colonies on the PDA reached about 43 mm in diameter, and the margin was regular and pale olive; the middle and centre were black due to dense pycnidia, and light brown conidial discharge was observed in the centre (Figure 2c). Pycnidia were mostly superficial or immersed in agar, ostiolate, 230–470 × 190–365 μm, and globose or subglobose and brown, becoming irregular-shaped and black with age (Figure 3a). Conidia were aseptate, variable in size and shape, oblong, broadly ellipsoidal, hyaline, becoming pale brown with age and measured 6.1 ± 9.3 × 3.4 ± 6.4 μm (Figure 3b). The internal transcribed spacer (ITS) of ribosomal DNA, partial 𝛽-tubulin gene (TUB2) and RNA polymerase second largest subunit (RPB2) loci of isolate Xg_Gg01 were amplified and bidirectionally sequenced with the universal primer sets; ITS1/ITS4 (White et al., 1990), BT2a/ BT2b (Glass & Donaldson, 1995), and 5f2 (Reeb et al., 2004)/7cr (Liu et al., 1999), respectively. A BLAST search of the resultant sequences (GenBank Accession Nos. OQ568230 for ITS, OQ571627 for TUB2, and OQ571628 for RPB2) showed 99.61–100% nucleotide identity with the holotype strain CBS 684.97 of X. glycyrrhizicola from New Zealand. The combined maximum-likelihood tree of ITS, TUB2, and RPB2 regions with 1000 bootstrap replicates showed that the isolate from the current study was clustered with strains of X. glycyrrhizicola derived from GenBank with strong support (Figure 4). Koch's postulates were fulfilled by spraying 10 ml of a spore suspension (106 spores/ml prepared in a 0.1% Tween-20 solution) of isolate Xg_Gg01 on each of five two-month G. glycyrrhizicola plants in trial pots. The plants were covered with plastic bags for 24 hr post inoculation. After seven days, spots were observed on the inoculated plants’ leaves and petioles (Figure 1c). No symptoms were observed on control plants, sprayed with sterile distilled water only. A morphologically identical X. glycyrrhizicola was isolated from affected tissues. To the best of our knowledge, this is the first report of X. glycyrrhizicola associated with leaf spots on G. glabra (Farr & Rossman, 2023). The fungus was previously reported on Glycyrrhiza lepidota in Iran (Ahmadpour et al., 2022) and New Zealand (Hou et al., 2020). However, G. glabra constitutes a new host record for this pathogen in Turkey and worldwide.

Differentiation of the domestic pig and wild boar using genotyping-by-sequencing

Domestic pigs and wild boars have undergone frequent interspecies crossbreeding; therefore, the presence of hybrids makes it challenging to find genetic markers that distinguish both subspecies. The aim of this research is to identify the DNA regions that underwent strong selection during the domestication of the pig and to give an insight into the genetic diversity of the Polish wild boar and domestic pigs by implementing the genotyping-by-sequencing (GBS) technique. We studied two groups of animals: one consisted of domestic pigs (Landrace, Large White, Duroc, Puławska and Pietrain), while the second group included wild boars from Poland. The filtered single nucleotide polymorphisms (SNP) panel used in this study included 7,298 markers that were spread across 18 porcine autosomes and unmapped contigs. The maximum-likelihood phylogenetic trees and multidimensional scaling (MDS) clearly separated the populations of pigs from the wild boars. We also detected genome regions that demonstrated the most significant genetic differences between the domestic pigs and wild boars. These regions were distributed on eight different autosomes and overlapped with 48 different pig RefSeq genes. The KEGG pathway, Reactome and GO terms were further used to assign a functional significance to the identified genes that were associated with inter alia muscle development (MYOG, MEOX2), pre-weaning mortality stress (MYO7A) and sensory perception (TAS1R3).

