Manatee County Research Articles

Diversification of West Nile virus in a subtropical region

BackgroundWest Nile virus (WNV) has spread across North, Central, and South America since its introduction in 1999. At the start of this spread, Florida was considered a potentially important area with regards to transmission due to its geographic, climatological, and demographic conditions. Curiously, the anticipated high levels of transmission or disease outbreaks have not been observed. As other studies have predicted that the lack of intense WNV transmission is not due to vector incompetence, we sought to evaluate the role of viral strain diversity in WNV transmission in Florida. Therefore, a phylogentic analysis was carried out on several isolates collected from three distinct locations in Florida.ResultsContrasting with a positive control collected in Indian River County, Florida during 2003 that contains the original NY99 genotype with valanine at amino acid 159 of the envelope region, all of the isolates collected in 2005 contain the WN02 genotype composed of a substation with alanine at that position indicating the window of introduction of the WN02 genotype occurred between 2003 and 2005. From the eight isolates collected in Duval, Indian River, and Manatee Counties; there is also a silent nucleotide substitution that differentiates the isolates collected on the Atlantic side of the state compared to the isolate collected on the Gulf side, which groups closer to isolates from other locations near the Gulf.ConclusionAs a whole, the Florida isolates contained numerous variable nucleotide and amino acid sites from the reference sequences, as well as each other; indicating greater nucleotide diversity within the Florida 2005 isolates than within other regions. Finally, a series of three amino acid substitutions surrounding a set of histidines located in the envelope coding region that hypothesized to play a role in conformational changes was found in the isolate collected in Indian River County, perhaps changing the antigenicity of the homodimer. Taken together, these findings expand our understanding of the temporal and spatial compartmentalization of West Nile virus subtypes within North America.

First Report of Cucurbit yellow stunting disorder virus in Cucurbits in Florida.

In August and September 2007, watermelon plants (Citrullus lanatus L.) in commercial fields in Manatee and Hillsborough counties in Florida exhibited stunting, deformation, interveinal chlorosis, and leaf mottling. Adult and immature whiteflies (Bemisia tabaci biotype B) were observed. Leaf samples were collected from seven watermelon and two squash plants showing different combinations of symptoms. Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR for the presence of criniviruses using primers specific to regions of the Cucurbit yellow stunting disorder virus (CYSDV) genome encoding the coat protein (CysCP5206F 5' TTTGGAAAAGAACCTGACGAG 3'; CysCP5600R 5' TTCATCAACAGATTGGCTGC 3') and HSP70h genes (2). Total nucleic acids were extracted using Gentra Puregene Kit (Qiagen) and subjected to PCR for the presence of begomoviruses using the degenerate primer pairs AC1048 and AV494, designed to amplify a region of the begomovirus coat protein gene (4), and PBL1v2040 and PCRc154, designed to amplify a region of the hypervariable region of the begomovirus B component (3). RT-PCR amplified the expected 394-bp fragment of the coat protein gene from three symptomatic plants (one squash, two watermelon) and from CYSDV-infected control plants but not from healthy controls. Similarly, the 175-bp HSP70h fragment was amplified from the same samples and from CYSDV-infected control plants but not from healthy controls. The coat protein amplicon was sequenced from one of the Manatee County isolates (GenBank Accession No. EU596528) and the 344 nt sequenced portion of the amplicon was found to be 100% identical to sequences of CYSDV from Texas, California, Jordan, and France (GenBank Accession Nos. AF312823, EU596529, DQ903107, and AY204220, respectively) and shared 99% identity with an isolate from Spain (GenBank Accession No. NC_004810), but only 91% with an isolate from Iran (GenBank Accession No. AY730779). The begomovirus primer pair pBL1v2040 and PCRc154 produced a 678-bp amplicon that is consistent with the presence of a bipartite begomovirus in all nine samples. Sequence analysis of four of the 678-bp amplicons revealed that all had greater than 97% sequence identity to isolates of Cucurbit leaf crumple virus (CuLCrV) from Arizona (GenBank Accession No. AF327559) and California (GenBank Accession No. AF224761). These results are similar to those reported in the first detection of CuLCrV in Florida in 2006 (1). In October 2007, CYSDV was detected in squash plants (Cucurbita pepo L.) in two additional fields in Manatee and Hillsborough counties, and additional fields with CYSDV-like symptoms have been observed with increasing frequency throughout the region. The appearance of CYSDV in Florida follows the recent emergence of CYSDV in California and Arizona and Sonora, Mexico in 2006 where the CYSDV infection of fall melons resulted in severe economic losses (2). The emergence of CYSDV in Florida, where the vector B. tabaci biotype B is well established, warrants concern for all cucurbit production in the southern United States. Disease monitoring efforts are in progress to determine the extent, severity, and impact of CYSDV on Florida cucurbit production.

