Vormela Research Articles

The great gerbil (Rhombomys opimus) as a host for tick species in Gurbantunggut Desert

BackgroundRodents play an important role in the life cycle of ixodid and argasid ticks, particularly as hosts of larvae and nymphs. The great gerbil (Rhombomys opimus), the preferred prey item of several carnivores (e.g. the red fox and marbled polecat), is the dominant rodent species in the Gurbantunggut Desert in northwestern China. The aim of this study was to investigate tick species associated with different hosts in the habitat of great gerbils, including wildlife and livestock.MethodsDuring 2018–2023, ticks were removed from 326 great gerbils, two red foxes (Vulpes vulpes), three marbled polecats (Vormela peregusna), 35 pastured sheep (Ovis aries), and one long-eared desert hedgehog (Hemiechinus auritus) in the Gurbantunggut Desert. Ticks were identified according to standard morphological keys. Then, they were further analyzed by molecular and phylogenic methods based on two mitochondrial markers, 16S rDNA and cytochrome c oxidase subunit I (COI) genes.ResultsA total of 889 ticks were collected, representing five species. These included Hyalomma asiaticum (n = 425: 24 larvae, 79 nymphs and 322 adults), Rhipicephalus turanicus (n = 153: 2 nymphs and 151 adults), Haemaphysalis erinacei (n = 298: 4 larvae, 7 nymphs and 287 adults), Ixodes acuminatus (n = 7: 4 nymphs and 3 adults) and Ornithodoros tartakovskyi (6 adults). Based on COI sequences, molecular and phylogenetic analyses showed that (i) I. acuminatus from great gerbils and marbled polecats clustered with I. acuminatus reported from Europe; (ii) O. tartakovskyi found in northwestern China belonged to an independent clade; (iii) Hy. asiaticum, R. turanicus and Ha. erinacei had 100% sequence identities to conspecific ticks sampled previously in China.ConclusionsThe great gerbil is an important host for the developmental stages of I. acuminatus, O. tartakovskyi, Ha. erinacei, Hy. asiaticum and R. turanicus, thus supporting the life cycle of several tick species which, as adults, parasitize predators (red fox and marble polecat) as well as pastured sheep and hedgehogs in the Gurbantunggut Desert. Ixodes acuminatus and O. tartakovskyi were found for the first time on great gerbil and marbled polecat, respectively.Graphical

Time to Step Up Conservation: Climate Change Will Further Reduce the Suitable Habitats for the Vulnerable Species Marbled Polecat (Vormela peregusna).

Habitat loss and human threats are putting the marbled polecat (Vormela peregusna) on the brink of extinction. Numerous recent studies have found that climate change will further deteriorate the living environment of endangered species, leading to their eventual extinction. In this study, we used the results of infrared camera surveys in China and worldwide distribution data to construct an ensemble model consisting of 10 commonly used ecological niche models to specify potential suitable habitat areas for V. peregusna under current conditions with similar environments to the sighting record sites. Changes in the suitable habitat for V. peregusna under future climate change scenarios were simulated using mid-century (2050s) and the end of the century (2090s) climate scenarios provided by the Coupled Model Intercomparison Project Phase 6 (CMIP6). We evaluated the accuracy of the model to obtain the environmental probability values (cutoff) of the V. peregusna distribution, the current distribution of suitable habitats, and future changes in moderately and highly suitable habitat areas. The results showed that the general linear model (GLM) was the best single model for predicting suitable habitats for V. peregusna, and the kappa coefficient, area under the curve (AUC), and true skill statistic (TSS) of the ensemble model all exceeded 0.9, reflecting greater accuracy and stability than single models. Under the current conditions, the area of suitable habitat for V. peregusna reached 3935.92 × 104 km2, suggesting a wide distribution range. In the future, climate change is predicted to severely affect the distribution of V. peregusna and substantially reduce the area of suitable habitats for the species, with 11.91 to 33.55% of moderately and highly suitable habitat areas no longer suitable for the survival of V. peregusna. This shift poses an extremely serious challenge to the conservation of this species. We suggest that attention be given to this problem in Europe, especially the countries surrounding the Black Sea, Asia, China, and Mongolia, and that measures be taken, such as regular monitoring and designating protected areas for the conservation of vulnerable animals.

