Mannitol Solution Research Articles

Incidence and risks of excessive distension absorption in hysteroscopic surgery using 5% mannitol solution: a retrospective descriptive study

ObjectiveTo clarify the incidence of excessive distension absorption in hysteroscopic surgery using 5% mannitol solution, evaluate the associated risks, and help to establish a safe fluid deficit threshold for such complication.DesignRetrospective descriptive study.SettingAcademic medical center.PatientsTen thousand six hundred ninety-three patients underwent inpatient hysteroscopic surgery with 5% mannitol perfusion using a monopolar electrosurgical instrument from Jan. 2015 to Sep. 2020.Intervention(s)None. This study has been approved by the Ethics Committee of Sun Yat-sen Memorial Hospital.Measurements and main resultsA fluid deficit of more than 1000 mL was defined as the diagnostic criteria for excessive distension absorption. The overall incidence of excessive distension absorption in this study was 0.46% (49/10693). The incidence was 2.57% (16/623) for transcervical resection of fibroid (TCRF), 2.36% (9/381) for retained products of conception (RPOC) removal, 1.20% (6/501) for hysteroscopic uterine septum resection (HSR), 0.48% (4/828) for transcervical resection of the endometrium (TCRE), and 0.53% (14/2621) for transcervical resections of adhesion (TCRA). Excessive distension absorption could occur within seven minutes in HSR. Among the patients diagnosed with excessive distension absorption, 30.77% (12/39) exhibited signs or symptoms related to circulation overload with a fluid deficit under 2500 mL, and 10.26% (4/39) developed pulmonary edema.ConclusionExcessive distension absorption could happen in all kinds hysteroscopic surgical treatment including RPOC removal and TCRA which were rarely reported. The overall incidence of excessive distension absorption could be low. But it would be five times higher in certain procedures such as TCRF, RPOC removal and TCRA. Resection using a needle electrode in HSR and TCRA may contribute to the short time development of excessive distension absorption. 30.77% of the patients could not tolerate the fluid deficit of less than 2500 mL which was set as a threshold for isotonic distending media and presented with circulation overload related signs or symptoms.

Unraveling the Function of Stress Kinase in the Progeny of Soybean Plants Grown from Low-Temperature Pretreated Seeds

The research work was carried out with the progeny of two soybean cultivars, Richy and Izidor, from the years 2019 and 2020. Plants were grown from seeds pretreated with low temperature (2–5 °C) before sowing for two periods of treatment: 12 days marked as “treated control” (tr. K) and 22 days marked as “treated” (tr.); and “non-treated” (K0) used as a control. Transcriptional profiles of the gene encoding a stress protein kinase were evaluated after the application of abiotic stresses caused by the following: 150 mM NaCl solution/salinity stress/for 24 h; 350 mM mannitol solution/drought stress/for 24 h; and low temperature (4 °C) for 72 h. Transcript levels were established by real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) in leaf tissue collected from seedlings of the 2019 and 2020 progeny of “tr. K”, “tr.”, and “K0” samples. Analyses determining the quantity of malondialdehyde (MDA) and total antioxidant capacity (TAC) were performed. The expression of investigated stress kinase was highly upregulated after the application of abiotic stress caused by 150 mM solution of NaCl and to a lesser extent by 350 mM solution of mannitol. Detected transcript levels depend on the type of sample out of “tr. K”, “tr.”, and “K0”; the progeny; and the genotype.

Optimization of The Priming Time of Mannitol Solution for Mungbean Seed Treatment

Abstract not available Bangladesh Agron. J. 2024, 26(2): 100-103

Study on volumetric heat and mass transfer coefficient in a spray drying process utilizing pressure swirl nozzle: A numerical and experimental approach

This paper applies a sectional and cumulative approach to estimate the volumetric heat and mass transfer coefficients (hV and kV) to characterize the behaviour of the spray drying process. The investigation utilizes a tailor-made spray dryer equipped with a pressure swirl nozzle with a 0.2 mm orifice diameter, utilizing Mannitol solution as the precursor and air as the carrier gas. A comprehensive numerical analysis is conducted using the Adaptive Mesh Refinement (AMR) technique alongside selective experiments. The study considers precursor mass flow rates of 1 g/s, 1.2 g/s, and 1.5 g/s, along with carrier gas velocities of 0.88 m/s and 1.19 m/s at a temperature of 250 °C. Comparisons between predicted and estimated hV and kV are performed, leading to the proposal of a method for identifying constant rate and falling rate periods. The analyses contribute to delineating the solvent evaporation zone, solid particles heating zone, spray penetration length, and drying length. Additionally, experimental temperature measurements in both axial and radial directions at 12 grid points in the chamber are conducted to validate the numerical results, showing acceptable deviation.