Florida red tide and human health: A pilot beach conditions reporting system to minimize human exposure

With over 50% of the US population living in coastal counties, the ocean and coastal environments have substantial impacts on coastal communities. While many of the impacts are positive, such as tourism and recreation opportunities, there are also negative impacts, such as exposure to harmful algal blooms (HABs) and water borne pathogens. Recent advances in environmental monitoring and weather prediction may allow us to forecast these potential adverse effects and thus mitigate the negative impact from coastal environmental threats. One example of the need to mitigate adverse environmental impacts occurs on Florida's west coast, which experiences annual blooms, or periods of exuberant growth, of the toxic dinoflagellate, Karenia brevis. K. brevis produces a suite of potent neurotoxins called brevetoxins. Wind and wave action can break up the cells, releasing toxin that can then become part of the marine aerosol or sea spray. Brevetoxins in the aerosol cause respiratory irritation in people who inhale it. In addition, asthmatics who inhale the toxins report increase upper and lower airway symptoms and experience measurable changes in pulmonary function. Real-time reporting of the presence or absence of these toxic aerosols will allow asthmatics and local coastal residents to make informed decisions about their personal exposures, thus adding to their quality of life. A system to protect public health that combines information collected by an Integrated Ocean Observing System (IOOS) has been designed and implemented in Sarasota and Manatee Counties, Florida. This system is based on real-time reports from lifeguards at the eight public beaches. The lifeguards provide periodic subjective reports of the amount of dead fish on the beach, apparent level of respiratory irritation among beach-goers, water color, wind direction, surf condition, and the beach warning flag they are flying. A key component in the design of the observing system was an easy reporting pathway for the lifeguards to minimize the amount of time away from their primary duties. Specifically, we provided a Personal Digital Assistant for each of the eight beaches. The portable unit allows the lifeguards to report from their guard tower. The data are transferred via wireless Internet to a website hosted on the Mote Marine Laboratory Sarasota Operations of the Coastal Ocean Observation Laboratories (SO COOL) server. The system has proven to be robust and well received by the public. The system has reported variability from beach to beach and has provided vital information to users to minimize their exposure to toxic marine aerosols.

Arbovirus Transmission by Culex nigripalpus in Florida, 2005

Understanding the transmission patterns of West Nile and St. Louis encephalitis viruses (family Flaviviridae, genus Flavivirus, WNV and SLEV) could result in an increased ability to predict transmission risk to humans. To examine transmission patterns between vector and host, we trapped mosquitoes in three Florida counties from June to November 2005 by using chicken-baited lard can mosquito traps. These traps were used to monitor for presence of WNV and SLEV in mosquitoes and subsequent transmission of these viruses to chickens. In total, 166,615 female mosquitoes were sorted into 4,009 pools based on species and bloodfed status, and they were tested for presence of WNV and SLEV. Sera from 209 chickens were tested for WNV and SLEV antibodies. We detected eight WNV-positive Culex nigripalpus Theobald mosquito pools; SLEV was not detected in any pools. Six positive pools were collected in August and September from Duval County, one pool in September from Manatee County, and one pool in November from Indian River County. Of the eight chickens potentially exposed to WNV, antibodies were detected in only one chicken, indicating a low rate of transmission relative to the observed mosquito infection rates. Low virus transmission rates relative to infection rates would suggest that using sentinel chicken seroconversion data as a means of arbovirus surveillance may underestimate the prevalence of WNV in the mosquito population. However, using mosquito infection rates may overestimate the risk of arboviral transmission. A variety of factors might account for the observed low level of transmission including a lack of viral dissemination in mosquito vectors.

Arbovirus transmission by Culex nigripalpus in Florida, 2005.