Diversity of Crenosoma species in mustelids with the first molecular characterization of C. melesi and C. petrowi.

Species of genus Crenosoma have a wide distribution and are reported in Europe, the Americas, and Asia. Currently, the genus includes 14 nominal species, out of which 9 are parasitic in mustelids. Two species are mostly reported in mustelids from Europe, namely C. melesi and C. petrowi. Up to now, no genetic sequences are deposited in GenBank for any of the two. The aims of this study were to investigate the distribution, prevalence, and diversity of Crenosoma spp. infecting mustelids in Romania and to genetically characterize the species. Mustelids (n = 247) were collected over a period of 7 years from different locations in Romania and the respiratory tract was removed and examined for nematodes. Detected nematodes were morphologically identified and fragments of two genes were sequenced. Sampled mustelids included Eurasian badger, Meles meles (n = 102), Eurasian otter, Lutra lutra (n = 20), beech marten, Martes foina (n = 36), European pine marten, Martes martes (n = 5), steppe polecat, Mustela eversmanii (n = 1), European mink, Mustela lutreola (n = 1), least weasel, Mustela nivalis (n = 2), European polecat, Mustela putorius (n = 78), and marbled polecat, Vormela peregusna (n = 1). Nematodes from Eurasian badgers were morphologically identified as C. melesi (n = 13, 12.74%) and C. petrowi (n = 3, 2.94%). Nematodes from the beech martens were identified as C. petrowi (n = 6, 16.66%), C. vulpis (n = 1, 2.78%) and Crenosoma spp. (n = 3, 8.33%). Co-infections with two Crenosoma species were detected in one beech marten (C. petrowi + C. vulpis, n = 1, 2.77%) and in one European pine marten [C. petrowi + C. vulpis (n = 1, 20%)]. Two genes of Crenosoma melesi and C. petrowi were partly sequenced for the first time. We report new host-parasite associations for M. martes and C. vulpis. However, further studies are needed in order to determine the host-parasite associations and to improve the understanding of the epidemiology of Crenosoma nematodes.

Prey-Base Does Not Influence Breeding Success in Eagle Owls (Bubo bubo) in Judea, Israel.

Simple SummaryWe studied the diet and breeding success of Eagle Owls (Bubo bubo) at 14 nests in the Judea region, Israel. A total of 9461 prey items were identified and although mammals and birds dominated, there were also reptiles, amphibians, and invertebrates. The gradient of diversity of mammalian prey decreased from west to east; and avian prey increased correspondingly. The index of prey species diversity had no relationship with breeding success. The prey-base of the Eagle Owls helped identify the changes in geographic distributions of several species. The Eagle Owl’s diet emphasizes its generalist foraging habits, but pairs may be species-specific specialists. This adaptation is especially important in a fast-developing and congested country like Israel and probably allows the species to subsist in the region.The diet and breeding success of Eagle Owls (Bubo bubo) have been suggested to vary at different latitudes. However, it is still unclear whether and how these relationships exist at lower latitudes outside of Europe. We therefore studied the diet and breeding success of Eagle Owls during four breeding seasons at 14 nests in the Judea region, Israel. Of a total of 9461 prey items were identified; mammals (N = 6896, 35 species; 72.89%, biomass 62.3%) and birds (N = 2255, 55 species, 23.83%; biomass 36.0%) predominated the prey-base. We found that the gradient of diversity of the mammalian prey decreased from west to east; and avian prey increased from east to west. The index of species diversity, H’ for all prey, had no relationship with breeding success. The prey-base of the Eagle Owls helped identify the changes in geographic distributions of several species. Marbled polecat (Vormela peregusna), especially threatened, appear to be relatively abundant, as are brown rats (Ratttus norvegicus) which were previously considered to be restricted to the coastal regions. In addition to Egyptian fruit bats (Rousettus aegyptiacus), the Eagle Owls also preyed on nine different species of insectivorous bats, several of which appear to have enlarged their geographic distribution within Israel. The Eagle Owl’s diet emphasizes its generalist foraging habits, but pairs may be species-specific specialists. This adaptation is especially important in a fast-developing and congested country like Israel, because a generalist hunting strategy probably allows the species to subsist in the region.