Effects of oral contrast agent on the viscoelastic properties of the terminal ileum investigated using magnetic resonance elastography.

While standard clinical magnetic resonance (MR) enterography can detect inflammatory bowel disease, it is of limited value in deciding between medical versus surgical treatment. Alternatively, intestinal MR elastography has the potential to contribute additional information to therapeutic decision-making; however, the influence of bowel distension by oral contrast agent on viscoelastic tissue properties remains elusive. Therefore, we aimed to investigate the influence of oral contrast agent-induced bowel distension on the viscoelastic properties of the terminal ileum in healthy volunteers. In this prospective pilot study, 20 healthy volunteers (33.2±8.2 years; 10 men, 10 women) underwent multifrequency MR elastography using a single-shot spin-echo echo planar imaging sequence at 1.5 Tesla and drive frequencies of 40, 50, 60 and 70 Hz. Maps of shear wave speed (c in ms-1) and loss angle (φ in rad), representing stiffness and viscous properties, respectively, were generated using tomoelastography data processing. The volunteers were scanned before and after ingestion of 1,000 mL of 2% mannitol solution as oral contrast agent. There was no significant difference in terminal ileum biomechanical properties before vs. after ingestion of an oral contrast agent (mean c: 1.47±0.24 vs. 1.40±0.25 ms-1 with P=0.37; mean φ: 0.70±0.12 rad vs. 0.68±0.12 rad with P=0.61). Moreover, there was no statistically significant correlation between MR elastography parameters before and after the ingestion of oral contrast (c: r=0.22, P=0.36; φ: r=0.24, P=0.30). The results of this study suggest that bowel distension for intestinal MR elastography has no systematic effect on the biomechanical tissue properties of the terminal ileum determined by MR elastography. Therefore, future study protocols appear feasible with or without oral contrast agents.

N-Methyl-D-aspartic acid (NMDA) mediated vasodilation in aorta

Although N-Methyl-D-aspartic acid (NMDA) mediated vasodilation has been extensively studied in cerebral circulation, there are limited studies that address the NMDA-mediated vascular responses at the peripheral vascular system. In this study our objective is to address the peripheral vascular responses mediated by NMDA. Vascular responses were obtained via in vitro myography on thoracic aorta segments isolated from C57BL/6 wild type male mice. NMDA at the concentration range of 100 micromolar to 1 millimolar in aortic segments precontracted by 1 micromolar phenylephrine. Maximal vasodilation of 75% in reference to baseline prior to drug application was observed at 3mM NMDA. NMDA receptor blockade by MK-801 did not change NMDA-induced vasodilation (55% vs 58%). Neither vehicle of NMDA, nor corresponding osmolar solutions of mannitol to NMDA concentrations induced vasodilation. Nitric oxide synthase (NOS) inhibition by 100 micromolar m Nω-Nitro-L-arginine methyl ester hydrochloride (L-NAME) reduced 3mM NMDA induced vasodilation from 75% to 16%. Removal of endothelial cell layer did not change the vasodilation mediated by NMDA. NMDA at millimolar concentrations relaxes vascular smooth muscle via non-endothelium dependent and NMDA-receptor independent mechanisms. Vasodilatory response to NMDA appears partially mediated by NOS. It is possible that NMDA is exerting its vasodilatory effects via non-NMDA receptors on the vascular smooth muscle. Whether NMDA-induced vasorelaxation is observed in resistance arteries remains warranted. PSC CUNY 66608-00 54. This is the full abstract presented at the American Physiology Summit 2024 meeting and is only available in HTML format. There are no additional versions or additional content available for this abstract. Physiology was not involved in the peer review process.

Comparison of mannitol and hypertonic saline solution for the treatment of suspected brain herniation during prehospital management of traumatic brain injury patients.