Understanding the transmission patterns of West Nile and St. Louis encephalitis viruses (family Flaviviridae, genus Flavivirus, WNV and SLEV) could result in an increased ability to predict transmission risk to humans. To examine transmission patterns between vector and host, we trapped mosquitoes in three Florida counties from June to November 2005 by using chicken-baited lard can mosquito traps. These traps were used to monitor for presence of WNV and SLEV in mosquitoes and subsequent transmission of these viruses to chickens. In total, 166,615 female mosquitoes were sorted into 4,009 pools based on species and bloodfed status, and they were tested for presence of WNV and SLEV. Sera from 209 chickens were tested for WNV and SLEV antibodies. We detected eight WNV-positive Culex nigripalpus Theobald mosquito pools; SLEV was not detected in any pools. Six positive pools were collected in August and September from Duval County, one pool in September from Manatee County, and one pool in November from Indian River County. Of the eight chickens potentially exposed to WNV, antibodies were detected in only one chicken, indicating a low rate of transmission relative to the observed mosquito infection rates. Low virus transmission rates relative to infection rates would suggest that using sentinel chicken seroconversion data as a means of arbovirus surveillance may underestimate the prevalence of WNV in the mosquito population. However, using mosquito infection rates may overestimate the risk of arboviral transmission. A variety of factors might account for the observed low level of transmission including a lack of viral dissemination in mosquito vectors.

Long-Term Surveillance Data and Patterns of Invasion by Aedes albopictus in Florida

We used geographic information system (GIS) and long-term mosquito surveillance data from Lake, Pasco, Manatee, and Sarasota Counties, FL, to look at patterns of invasion by Aedes albopictus and concurrent changes in resident Ae. aegypti. We investigated environmental factors associated with population changes in these species with the use of satellite climate data. Aedes aegypti densities attenuated rapidly following the arrival of Ae. albopictus in most counties, yet both species persisted in equilibrium in Manatee County. We discuss the relative importance of rainfall, habitat, and proximity to urban areas in the population dynamics of these species in sympatry.

Gladiolus Rust Caused by Uromyces transversalis Makes First Nearctic Appearance in Florida.

The most serious rust pathogen of gladiolus (Gladiolus × hortulanus), Uromyces transversalis, has been listed as an exotic pathogen of concern for the United States for more than 80 years (4). Native to South Africa, the pathogen was reported in the Western Hemisphere for the first time in Brazil (2) and Argentina (1). Reports of gladiolus rust in several central Mexican states from 2004 to 2005 (3; http://www.pestalert.org/espanol/oprDetail.cfm?oprID=138 ) and interceptions at Mexican border stations and in Brazilian imports in 2005 at the port of Miami, FL collectively raised the alert level in the United States to high. In April 2006, the Hawaii Department of Agriculture notified the USDA of rust-infected gladiolus in a cut-flower shipment that was traced back to a 1,400-acre (565 ha) farm in Manatee County, FL. Inspection at the farm yielded samples that were quickly confirmed as U. transversalis by FDACS-DPI and USDA plant pathologists. The disease was identified in eight residential gardens near the commercial find and in another 700-acre (285 ha) farm in remote Hendry County, 100 miles to the southeast. In May 2006, gladiolus rust was detected in residential and commercial gladiolus in San Diego County, CA (see companion publication). On the advice of a USDA-assembled panel of experts, strict rust management guidelines and fallow host-free periods were implemented with the ultimate goal of eradication. Subsequent summer, fall, and now winter surveys in the infested commercial and residential areas have uncovered diminishing amounts of rust, with last traces detected on 9 September 2006. Commercial planting resumed at both farms in late summer, and crops remained rust free under weekly inspection until 15 February 2007 in Manatee County and 29 March 2007 in Hendry County. To insure a rust-free product, cut flowers are carefully inspected and foliage stripped at the packinghouse. Eradication will be attempted once more with a fallow host-free period before the 2007 season. U. transversalis is an autoecious rust that mainly infects Gladiolus spp., but has been known to infect other members of the Iridaceae: Anomatheca, Crocosmia, Melasphaerula, Tritonia, and Watsonia. Amphigenous uredinia form in transverse lines across gladiolus foliage and also on flower spikes under heavy disease pressure. The isolate present in Florida fits the literature description of U. transversalis in every respect (uredinia 0.5 to 1.5 mm in diameter, subglobose to ellipsoid verruculose yellow-amber urediniospores, 15 to 28 × 14 to 20 μm with wall 1.5 to 2.5 μm thick; telia also amphigenous, 0.5 to 1.3 μm in diameter, dark brown-black, subglobose to pyriform smooth amber teliospores, 20 to 30 × 15 to 20 μm with wall 1.5 to 2.0 μm thick, 4 to 6 μm thick at apex, pale brown to hyaline pedicel 30 to 40 μm long, yellow-brown paraphyses in pustule) ( http://nt.ars-grin.gov/fungaldatabases/new_allView.cfm?whichone=all&thisName=Uro myces%20transversalis&organismtype=Fungus ). Urediniospores initiated typical foliar lesions on transplanted gladiolus samples kept in the FDACS-DPI quarantine greenhouse during the diagnostic process.