Бегущая ласка, крадущийся лев и затаившийся кот: археозоологические материалы на Нижнем Дунае

The article addresses finds of bones of carnivores of the families Felidae and Mustelidae in the South-West of modern Ukraine in the context of domestication of their individual representatives. Published finds come from the monuments of Orlovka/Kartal (layers of cultures of Cernavoda, the Thracian Hallstatt and the first centuries AD) and Novoselskoe (Thracian Hallstatt). Bones of a wild forest cat, a lion, a domestic cat, a rock marten and a marbled polecat have been identified in the archeozoological materials. Paw prints of another small predator, weasel, were found on a fragment of Roman tile. Accounts from ancient writers mention the practice of using representatives of the marten family and domestic cats, but much later in time, for the elimination of mouse-like rodents. Archeozoological materials from the sites in the Lower Danube region confirm the appearance of a domestic cat on the territory of the South-Western part of modern Ukraine only in Roman time.

Rickettsiae in red fox (Vulpes vulpes), marbled polecat (Vormela peregusna) and their ticks in northwestern China

BackgroundPreviously, twelve Rickettsia species were identified in ticks, fleas, sheep keds (Melophagus ovinus), bats (Pipistrellus pipistrellus) and a tick-bitten patient in the Xinjiang Uygur Autonomous Region (XUAR) in northwestern China. Here we aimed to molecularly detect rickettsial agents in red fox (Vulpes vulpes), marbled polecat (Vormela peregusna) and their ticks.MethodsDuring 2018–2019, 12 red foxes, one marbled polecat and their ticks were sampled in two counties and a city of the XUAR. The heart, liver, spleen, lung and kidney of these 13 carnivores were dissected, followed by DNA extraction. Hard ticks were identified both morphologically and molecularly. All samples were examined for the presence of rickettsiae by amplifying four genetic markers (17-kDa, gltA, ompA, sca1).ResultsA total of 26 adult ticks and 28 nymphs (38 Ixodes canisuga, nine Ixodes kaiseri, six Haemaphysalis erinacei and one Dermacentor marginatus) were collected from red foxes, and four Ha. erinacei ticks were removed from the marbled polecat. Analysis of cytochrome c oxidase subunit I (COI) gene sequences indicated that 2–32 nucleotides differed between I. canisuga, I. kaiseri and Ha. erinacei from northwestern China and Europe. Rickettsia raoultii was detected in three red foxes, Candidatus Rickettsia barbariae in a red fox, Rickettsia sibirica in a red fox and a marbled polecat, and R. raoultii in two tick species (I. canisuga and D. marginatus).ConclusionsTo the best of our knowledge, I. canisuga and I. kaiseri have not been previously reported from red foxes in China. The DNA of R. sibirica and R. raoultii was detected for the first time in the organs of red foxes, and R. sibirica in the organs of a marbled polecat. This is also the first molecular evidence for the presence of R. raoultii in I. canisuga. Our findings expand the range of tick-borne pathogens in wildlife species and associated ticks in China.Graphical

First mitochondrial genome of the marbled polecat Vormela peregusna (Carnivora, Mustelidae)

The marbled polecat, Vormela peregusna, is one of the least studied species in the Mustelidae family, especially with regard to phylogeography and genetic diversity. In this study, we determined the mitochondrial genome sequence of V. peregusna and investigated its position within the Mustelidae phylogeny. The generated mitogenome is 15,982 bp in length; it consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes, and a control region.

Analysis of the activity rhythms of the great gerbil (Rhombomys opimus) and its predators and their correlations based on infrared camera technology