Occurrence of mydriasis during the prehospital management of traumatic brain injury (TBI) may suggest severe intracranial hypertension (ICH) subsequent to brain herniation. The initiation of hyperosmolar therapy to reduce ICH and brain herniation is recommended. Whether mannitol or hypertonic saline solution (HSS) should be preferred is unknown. The objective of this study is to assess whether HSS, compared with mannitol, is associated with improved survival in adult trauma patients with TBI and mydriasis. A retrospective observational cohort study using the French Traumabase national registry to compare the ICU mortality of patients receiving either HSS or mannitol. Patients aged 16 years or older with moderate to severe TBI who presented with mydriasis during prehospital management were included. We performed propensity score matching on a priori selected variables [i.e. age, sex and initial Coma Glasgow Scale (GCS)] with a ratio of 1 : 3 to ensure comparability between the two groups. The primary outcome was ICU mortality. The secondary outcomes were regression of pupillary abnormality during prehospital management, pulsatility index and diastolic velocity on transcranial Doppler within 24 h after TBI, early ICU mortality (within 48 h), ICU and hospital length of stay. Of 31 579 patients recorded in the registry between 2011 and 2021, 1417 presented with prehospital mydriasis and were included: 1172 (82.7%) received mannitol and 245 (17.3%) received HSS. After propensity score matching, 720 in the mannitol group matched 240 patients in the HSS group. Median age was 41 years [interquartile ranges (IQR) 26-60], 1058 were men (73%) and median GCS was 4 (IQR 3-6). No significant difference was observed in terms of characteristics and prehospital management between the two groups. ICU mortality was lower in the HSS group (45%) than in the mannitol group (54%) after matching [odds ratio (OR) 0.68 (0.5-0.9), P = 0.014]. No differences were identified between the groups in terms of secondary outcomes. In this propensity-matched observational study, the prehospital osmotherapy with HSS in TBI patients with prehospital mydriasis was associated with a lower ICU mortality compared to osmotherapy with mannitol.

Chitin nanocrystals-stabilized emulsion as template for fabricating injectable suspension containing polylactide hollow microspheres

One of the promising applications of rod-like chitin nanocrystals (ChNCs) is the use as particle emulsifier to develop Pickering emulsions. We reported a ChNC-stabilized oil-in-water emulsion system, and developed a Pickering emulsion-templated method to prepare polylactide (PLA) hollow microspheres here. The results showed that both non-modified ChNCs and acetylated ChNCs could well emulsify the dichloromethane (DCM) solution of PLA-in-aqueous mannitol solution systems, forming very stable emulsions. At the same oil-to-water ratios and ChNC loadings, the emulsion stability was improved with increasing acetylation levels of ChNCs, accompanied by reduced size of droplets. Through the solvent evaporation, the PLA hollow microspheres were templated successfully, and the surface structure was also strongly dependent on the acetylation level of ChNCs. At a low level of acetylation, the single-hole or multi-hole surface structure formed, which was attributed to the out-diffusion of DCM caused by the solvent extraction and evaporation. These surface defects decreased with increased acetylation levels of ChNCs. Moreover, the aqueous suspension with as-obtained PLA microspheres revealed shear-thinning property and good biocompatibility, thereby had promising application as injectable fillers. This work can provide useful information around tuning surface structures of the Pickering emulsion-templated polymer hollow microspheres by regulating acetylation level of ChNCs.

Individualized small bowel preparation for computed tomography enterography: A prospective randomized controlled trial.

The study aims to evaluate the feasibility of body mass index (BMI)-based individualized small bowel preparation for computed tomography enterography (CTE). In this prospective randomized controlled study, patients undergoing CTE were randomly assigned to the individualized group or standardized group. Those in individualized group were given different volumes of mannitol solution based on BMI (1000mL for patients with BMI<18.5kg/m2, 1500mL for patients with 18.5kg/m2≤BMI<25kg/m2 and 2000mL for patients with BMI≥25kg/m2) while patients in the standardized group were all asked to consume 1500-mL mannitol solution. CTE images were reviewed by two experienced radiologists blindly. Each segment of the small bowel was assessed for small bowel image quality and disease detection rates. Patients were invited to record a diary regarding adverse events and acceptance. A total of 203 patients were enrolled and randomly divided into two groups. For patients with BMI<18.5kg/m2, 1000-mL mannitol solution permitted a significantly lower rate of flatulence (P=0.045) and defecating frequency (P=0.011) as well as higher acceptance score (P=0.015), but did not affect bowel image quality and diseases detection compared with conventional dosage. For patients with BMI≥25kg/m2, 2000-mL mannitol solution provided better overall image quality (P=0.033) but comparable rates of adverse events and patients' acceptance compared with conventional dosage. Individualized bowel preparation could achieve both satisfactory image quality and patients' acceptance thus might be an acceptable alternative in CTE.