Silvopasture for reducing phosphorus loss from subtropical sandy soils

Phosphorus (P) losses from sandy soils that are predominant in the 1.4 million ha of pastureland in Florida are a major cause of water pollution. We hypothesized that soil P loss would be lower from silvopastoral systems than from treeless pastures because soil P removal by a combined stand of trees and pasture would be more than that of treeless pasture. Four slash pine (Pinus elliottii Engelm.) + bahiagrass (Paspalum notatum Flugge) silvopastoral systems located in Alachua, Suwannee, Manatee, and Osceola counties in Florida were selected for the study. The former two sites are on Ultisols, and the latter two on Spodosols. Soil samples were collected at different depth increments. Soil P storage capacity (SPSC), the maximum amount of P that can be safely applied to a soil before it becomes an environmental concern, was calculated. Water-soluble P concentrations in the 0–5 cm soil layer ranged from 4 to 11 mg kg−1 for the silvopasture sites and 10 to 23 mg kg−1 in the treeless pasture sites, with higher P concentrations in the treeless pasture at each location. Total SPSC in the upper 1 m depth ranged from 342 to 657 kg ha−1 in the silvopasture sites and −60 to 926 kg ha−1 in the treeless pasture sites (a negative value indicates that the soil is a P source). The results suggest that P buildup within the soil profile and therefore the chances for loss of P from soil to water bodies were less from silvopastures than from treeless pastures. Thus, silvopasture systems can be expected to provide greater environmental service in regard to water quality protection compared to treeless pastures under comparable ecological settings

Florida Grasshopper Sparrow Distribution, Abundance, and Habitat Availability

Remote sensing, geographical information system applications, and ground and aerial assessments revealed a fragmented distribution of 44,933 ha of potential habitat for the endangered Ammodramus savannarum floridanus (Florida Grasshopper Sparrow) with most of this habitat (30,262 ha, 67%) located on conser- vation lands. A continued decrease in available habitat since 1996 was indicated. Searches of potential habitat and information from surveys at known locations found 278 male Florida Grasshopper Sparrows at seven sub-populations during 2004. No previously unknown breeding aggregations were found. The current distribution evinces a considerable contraction in range compared to historic distribution; how- ever, other breeding aggregations may exist on private property (10,718 ha) where access was denied. Three formerly large sub-populations on Avon Park Air Force Range have declined and are now near extirpation. The low number of individuals and the paucity and fragmented distribution of suitable dry prairie will be limiting factors for recovery of this sedentary subspecies. Habitat expansion and manage- ment, and demographic improvements at existing locations may restore some Florida Grasshopper Sparrow sub-populations. Large areas (> 377 ha) of protected potential habitat in Manatee, DeSoto, and Glades counties offer the best opportunities for the establishment of additional sub-populations (> 50 pairs) to achieve recovery goals. The cooperative effort of public land managers from various agencies and of private landowners will be needed to prevent the extinction of this bird.

Anaerobic Digester Hydrogen Sulfide Removal at the Manatee County, FL Southwest Water Reclamation Facility

Anaerobic Digester Hydrogen Sulfide Removal at the Manatee County, FL Southwest Water Reclamation Facility

Alternanthera mosaic virus Found in Scutellaria, Crossandra, and Portulaca spp. in Florida.