Rodents have long plagued forestry production in China, particularly in desert areas in northwestern China, where prevention and monitoring techniques are lacking. Predators are important in regulating rodent populations, and determining how to maximise the role of predators in the comprehensive management of rodent pests is one of the most important issues in rodent control. To accurately understand the activities and vegetation damage patterns of the great gerbil (Rhombomys opimus) in a desert forest area, as well as the activities of its predators, we set up infrared cameras in the Sal Hu Song desert forest region of Altay city, Xinjiang Uygur Autonomous Region, China, in December 2016 and conducted one year of field monitoring of R. opimus and its predators. A total of 2407 independent and valid photographs of R. opimus and its predators were collected. By calculating the relative abundance index, we analysed the activity rhythms of R. opimus and its predators and calculated the correlations of their activity rhythms. The relative abundance of R. opimus was 237.75 in Sal Hu Song, and the predators were mainly the long-legged buzzard (Buteo rufinus) at 94.50, marbled polecat (Vormela peregusna) at 45.74, and red fox (Vulpes vulpes) at 44.26. R. opimus is a typical diurnal animal, with activity peaks occurring between 10:00 and 12:00 and between 17:00 and 19:00, and its activities were mainly movement and foraging. Over the year, R. opimus had two peak activity periods, March and September–October. The peak activity periods of V. peregusna were March and September, while the peak activity period of V. vulpes was February–March. The peak activity period of B. rufinus was June. Among these three predators, the activity rhythms of V. peregusna had the highest correlation with those of R. opimus. This study will contribute to monitoring and managing pest animals in these desert areas.

Tick distribution in border regions of Northwestern China

Ticks are important vectors of emerging and re-emerging pathogens. The aim of this study was to determine tick species occurring in Xinjiang Uygur Autonomous Region (XUAR), especially on border regions. A total of 22,994 ticks (including 22,629 adults, 365 larvae and nymphs), belonging to six tick genera (i.e. Dermacentor, Hyalomma, Rhipicephalus, Haemaphysalis, Ixodes and Argas) and fourteen tick species, were collected from ten animal hosts in thirty-five counties (cities) in XUAR during 2011 - 2017. Rhipicephalus turanicus, Dermacentor niveus, Hyalomma asiaticum and Dermacentor marginatus were dominantly sampled from domestic animals while Dermacentor nuttalli, Haemaphysalis punctata, Haemaphysalis concinna, Rhipicephalus sanguineus sensu lato, Dermacentor silvarum, Hyalomma scupense and Argas persicus were sporadically found. Based on 16S rDNA, phylogenetic analyses showed that: i) R. turanicus genotypes in XUAR showed geographical separation, and belonged to clade I (major distribution in the Central Asian) rather than clade II (major distribution in the Mediterranean Basin); ii) Ixodes kaiseri, firstly sampled from Asian badgers (Meles leucurus), was in ancestral position compared to European tick species when combining COI haplotypes; and iii) Haemaphysalis erinacei from marbled polecats in China was a separate genotype compared with that in Mediterranean and Europe. Our findings suggest that geographical range plays a more important role than host-association in tick phylogeny, especially for R. turanicus, I. kaiseri and H. erinacei.

Genetic diversity of MHC class II DRB alleles in the marbled polecat, Vormela peregusna, in Bulgaria

The marbled polecat, Vormela peregusna, is a small marten-like mustelid distributed from southeastern Europe to western China. Since the individual numbers of this species have declined, it has been classified as a vulnerable (VU) species in the 2008 IUCN Red List. To better understand the adaptation of V. peregusna, we investigated diversity and selection in the major histocompatibility complex (MHC) class II DRB gene which is reported to be highly polymorphic in many other species. Among 10 V. peregusna individuals from Bulgaria, we detected 9 novel sequences of partial exon 2, including antigen-binding site (ABS) codons, as representatives of DRB allele (Vope-DRBs). Two of the alleles were detected in all individuals analysed, while the others showed limited geographical distributions. Our results provided evidence for positive selection on ABS codons and recombination break points, contributing to maintaining the diversity of Vope-DRBs. In a Bayesian phylogenetic tree, all Vope-DRBs grouped within the mustelid clade, with three of them in the basal group consisted of alleles from Meles, Martes, and Vormela but no Mustela alleles, and the others in the derived group consisted of alleles diverged relatively late in the various mustelid species. The Vope-DRBs showed trans-species polymorphism within the mustelid clade, suggesting that the DRB genes evolved under long-lasting balancing selection.