Mannitol Reduces Pain and Trismus After Impacted Mandibular Third Molar Surgery

BackgroundThe removal of the lower third molar is a routine procedure in oral surgery , yet it often leads to postoperative side effects, particularly inflammation.Despite various interventions explored in prior studies, there is still a need for effective strategies, such as anti-inflammatory substances, to address postoperative side effects. PurposeThe purpose of this study is to answer the following clinical question: Does the local injection of 0.9M mannitol reduce postoperative pain, trismus, and swelling in patients undergoing bilateral symmetrically impacted mandibular third molar extraction? Study Design, Setting, SampleThis prospective, single-blind, split-mouth study at Hamadan Dental School involved 30 patients with bilateral symmetrically impacted mandibular third molars. Inclusion criteria were: no current medication, no anesthesia allergies, bilateral symmetrically impacted mandibular third molars, non-smokers, and the absence of systemic diseases. Exclusion criteria were: poor oral hygiene, alcohol/cigarette use, drug consumption, diabetes, systemic/gastrointestinal disorders, infection at the surgical site, lack of patient cooperation, and mannitol/anesthetic allergy. Predictor/Exposure/Independent VariableThe predictor variable was therapeutic injection, and it was grouped into two categories, 0.9M mannitol solution or distilled water. Main Outcome VariableThe primary outcome variable was pain. Secondary outcomes are trismus, swelling, patient satisfaction, and analgesic consumption CovariatesCovariates included demographic information and operative details. AnalysesStatistical analyses included repeated measures and paired t-tests with a significance level set at P < 0.05. ResultsThe study comprised 30 participants (mean age: 22.6 ± 3.59 years; 6 men, 24 women). In the test group, pain intensity significantly decreased from 5.30 on surgery day to 0.00, with subsequent values of 2.97, 1.30, 0.40, 0.17, and 0.03. The control group also decreased from 7.68 to 0.00, with values of 4.73, 2.67, 0.97, 0.23, and 0.07. The difference was statistically significant (p < 0.001). No significant swelling differences at T1, T3, T5, and T7 (p > 0.05). The intervention group had improved maximum mouth opening at T1, T3, T5, and T7 (p = 0.011) compared to the control group. Conclusion and RelevanceMannitol infiltration significantly reduces postoperative pain and trismus in impacted third molar surgery. This finding underscores the potential for improved patient comfort and recovery in this context.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Ionic Conductivity and Ion Association in Aqueous NaCl + Mannitol Solutions at Temperatures from 293.15 to 313.15 K

Ionic Conductivity and Ion Association in Aqueous NaCl + Mannitol Solutions at Temperatures from 293.15 to 313.15 K

Thermophysical investigation of glycol ethers in mannitol solutions at various temperatures

Ultrasonic analysis can be very helpful to comprehend the molecular dynamics and interactions in liquid systems. Employing the Anton-Paar (DSA 5000 M) at concentrations and 0.1 MPa, sound speed as well as density of glycol ethers, i.e., phenoxyethanol (PE) and butoxyethanol (BE) in solutions of a well-known sugar alcohol (D-mannitol) were measured at 288.15-303.15 K. A variety of advanced acoustic-thermodynamic parameters, including apparent molar parameters, partial molar parameters and transfer molar properties, were estimated using the experimentally attained the velocity and density values. These derived values are used to express the interactions between solutes and their solvents. The propensity of the solute to generate or destroy structures in a solvent is also a subject of research. Analysis was done on the interactions between the molecules in the ternary mixture of D-mannitol and glycol ethers in aqueous medium.

Inducing drought tolerance to rice variety CAU-R1 by the influence of seed priming

Experiments were conducted as pot experiment during the 2019 of kharif seasons to investigate the inducing drought tolerance to rice variety CAU-1 by seed priming at poly house of College of Agriculture, Central Agricultural University, Imphal. The experiment was laid out in Completely Randomized Design (CRD) with four replications and six treatments. Seeds were soaked in 1 % and 2 % solutions of KNO3 , CaCl2 , 40 ppm and 50 ppm of salicylic acid for 12 hours. Rice plants were induced to drought by applying mannitol solution (100 mM) at 10 days after emergence (DAE) of seedlings. The results revealed that seeds primed with 2 % KNO3 showed the lowest days to 50 % germination and mean emergence time, maximum number of seedling leave, seedling height, root length, and root biomass. The treatment of 2% KNO3 followed by 50 ppm salicylic acid were found to be superior among other treatments in most of the parameters.