In the fall of 1998, the Division of Plant Industry (DPI) received vegetative propagations of Scutellaria longifolia (skullcap) with symptoms of foliar mosaic, chlorotic/necrotic ringspots, and wavy line patterns from a nursery in Manatee County. Flexuous particles approximately 500 nm long were found with electron microscopy. The plants tested positive for Papaya mosaic virus (PaMV) in an enzyme-linked immunosorbent assay (ELISA) test with antiserum to PaMV (Agdia, Elkhart, IN). However, in immunodiffusion tests (antiserum from D. Purcifull, University of Florida), this virus gave a reaction of partial identity indicating it was related but not identical to PaMV (1). The original infected plants were kept in a greenhouse. In January 2005, a specimen of Crossandra infundibuliformis (firecracker plant) with mosaic symptoms was submitted to the DPI from a nursery in Alachua County. Inclusions found with light microscopy and particles found with electron microscopy indicated that this plant was infected with a potexvirus. This was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) with primers designed to detect members of the virus family Potexviridae (3). These plants reacted positive to PaMV antiserum in ELISA and gave a reaction of partial identity to PaMV in immunodiffusion. A specimen of Portulaca grandiflora (moss rose) with distorted leaves found at a local retail store was also tested and gave the same results. Leaves from each of the three plant species were rubbed onto a set of indicator plants using Carborundum and potassium phosphate buffer. Total RNA was extracted from symptomatic indicator plants of Nicotiana benthamiana. RT-PCR (3) was performed, and PCR products were sequenced directly. Sequences of approximately 700 bp were obtained for all three plant species and showed 98% identity with each other. BLAST search results showed that these sequences were 93% identical to an Alternanthera mosaic virus (AltMV) sequence at the nucleotide level but only 76% identical to PaMV. The amino acid sequences were 98 and 82% identical to AltMV and PaMV, respectively. The PCR products of the virus from Scutellaria sp. were cloned, resequenced, and the sequence was entered into the GenBank (Accession No. DQ393785). The bioassay results matched those found for AltMV in Australia (2) and the northeastern United States (4), except that the Florida viruses infected Datura stramonium and Digitalis purpurea (foxglove). The virus associated with the symptoms of these three plants appears to be AltMV and not PaMV. AltMV has been found in ornamental plants in Australia, Italy, and the United States (Pennsylvania, Maryland, and now Florida). Since this virus is known to infect several plants asymptomatically and can be easily confused with PaMV serologically, it is likely that the distribution of this virus is much wider than is known at this time.

Survey of Container Nursery Irrigation Practices in West-central Florida: An Educational Opportunity

A survey was conducted of nursery operators participating in workshops in west-central Florida. The purpose of the survey was to identify the irrigation best management practices (BMPs) adopted by container nurseries in west-central Florida and obtain information regarding emphasis of future extension educational programs. Workshops were conducted in Hillsborough County, Fla., and Manatee County, Fla., and participation was voluntary. Respondents were asked about BMPs used in the nurseries according to the irrigation system used and it was found that the majority of the nurseries relied on well water as the primary source for irrigation. While 69% of the nurseries monitored uniformity of microirrigation systems, only 35% monitored uniformity of overhead irrigation systems. Thirty-four percent of the nurseries collected irrigation or rain runoff and 9% knew the water holding capacity of their substrate. Most of the nurseries grouped plants by irrigation requirements (74%) and grouped container sizes by irrigation requirements (69%). The survey indicates that many BMPs are not widely adopted by nurseries in west-central Florida. The information from this survey can be used as a guide to focus the efforts of university extension educational programs to achieve greater adoption of BMPs.