Molecular phylogenetic status of the Bulgarian marbled polecat (Vormela peregusna, Mustelidae, Carnivora), revealed by Y chromosomal genes and mitochondrial DNA sequences

In this study, we investigated molecular phylogenetic status of the marbled polecat (Vormela peregusna) from Bulgaria, using sequences of two Y-chromosomal genes (SRY and ZFY). The phylogenetic tree inferred using combined sequences of both genes indicated that the marbled polecat was split from genera Lutra, Neovison and Mustela after genus Martes was diverged in family Mustelidae. In addition, we analyzed molecular phylogeography of the Bulgarian population of the marbled polecat, using cytochrome b and control region sequences of mitochondrial DNA (mtDNA). The phylogenetic tree of cytochrome b indicated that the haplotypes of the Bulgarian population comprised two haplogroups, which were the most ancestral clades. Additionally, the control region phylogeny showed that the haplotypes of Bulgaria formed two haplogroups: one was the most ancestral clade, and the other was the derivative clade. One individual with the most ancestral cytochrome b clade had a control region haplotype of the derivative clade. Thus, this study revealed that the most ancestral lineages of the marbled polecat are included in the population of Bulgaria. The Bulgarian population could be a remnant lineage from a basal for the species, which in Pleistocene occupied a relatively large area related to the Balkan-Caucasian.

Cranial variation and taxonomic content of the marbled polecat Vormela peregusna (Mustelidae, Carnivora)

Morphometric variation in 26 characters of 245 skulls of the marbled polecat (Vormela peregusna) was studied across the distribution range. Morphological diversity was low with respect to both the size and the shape of the skull. The sexual size dimorphism of cranial characters in V. peregusna was low compared with other similar-sized mustelids. This finding may be a result of more specialized behaviour, resulting in less intra-specific competition with respect to habitat and food selection. Analysis of the geographic variation of skulls revealed two morphological groups – western and eastern. These groups were treated as distinct subspecies in this study. Nominotypical V. p. peregusna (Güldenstädt, 1770) (syn. sarmatica, euxina) is found in southern and eastern Europe, Asia Minor and Caucasus. The eastern subspecies V. p. koshewnikowiSatunin, 1910 (syn. alpherakii, chinensis, negans, obscura, ornata, pallidior, syriaca, and tedshenika) is found south and east of the Middle East, in Middle and Central Asia and eastward to China. Our data revealed a gradual decrease in the morphological diversity in Vormela skulls from west to east in the distribution range. This phenomenon may be explained by the later origin of the eastern subclusters of the marbled polecat. The pattern of geographic variation revealed in this study may reflect the Pleistocene history of the species range formation, rather than a relationship to climate conditions throughout the modern species range.

Стан популяції перегузні (Vormela peregusna) на південному сході України

Стан популяції перегузні (Vormela peregusna) на південному сході України

The early 8thcentury A.D. zoomorphic iconography of the wall decorations in Qasr al-Amra, Hashemite Kingdom of Jordan

ABSTRACT Located near to the village of Azraq, in eastern Jordan, the archaeological site of Qasr al-Amra was built in the early Umayyad period, for the caliph Al-Walid I. It is especially famous for the wall paintings that have survived on the interior ceilings and walls, showing, among other subjects, hunting scenes and several zoomorphic figures. Many of these portray the ancient local fauna, including a snake (probably Walterinnesia aegyptia Lataste, 1887), several birds (herons, flamingos, cranes, peacocks and partridges), carnivores (Ursus arctos Linnaeus, 1758, Felis silvestris Schreber, 1777 and Vormela peregusna Guldenstadt, 1770), and ungulates (Syrian onagers and Persian gazelles). It is very likely that some of these illustrations were influenced by tales contained in the great Iranian epic poem Shâh Nâmeh, or “The Book of Kings”, and in other traditional Sassanid and Muslim texts.

Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China–Kazakhstan border

We found Rickettsia raoultii DNA in 2 out of 32 (6.25 %) Haemaphysalis erinacei ticks. Result showed that the sequences of five genes (17-kDa, gltA, ompA, rrs, and ompB) were 100 % identity with that of R. Raoultii in GenBank. This study is the first report on the presence of R. raoultii in H. erinacei from wild marbled polecat, Vormela peregusna. Our findings suggest that H. erinacei parasitizing wild marbled polecat may serve as reservoir and carriers for R. raoultii in areas around the China-Kazakhstan border. The transmission of tick-borne diseases originated from wildlife should not be underestimated in border region.