Genomic Insights Into Molecular Characteristics and Phylogenetic Linkage Between the Cases of Carbapenem-Resistant Klebsiella pneumoniae from a Non-tertiary Hospital in China: A Cohort Study

Background: Carbapenem-resistant Klebsiella pneumoniae (CRKP) strains have been listed as one of the major clinical concerns. Objectives: We investigated CPKP isolates from non-tertiary hospitals to find disseminated clones and analyze extensive phenotypic and genetic diversity in this study. Methods: In this cohort study, a total of 49 CRKP isolates from 3 hospitals in the same region were collected in 2021. The prevalence and antimicrobial susceptibility patterns were analyzed. Clinical data were retrieved from electronic medical record systems. The molecular types, antimicrobial resistance (AMR) profiles, plasmid replicons, and virulence factors were analyzed. The maximum-likelihood phylogenetic tree and transmission networks were constructed using single-nucleotide polymorphisms (SNPs). Results: The median age of patients (N = 49) was 66.0 years, and 85.7% were male. The most common CRKP infection was nosocomial pneumonia (75.5%), followed by bacteremia (10.2%). More than 53% of isolates were resistant to ceftazidime-avibactam (CAZ/AVI). Forty-five isolates were successfully sequenced; the predominant carbapenem-resistant gene was blaKPC-2 (93.3%). The 30-day mortality in our cohort was 24.5%. The most dominant sequence type (ST) was ST11 (60.0%), followed by ST15 (13.3%). Whole genome sequencing (WGS) analysis exhibited dissemination of ST11 strain clones, ST420, and ST15 clones, both within and outside the given hospital. Conclusions: In this surveillance study, several dissemination chains of CRKP were discovered in the hospital and the region, as ST11 was the main epidemic clone. Our findings suggest that effective infection control practices and antimicrobial stewardship are needed in non-tertiary hospitals in China.

Middle East respiratory syndrome coronavirus—a 10-year (2012-2022) global analysis of human and camel infections, genomic sequences, lineages, and geographical origins

ObjectivesThe World Health Organization priority zoonotic pathogen Middle East respiratory syndrome (MERS) coronavirus (CoV) has a high case fatality rate in humans and circulates in camels worldwide. MethodsWe performed a global analysis of human and camel MERS-CoV infections, epidemiology, genomic sequences, clades, lineages, and geographical origins for the period January 1, 2012 to August 3, 2022. MERS-CoV Surface gene sequences (4061 bp) were extracted from GenBank, and a phylogenetic maximum likelihood tree was constructed. ResultsAs of August 2022, 2591 human MERS cases from 26 countries were reported to the World Health Organization (Saudi Arabia, 2184 cases, including 813 deaths [case fatality rate: 37.2%]) Although declining in numbers, MERS cases continue to be reported from the Middle East. A total of 728 MERS-CoV genomes were identified (the largest numbers were from Saudi Arabia [222: human = 146, camels = 76] and the United Arab Emirates [176: human = 21, camels = 155]). A total of 501 ‘S’-gene sequences were used for phylogenetic tree construction (camels [n = 264], humans [n = 226], bats [n = 8], other [n=3]). Three MERS-CoV clades were identified: clade B, which is the largest, followed by clade A and clade C. Of the 462 clade B lineages, lineage 5 was predominant (n = 177). ConclusionMERS-CoV remains a threat to global health security. MERS-CoV variants continue circulating in humans and camels. The recombination rates indicate co-infections with different MERS-CoV lineages. Proactive surveillance of MERS-CoV infections and variants of concern in camels and humans worldwide, and development of a MERS vaccine, are essential for epidemic preparedness.