Unusual Career Opportunities

CAREER counseling can have its interesting moments. Take the outside career consultant who was asked recently by some astute middle school students about one of the top money-making professions on his list. He explained the nature of the work and the possibility of making a six- figure annual income. The principal and parents, however, were not pleased. It happened that the career the expert discussed with the students was exotic dancing. I would like to suggest another off-beat career path not often mentioned as a lifelong occupation, one that's certainly not as high paying as the consultant's option, but one in which talents would be just as appreciated. Most important, it already is an accepted part of school life in many places. (Okay, some would say generally accepted teenage dancing borders on the exotic these days.) That career is service. Students often participate in service programs or service learning because it looks good on college applications or is a natural outcome of their church or club activities. If they stumble into careers of service later, it is usually an afterthought, not part of a planned path. Considering the social, environmental, and economic equity issues that today's students will be responsible for handling, it is time now to move beyond the volunteer possibilities of the service field and get specific about the career possibilities. Let me give an example going on right now that makes this point. About 10 years ago, a 12-year-old in Manatee County, Florida, brought together a few friends, ostensibly to find projects to fulfill the school's service requirement. They chose helping seniors to live independently, and so the students started with doing lawn mowing and small jobs around the homes of the elderly. A Learn and Serve grant from the Corporation for National and Community Service expanded their fledgling ManaTEENs group. Today, about 10,000 young people in southwestern Florida help out seniors in many ways. They senior-proof homes, remove environmental hazards, and involve their families in adopting a grandparent for whom they provide transportation and companionship. When the teens found out that almost 20% of seniors were sharing their meals with pets because they could not afford pet food, they started monthly collections of food, which they also deliver. In the last two years, these students have helped 37,000 seniors to live independently. What's most important, at least 60 of the former student volunteers, including the youngster who started the whole thing, are now committed to service as a career. They have come back as adults enrolled in AmeriCorps*VISTA. This was one of the examples of pathways to service careers discussed at a series of forums sponsored by Innovations in Civic Participation (ICP). This is a nonprofit organization founded by Susan Stroud, the first staff director of the Corporation for National and Community Service. ICP focuses on promoting civic engagement through service. In addition to helping find ways for seniors to live independently, the ICP forums also linked opportunities for national service with youth development in out-of-school time and with rural development. The service and social service leaders who participated drew up recommendations for policy makers, and each group, meeting separately, came to the conclusion that much greater efforts must be made early, no later than the high school years, to use service learning as a trigger for raising the interest of young people in service as a career. Apparently, voluntary service offers a good way into careers in service. More than 200,000 alumni of national service programs are now employed in a youth-related field. …

Minimizing the impact of the mosquito adulticide naled on honey bees, Apis mellifera (Hymenoptera: Apidae): aerial ultra-low-volume application using a high-pressure nozzle system.

The impact of the mosquito adulticide naled on honey bees, Apis mellifera L., was evaluated by exposing test beehives to nighttime aerial ultra-low-volume (ULV) applications using a high-pressure nozzle system. The tests were conducted during routine mosquito control missions at Manatee County, Florida, in summer 2000. Two treatment sites were sprayed a total of four times over a 10-wk period. Honey bees, which clustered outside of the hive entrances, were subjected to naled exposure during these mosquito control sprays. The highest average naled ground deposition was 2,688 microg/m2 at the Port Manatee site, which resulted in statistically significant bee mortality (118) compared with the controls. At the Terra Ceia Road site, an intermediate level of naled deposition was found (1,435 microg/m2). For this spray mission, the range of dead bees per hive at Terra Ceia was 2 to 9 before spraying and 5 to 36 after naled application. Means of all other naled ground depositions were < 850 microl/m2. We concluded that substantial bee mortality (> 100 dead bees) resulted when naled residue levels were > 2,000 kg/m2 and honey bees were clustered outside of the hive entrances during mosquito adulticide applications. Compared with the flat-fan nozzle systems currently used by most of Florida's mosquito control programs, the high-pressure nozzle system used in this experiment substantially reduced environmental insecticide contamination and lead to decreased bee mortality. Statistical analysis also showed that average honey yield at the end of the season was not significantly reduced for those hives that were exposed to the insecticide.

The Probable Center of Origin of Fusarium oxysporum f. sp. lycopersici VCG 0033.

Isolates of the tomato wilt pathogen Fusarium oxysporum f. sp. lycopersici, predominantly from commercial tomato fields in Florida and southwestern Georgia, were characterized using vegetative compatibility grouping (VCG), nuclear restriction fragment length polymorphism (RFLP), and virulence. All field isolates that could be grouped into VCG belonged to VCG 0033. This VCG was first described by Marlatt et al. in 1996 for isolates from northern Florida, Arkansas, and North Carolina. This study demonstrates that VCG 0033 is also widespread in central and southern Florida, in addition to southwestern Georgia, and also was found to be present in Puerto Rico. Population genetic and phylogenetic analyses of 121 isolates indicated that molecular diversity among VCG 0033 isolates was by far the highest in Manatee County, FL, suggesting it to be the probable center of origin of this relatively newly described VCG. Virulence tests with a subset of isolates identified all VCG 0033 isolates as race 3, although differences in aggressiveness were observed among tested isolates, independent of resistance genes in the differential cultivars. The widespread VCG 0030 of F. oxysporum f. sp. lycopersici was not present in our field collections. This was unexpected, as strains from Florida isolated prior to 1990 were predominantly VCG 0030. This would suggest that VCG 0033 has replaced VCG 0030 in recent years in commercial tomato fields of Florida and southwestern Georgia.