Phylogenetic Status and Genetic Diversity of the Turkish Marbled Polecat, Vormela peregusna, (Mustelidae: Carnivora: Mammalia) inferred from the Mitochondrial Cytochrome b Gene

Previous genetic studies of marbled polecats did not include samples collected in Turkey. Therefore, the current knowledge is not sufficient to elucidate the phylogenetic relationships among marbled polecat populations. The aim of the present study was to determine the genetic diversity of the Turkish population and to reveal the phylogenetic relationships between the Turkish population and other marbled polecat populations. To accomplish this, we analyzed 17 cytochrome b gene sequences from Turkey and compared these with 10 cytochrome b gene sequences from the GenBank database. To construct the phylogenetic tree, we used the Neighbor-Joining, Maximum Likelihood, Maximum Parsimony and Bayesian methods, and also a median-joining network to assess relationships among haplotypes of the marbled polecat. The performed analyses, except for Bayesian method, yielded three main haplogroups within the marbled polecat. Haplogroup 1 contained haplotypes from Armenia, Azerbaijan, Russia, Turkey (Anatolia), Turkmenistan and Uzbekistan, Haplogroup 2 consisted of haplotypes from Turkey (Thrace), Turkmenistan and an unknown location, and Haplogroup 3 (Turkish Main Haplogroup) contained only the Turkish haplotypes. The present study shows that the Turkish population consists of individuals from all these three distinct phylogroups, and emphasized the importance of data obtained from the Turkish samples to reveal the phylogenetic relations among marbled polecat populations.

On the correct name for some subfamilies of Mustelidae (Mammalia, Carnivora)

Mustelids (Mustelidae) exhibit a wide morphological and ecological diversity, ranging from aquatic to semi arboreal and fossorial forms. It is the most diversity family in Carnivora, and this has promoted a great number of taxonomic arrangements for subfamilies, which can range from two to 15 depending on the author. The relatively recent use of molecular data has helped to elucidate the classification of mustelids, and eight subfamilies are currently recognized: Mustelinae, Galictinae, Helictidinae, Martinae, Melinae, Mellivorinae, Taxidiinae and Lutrinae. However, some of these subfamilies have nomenclatural problems, not receiving the oldest available name. The subfamily that includes martens (Martes, Charronia and Pekania), tayra (Eira) and wolverine (Gulo) has received the name of Martinae Wagner, 1841, but the oldest available name is Guloninae Gray, 1825. This problem also occurs for the subfamily that includes the grisons (Galictis), Patagonian weasel (Lyncodon), marbled polecat (Vormela) and striped weasels (Ictonyx and Poecilogale), which are known as Grisoninae Pocock, 1921, but the correct name for this group is Ictonychinae, Pocock, 1921. The subfamily that includes ferret badgers (Melogale) retains the name Helictidinae Gray, 1865, because its validity is not affected when the type-genus of the subfamily becomes a junior synonym of another genus. Furthermore, a list of the extant subfamilies of Mustelidae and their respective synonyms and included genera is provided.

First report of Borrelia burgdorferi sensu lato in two threatened carnivores: the Marbled polecat, Vormela peregusna and the European mink, Mustela lutreola (Mammalia: Mustelidae)

BackgroundLyme disease is a widespread cosmopolitan zoonosis caused by species belonging to the genus Borrelia. It is transmitted from animal reservoir hosts to humans through hard - ticks of genus Ixodes which are vectors of the disease.Case presentationBorrelia burgdorferi sensu lato infection was identified in a marbled polecat, Vormela peregusna, and two European minks, Mustela lutreola, from Romania, by PCR. RFLP revealed the presence of a single genospecies, Borrelia burgdorferi sensu stricto.ConclusionsThis is the first report of the Lyme disease spirochetes in the two mentioned hosts.