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

DNA Barcoding of Commercial Cockroaches in Turkey

Accurate species identification has become a precondition for accomplished biodiversity administration and further genetic research. Species acquaintance technics require molecular tools such as DNA barcoding as well as morphological identification for accurate identification. Particularly, the application of subunit I of the mitochondrial cytochrome c oxidase (COI) gene for DNA barcoding for insects has approved to be very useful in species acquaintance. The main aim of this study is to generate the first reference library of DNA barcode for cockroaches in Turkey using previously published data. As a result of the literature research, it has been observed that no study has been carried out on the DNA barcode of Turkish cockroaches. Therefore, in this study, we evaluated the advantage of DNA barcoding applied to two cockroach samples from Turkey for the first time. Our working samples implicated 10 DNA barcodes grounded on sequences created from our present study and 109 other DNA barcodes from BOLD. Various molecular analyzes including genetic distance-origin assessment (NeighborJoining and Maximum Likelihood trees) has been applied to accurately identify and describe species. In addition, Blaptica dubia (B. dubia) (Serville, 1838) and Nauphoeta cinerea (N. cinerea) (Olivier, 1789) have been reported as the first country records. It has been observed that reference libraries like BOLD are not yet sufficiently populated with COI sequences of Turkish cockroach species. In order for Turkish cockroach bio-assessment and biodiversity studies to benefit from the advantages of DNA barcoding, it is of great importance that cockroach inventories and taxonomic studies include DNA barcodes.

Chinese Domestic Ducks Evolved from Mallard Duck (Anas platyrhynchos) and Spot-Billed Duck (A. zonorhyncha)

China has a rich genetic resource in its 34 domestic duck breeds. In order to detect the genetic diversity and explore the origin of these indigenous duck populations, the mitochondrial DNA (mtDNA) control region was sequenced and analyzed for 208 individual ducks, including 22 domestic breeds, wild Mallards ducks, Eastern spot-billed ducks, White Muscovy ducks, and Black Muscovy ducks. The haplotype diversity (Hd) was 0.653 and the average nucleotide diversity (Pi) was 0.005, indicating moderate genetic diversity. Sixty haplotypes were detected, and the maximum-likelihood (ML) phylogenetic tree and median-joining (MJ) network were generated from the sequence analyses. In this study, haplotypes from the Mallard duck (Anas platyrhynchos) were detected in most of the Chinese domestic duck breeds. In addition, the Eastern spot-billed duck (A. zonorhyncha) H8 haplotype was detected in two duck breeds. Only two haplotypes were found in Muscovy ducks, suggesting low genetic diversity within this population. The sequence and haplotype analyses revealed that both A. platyrhynchos and A. zonorhyncha contributed to the evolution of domestic ducks in China.

Multiple Introduction and High Genetic Diversity: Drivers for Successful Establishment of Invasive Peacock Bass (Cichla spp.) in Peninsular Malaysia

The introduction of invasive Cichla spp. was followed by the several reports regarding the decline of local freshwater native species in Malaysia. The purpose of this research was to generate information concerning the introduction history of Cichla spp. in Malaysia. Studies on genetic diversity and structure provides the essential baseline data for monitoring and conservation of invasive species. This will help to clearly understand the propagule pressure and genetic distribution of Cichla spp. in the invaded freshwaters of Malaysia. A total of 61 samples of Cichla spp. were collected from 9 sampling location in Malaysia for mitochondrial DNA (control region) analysis. Overall samples showed high genetic diversity (Hd, 0.6700; π, 0.0254) and yielded 9 haplotypes resulted from different Cichla spp. present. The maximum likelihood tree with strong bootstrap support revealed that Cichla spp. forms 3 clusters, and confirmed to be C. monocoulus, C. occelaris and C. temensis. Except for Malacca populations, other populations were largely dominated by either C. monocoulus or C. occelaris. The current study suggesting that more than one introduction event of invasive Cichla spp. occurred in Malaysia. HIGHLIGHTS One of the common problem in the conservation effort for Malaysia’s freshwater aquatic ecosystem is failure to understand the introduction events of invasive species (Cichla) Mitochondrial DNA analysis (control region) conducted in order to find the genetic diversity and genetic structure of invasive Cichla across freshwater habitats in Malaysia High genetic diversity was observed, suggesting multiple introduction occurance of invasive Cichla in the country GRAPHICAL ABSTRACT

