Geographical variation of the marbled polecat Vormela peregusna (Carnivora: Mustelidae): Molecular genetic study

Abstract

(Guldens-taedt, 1770) remains the least studied member of thefamily Mustelidae. Our previous molecular geneticanalysis [1] provided more specific information on phy-logenetic relationships of the genus; however, theintraspecific structure of the marbled polecat is stillunknown, although the species area is rather extendedand covers the entire steppe, desert, and semidesertzones of Eurasia. Sequencing the mitochondrial DNAof marbled polecats from southern Russia, Transcauca-sia, Turkmenistan, and Uzbekistan showed a highdegree of the species genetic homogeneity in a largepart of the area, and no distinctions were found betweenanimals from the above regions, though some of thesepopulations are now assumed to be valid subspecies.Among numerous marbled polecat forms that weredescribed at different times, the following ones are nowvalid: V. p. peregusna, V. p. syriaca, V. p. pallidior,V. p. euxina, V. p. koshevnikovi, and V. p. negans [2].The taxonomy of marbled polecats from some regions(Kyzyl Kum, Transcaucasia, Tadjikistan, etc.) remainsunknown.The following samples were the objects of ourstudy. Southern Russia: VP1_KLM ([1]: VP1),Kalmykia, 2002; VP2_RST ([1]: VP2), Rostov oblast,1999. Transcaucasia: VP5-2_ARM, Armenia, nearLake Sevan, 2005 (muscles preserved in alcohol); VP5-3_AZR, Azerbaijan, Lachin outskirts, the ZabukhRiver, 1999 (a dry skin). Turkmenistan: VP4-4_TRK(the collection of the Zoological Institute (ZIN) of theRussian Academy of Sciences: C.51339), VP4-5_TRK(ZIN: C.51340), and VP4-7_TRK (ZIN: C.51403); allthe three samples were from southeastern Kara Kum,1964; VP4-6_TRK (ZIN: C.40194), Kushka outskirts,1956; VP4-8_TRK (ZIN: C.48161), Mary outskirts,1960; The material from ZIN consisted of ZIN collec-tion fingers on dry skins. Uzbekistan (Kysyl Kum):VP3-2_UZB ([1]: VP3), 1991, VP3-7_UZB, 1993,both samples were from Bukhara oblast, 25 km south-east of Bukhara, dry skins.For all 11 samples, the left domain sequences of themtDNA control region were determined (253–256 bp,256 positions); for samples VP5-3_AZR, VP4-6_TRK,and VP3-2_UZB, the complete sequences of the cyto-chrome b gene (1140 bp) were determined; for the sam-ples VP1_KLM, VP2_RST, VP5-2_ARM, VP4-4_TRK, and VP4-7_TRK, the complete sequences ofboth cytochrome b gene and the mtDNA control region(1085–1108 bp, 1109 positions) were determined.DNA was extracted as described previously [1]. Forthe cytochrome b gene amplification, internal primersCVS-r2 (cgggtttaatatggggtggt) and CVS-f2 (atattccca-gaaacatgaaacatc) were designed as pairs to the previ-ously used CVS-f1 and CVS-r1 primers [1]. For ampli-fication of the control region, we developed pairs ofprimers DVS-f1 (cctccctaagactcaaggaagaa)–DVS-r2(tgtcctgtgaccattgactga) and DVS-f2 (aatcagcccatgatca-caca )– DVS - r 1 ( ggctaggaccaaacctttatg ). The PCR pro-file was were the following: I, 94 ° C for 3 min; II, 94 ° Cfor 45 s, 54 ° C for 1.5 min, and 70 ° C for 2 min(30 cycles); III, 70 ° C for 3 min. For some samples withunstable DNA, primer DVS-r3 (ttatgtgtgatcatgggctga)or DVS-r4 (ccagatgccaggtatagtttca) was used togetherwith the DVS-f1 primer to amplificate the left domainof the control region. All primers were constructedusing the Primer3 software [3].Both both strands of each mtDNA region were rec-ognized for each region of every sample (an ABIPRISM 310 analyzer; BigDye Terminator v.3.1reagents as described in [1]). The sequences werematched using the BioEdit v.7.0.1 software [4]. Thecontrol region borders were determined by alignment