Influenza A in children complicated by encephalitis - case study

Influenza is a seasonal disease that can cause annual outbreaks, especially during the cold periods of the year, in temperate areas. Symptomatology mainly involves the upper and lower respiratory tract, but varies greatly depending on the age and medical history of each person. In this paper we present a clinical case of influenza type A complicated with encephalitis in a female child aged 5 years and 6 months with a personal pathological history of neurological damage (Guillain-Barre syndrome). The diagnosis of influenza was established on the basis of symptoms (productive cough, rhinorrhea, marked physical asthenia, high fever) and confirmed by laboratory tests (rapid influenza antigen test and influenza RT PCR from nasopharyngeal secretions - positive). Neurological involvement was clinically supported by the occurrence of bradykinesia, bradypsy, broad-based gait, confirmed by neurological examination. The diagnosis of encephalitis was completed by analysis of cerebrospinal fluid (CSF) obtained by lumbar puncture in which influenza virus type A was identified and by electroencephalogram (EEG) showing altered tracing. Under antiviral (Oseltamivir), pathogenic (corticosteroid therapy), brain depleting (mannitol solution), non-specific human and symptomatic immunoglobulins treatments, the evolution was slowly favorable with remission of symptoms. The case presented argues that although influenza in immunocompetent children is generally a self-limiting and uncomplicated condition, it can evolve severely with the development of complications and after-effects and sometimes increased mortality especially in immunocompromised hosts.

DIFFERENTIATED HYPEROSMOLARY THERAPY IN CEREBRAL EDEMA IN PATIENTS WITH CRANIOCEREBRAL INJURY

to study the pathophysiological aspects of cerebral edema and compare the effectiveness of using 15% mannitol solution and hypertonic 3.5%, 7%, 10% sodium chloride solution in the complex treatment of patients with head injury. Material and methods:90 patients from 18 years old to 68 years old with various traumatic brain injuries and inhibition of consciousness level from 4 to 13 points on the Glasgow coma scale were examined. Results:infusion of mannitol at the indicated dosage reduced ICP after 30 minutes by 42, 3%, and after 120 minutes it remained below the initial data by 23.9%. Infusion of a 3.5% NaCl solution already by the 30th minute led to a decrease of ICP by 48.6%, and by the end of 120 minutes the ICP remained below the initial data by 35.9%. Infusion of a 7% NaCl solution already by the 30th minute led to a decrease in ICP by 55.4%, and by the end of 120 minutes the ICP remained below the initial data by 39.9%. Infusion of a 10% NaCl solution already by the 30th minute led to a decrease in ICP by 58.4%, and by the end of 120 minutes the ICP remained below the initial data by 45.9%. Conclusions:the decrease in ICP within 30 and 120 minutes after the introduction of hyperosmolar solutions is more pronounced with iv administration of 3.5%, 7%, 10% NaCl solution relative to 15% Mannitol in calculated dosages, which should be borne in mind in patients with concomitant cardiac and renal pathology.

Hemolysis by Saponin Is Accelerated at Hypertonic Conditions.

Saponins are a large group of organic amphiphilic substances (surfactants) mainly extracted from herbs with biological activity, considered as one of the main ingredients in numerous remedies used in traditional medicine since ancient times. Anti-inflammatory, antifungal, antibacterial, antiviral, antiparasitic, antitumor, antioxidant and many other properties have been confirmed for some. There is increasing interest in the elucidation of the mechanisms behind the effects of saponins on different cell types at the molecular level. In this regard, erythrocytes are a very welcome model, having very simple structures with no organelles. They react to changing external conditions and substances by changing shape or volume, with damage to their membrane ultimately leading to hemolysis. Hemolysis can be followed spectrophotometrically and provides valuable information about the type and extent of membrane damage. We investigated hemolysis of erythrocytes induced by various saponin concentrations in hypotonic, isotonic and hypertonic media using measurements of real time and end-point hemolysis. The osmotic pressure was adjusted by different concentrations of NaCl, manitol or a NaCl/manitol mixture. Unexpectedly, at a fixed saponin concentration, hemolysis was accelerated at hypertonic conditions, but was much faster in NaCl compared to mannitol solutions at the same osmotic pressure. These findings confirm the colloid-osmotic mechanism behind saponin hemolysis with pore formation with increasing size in the membrane.