A new species of Fusigobius (Teleostei: Gobiidae) from the Red Sea and Gulf of Aden

The gobiid species, Fusigobius humerosus sp. nov., is described based on 12 type and 18 non-type specimens collected from the Red Sea and Gulf of Aden. The new species can be distinguished from congeners by a combination of meristic and morphometric characters. The new species was formerly misidentified with F. humeralis: both are characterised by a semitranslucent body; head and body with numerous small dusky orange-yellow spots; a round black spot in humeral region just above base of pectoral fin; and a black spot subequal to pupil diameter at midbase of the caudal fin. However, Fusigobius humerosus sp. nov. differs from F. humeralis by scales on side of nape not extending forward to above posterior margin of preopercle (vs. scales variably extending forward to between above posterior preopercular margin and orbit); first dorsal-fin spine longest (vs. second and third dorsal-fin spines longest); shorter upper jaw; shorter anal-fin spine; and posterior nostril about halfway between orbit and anterior nostril (vs. posterior nostril closer to orbit). The most complete description of the genus Fusigobius is provided. In phylogenetic analyses of publicly available sequences of the barcoding portion of the mitochondrial cytochrome oxidase subunit I (COI) gene, sequences derived from the new species form a separate and well-divergent monophyletic lineage. The resulting COI gene tree further suggests that the new Fusigobius species is phylogenetically most closely related to F. humeralis which forms its sister species in the maximum likelihood tree. Molecular species delimitation of available Fusigobius COI barcodes shows that 19 or 20 hypothetical divergent evolutionary lineages can be deduced depending on the analytical approach (ABGD = 19 and bPTP = 20), indicating a potentially higher taxonomic richness than the presently acknowledged 11 valid species. However, the assignment of available species names for some lineages remains uncertain, highlighting the need for an additional integrative taxonomic research on this genus.

Burkholderia semiarida sp. nov. and Burkholderia sola sp. nov., two novel B. cepacia complex species causing onion sour skin

Two putative novel Burkholderia cenocepacia lineages found in the semi-arid region of north-east Brazil causing onion sour skin were studied using genomic approaches to determine their taxonomic position. Four strains belonging to one novel lineage (CCRMBC16, CCRMBC33, CCRMBC74, and CCRMBC171) and one strain (CCRMBC51) belonging to another novel lineage had their whole genome sequenced to carry out taxogenomic analyses. The phylogenomic tree built using the type (strain) genome server (TYGS) clustered the strains CCRMBC16, CCRMBC33, CCRMBC74, and CCRMBC171 into the same clade, while grouped the strain CCRMBC51 separately. Average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) analysis showed values above 99.21 % and 93.2 %, respectively, among the strains CCRMBC16, CCRMBC33, CCRMBC74, and CCRMBC171, while ANI and dDDH values between these strains and the strain CCRMBC51 were below 94.49 % and 56.6 %, respectively. All these strains showed ANI and dDDH values below 94.78 % and 58.8 % concerning type strains of the B. cepacia complex (Bcc) species. The phylogenetic maximum likelihood tree constructed based on the multilocus sequence analysis of core genes (cMLSA) clustered the strains CCRMBC16, CCRMBC33, CCRMBC74, and CCRMBC171 and the strain CCRMBC51 in two exclusive clades, which did not cluster with any known species of the Bcc. Therefore, combined data from TYGS, ANI, dDDH, and cMLSA demonstrated that the strains represent two novel species of the Bcc, which we classified as Burkholderia semiarida sp. nov. and Burkholderia sola sp. nov., and proposed the strains CCRMBC74T (=IBSBF 3371 T = CBAS 905 T) and CCRMBC51T (=IBSBF3370T = CBAS 904 T) as type strains, respectively.