Geographical variation of the marbled polecat Vormela peregusna (Carnivora: Mustelidae): Molecular genetic study

(Guldens-taedt, 1770) remains the least studied member of thefamily Mustelidae. Our previous molecular geneticanalysis [1] provided more specific information on phy-logenetic relationships of the genus; however, theintraspecific structure of the marbled polecat is stillunknown, although the species area is rather extendedand covers the entire steppe, desert, and semidesertzones of Eurasia. Sequencing the mitochondrial DNAof marbled polecats from southern Russia, Transcauca-sia, Turkmenistan, and Uzbekistan showed a highdegree of the species genetic homogeneity in a largepart of the area, and no distinctions were found betweenanimals from the above regions, though some of thesepopulations are now assumed to be valid subspecies.Among numerous marbled polecat forms that weredescribed at different times, the following ones are nowvalid: V. p. peregusna, V. p. syriaca, V. p. pallidior,V. p. euxina, V. p. koshevnikovi, and V. p. negans [2].The taxonomy of marbled polecats from some regions(Kyzyl Kum, Transcaucasia, Tadjikistan, etc.) remainsunknown.The following samples were the objects of ourstudy. Southern Russia: VP1_KLM ([1]: VP1),Kalmykia, 2002; VP2_RST ([1]: VP2), Rostov oblast,1999. Transcaucasia: VP5-2_ARM, Armenia, nearLake Sevan, 2005 (muscles preserved in alcohol); VP5-3_AZR, Azerbaijan, Lachin outskirts, the ZabukhRiver, 1999 (a dry skin). Turkmenistan: VP4-4_TRK(the collection of the Zoological Institute (ZIN) of theRussian Academy of Sciences: C.51339), VP4-5_TRK(ZIN: C.51340), and VP4-7_TRK (ZIN: C.51403); allthe three samples were from southeastern Kara Kum,1964; VP4-6_TRK (ZIN: C.40194), Kushka outskirts,1956; VP4-8_TRK (ZIN: C.48161), Mary outskirts,1960; The material from ZIN consisted of ZIN collec-tion fingers on dry skins. Uzbekistan (Kysyl Kum):VP3-2_UZB ([1]: VP3), 1991, VP3-7_UZB, 1993,both samples were from Bukhara oblast, 25 km south-east of Bukhara, dry skins.For all 11 samples, the left domain sequences of themtDNA control region were determined (253–256 bp,256 positions); for samples VP5-3_AZR, VP4-6_TRK,and VP3-2_UZB, the complete sequences of the cyto-chrome b gene (1140 bp) were determined; for the sam-ples VP1_KLM, VP2_RST, VP5-2_ARM, VP4-4_TRK, and VP4-7_TRK, the complete sequences ofboth cytochrome b gene and the mtDNA control region(1085–1108 bp, 1109 positions) were determined.DNA was extracted as described previously [1]. Forthe cytochrome b gene amplification, internal primersCVS-r2 (cgggtttaatatggggtggt) and CVS-f2 (atattccca-gaaacatgaaacatc) were designed as pairs to the previ-ously used CVS-f1 and CVS-r1 primers [1]. For ampli-fication of the control region, we developed pairs ofprimers DVS-f1 (cctccctaagactcaaggaagaa)–DVS-r2(tgtcctgtgaccattgactga) and DVS-f2 (aatcagcccatgatca-caca )– DVS - r 1 ( ggctaggaccaaacctttatg ). The PCR pro-file was were the following: I, 94 ° C for 3 min; II, 94 ° Cfor 45 s, 54 ° C for 1.5 min, and 70 ° C for 2 min(30 cycles); III, 70 ° C for 3 min. For some samples withunstable DNA, primer DVS-r3 (ttatgtgtgatcatgggctga)or DVS-r4 (ccagatgccaggtatagtttca) was used togetherwith the DVS-f1 primer to amplificate the left domainof the control region. All primers were constructedusing the Primer3 software [3].Both both strands of each mtDNA region were rec-ognized for each region of every sample (an ABIPRISM 310 analyzer; BigDye Terminator v.3.1reagents as described in [1]). The sequences werematched using the BioEdit v.7.0.1 software [4]. Thecontrol region borders were determined by alignment

Sexual dimorphism of marbled polecat Vormela peregusna (Carnivora: Mustelidae)

Analysis of morphometric variation in 26 cranial characters were studied in 85 individuals of marbled polecat Vormela peregusna from Turkmenistan demonstrated a low level of sexual dimorphism in the species. The properties of sexual dimorphism in marbled polecat are discussed in terms of available hypotheses of sexual dimorphism in carnivores.