Diagnosis and Treatment of Severe Traumatic Brain Injury in Idiopathic Intracranial Hypertension Syndrome

A topic of current research is the development of a new approach to the diagnosis and treatment of severe brain injury taking into consideration its main pathophysiological mechanism-idiopathic intracranial hypertension syndrome. The goal of this study was to identify Doppler patterns of unfavorable craniocerebral injury conditions to form a consistent algorithm of treatment measures to reduce secondary brain damage in patients with severe craniocerebral trauma. Transcranial Doppler imaging is a prospective method, which allows quick and noninvasive assessment of the intracerebral blood flow dynamics right at the patient's bedside. Due to the operator-dependent nature of this method, clinical interpretation can often be contradictory. As a result, no clear criteria for therapy correction have yet been formulated based on this neuroimaging method. Analysis of the therapy performed allowed us to specify the options for the hyperosmolar solutions for the correction of idiopathic intracranial hypertension syndrome. No statistically significant difference in effectiveness was shown between mannitol and hypertonic saline solutions.

Abstract P124: Piezo1 Mediates Vasodilation Induced By Acute Hyperglycemia In Mouse Renal Arteries And Microvessels

Background: Acute hyperglycemia (HG) is a risk factor for developing acute kidney injury and poor renal outcome in critically ill patients. The role of renal vasculature in this context is not clear. We hypothesize that HG-associated hyperosmolarity facilitates vasodilation through Piezo1-mediated eNOS activation. Methods: Vasoreactivity of isolated mouse mesenteric (MA) and renal interlobar (ILA) arteries were analyzed using wire myography and that of renal afferent (AA) and efferent (EA) arterioles, and vasa recta (VR) using microvascular perfusion. Immunofluorescence and western blot were used for molecular analyses of isolated mouse blood vessels as well HUVECs. Results: Pre-treatment with HG (44 mmol L -1 glucose; 4 h) increased acetylcholine (ACh)-induced relaxation in ILA and MA, which was prevented by eNOS inhibition using L-NAME. Hyperosmotic mannitol solution had a similar effect. HG induced an immediate, L-NAME-inhibitable dilation in AA, EA, and VR, whereby stronger dilation in AA compared to EA. HG also increased glomerular filtration rate in mice. In HUVECs, HG and the Piezo1 activator Yoda1 increased levels of Piezo1 protein, phosphorylated CaMKII (p-CaMKII), Akt, and p-eNOS. The HG-effect could be prevented by inhibiting Piezo1 using GsMTx4 and CaMKII using KN93. Furthermore, in arteries and microvessels, inhibition of Piezo1 using GsMTx4 prevented the HG-effect, while Yoda1 caused relaxation and dilation, respectively. Conclusion: Results reveal that Piezo1 mediates renal vasodilation induced by hyperosmolarity in acute HG. This mechanism may contribute to the pathogenesis of renal damage by acute HG.

Assessment of Hyperosmolar Blood-Brain Barrier Opening in Glioblastoma via Histology with Evans Blue and DCE-MRI.

While the blood-brain barrier (BBB) is often compromised in glioblastoma (GB), the perfusion and consequent delivery of drugs are highly heterogeneous. Moreover, the accessibility of drugs is largely impaired in the margins of the tumor and for infiltrating cells at the origin of tumor recurrence. In this work, we evaluate the value of methods to assess hemodynamic changes induced by a hyperosmolar shock in the core and the margins of a tumor in a GB model. Osmotic shock was induced with an intracarotid infusion of a hypertonic solution of mannitol in mice grafted with U87-MG cells. The distribution of fluorescent dye (Evans blue) within the brain was assessed via histology. Dynamic contrast-enhanced (DCE)-MRI with an injection of Gadolinium-DOTA as the contrast agent was also used to evaluate the effect on hemodynamic parameters and the diffusion of the contrast agent outside of the tumor area. The histological study revealed that the fluorescent dye diffused much more largely outside of the tumor area after osmotic shock than in control tumors. However, the study of tumor hemodynamic parameters via DCE-MRI did not reveal any change in the permeability of the BBB, whatever the studied MRI parameter. The use of hypertonic mannitol infusion seems to be a promising method to increase the delivery of compounds in the margins of GB. Nevertheless, the DCE-MRI analysis method using gadolinium-DOTA as a contrast agent seems of limited value for determining the efficacy of opening the BBB in GB after osmotic shock.