Impact of naled on honey bee Apis mellifera L. survival and productivity: aerial ULV application using a flat-fan nozzle system.

A study was conducted to evaluate the impact of naled on honey bees as a result of their exposure to aerial ULV applications of this insecticide during three routine mosquito spray missions by Manatee County Mosquito Control District in Florida during the summer of 1999. Naled deposits were collected on filter paper and subsequently analyzed by gas chromatography. Mortality of adult honey bees Apis mellifera L. was estimated based on numbers from dead bee collectors placed in front of the entrance of the beehives. We found that honey bees clustering outside of the beehives were subject to naled exposure. Bee mortality increased when higher naled residues were found around the hives. The highest average naled deposit was 6,227 +/- 696 microg/m2 at the site 1 forest area following the mosquito spray mission on July 15, 1999. The range of naled deposition for this application was 2,818-7,101 microg/m2. The range of dead bees per hive was 0-39 prior to spraying and 9-200 within 24 h following this spray mission. The average yield of honey per hive was significantly lower (p < 0.05) for naled-exposed hives compared with unexposed hives. Because reduction of honey yield also may be affected by other factors, such as location of the hives relative to a food source and vigor of the queen bee, the final assessment of honey yield was complicated.

SURVEY OF PEST MOLE CRICKETS (ORTHOPTERA: GRYLLOTALPIDAE) ACTIVITY ON PASTURE IN SOUTH-CENTRAL FLORIDA

Histories of pest mole cricket activity (Scapteriscus spp. Scudder) (Orthoptera: Gryllotalpidae) on bahiagrass (Paspalum notatum Fluegge) pastures were needed to provide baseline data for evaluating on-going biological control with Steinernema scapterisci (Nguyen and Smart) nematodes. Seven ∼4-ha pastures were selected from five county sites for the survey. These consisted of one mole cricket-infested bahiagrass pasture each from two ranches in Polk county and from one ranch each in Manatee and Pasco counties. The rest were two renovated and uninfested pastures located at the Range Cattle Research and Education Center, Ona, in Hardee county and a third in Desoto county. Six linear pitfall traps (each 12.2 m total) were installed on equal subdivisions (0.67 ha) of each of the seven pastures in July 1997 and labeled 1 to 6 at each site according to a visually-determined decreasing slope of terrain. Traps were cleaned weekly from the time of installation through December 1999, and the total weekly-captures per trap of tawny, S. vicinus (Scudder) and southern, S. borellii, (Giglio-Tos) mole crickets were recorded along with weekly rainfall for each site. The mean, weekly mole cricket capture on heavily-infested bahiagrass pastures increased exponentially over time beginning with the early summer rains. Mean weekly-count on these pastures peaked at 20-60 juveniles per trap, depending on site, in June-July and then declined sharply through September and October as mole crickets matured. The annual mean weekly-capture on heavily-infested pastures was 10 to 12 juveniles per trap. There was very little surface activity by overwintering adult mole crickets during December and January. Mean weekly-capture on uninfested new bahiagrass pasture was erratic and usually less than 2 juveniles per trap. The data suggest that peak weekly mole cricket pitfall trap captures between June and August in excess of 20 juveniles per trap and a total seasonal capture in excess of 43 m-1 of trap were indicative of a serious infestation problem.

Confirmation and Control of a Paraquat-Tolerant Goosegrass (Eleusine indica) Biotype1

Diminished control of goosegrass was observed in tomato fields located in Manatee County, FL, after years of repeated paraquat use. Tolerance of the Manatee biotype to paraquat was confirmed by its comparison in greenhouse studies with a susceptible biotype from the Alachua County, FL. A 30-fold increase in paraquat rate was required to reach the 50% growth reduction level of the resistant biotype over the susceptible biotype. The Manatee biotype was not tolerant to clethodim, metribuzin, or sethoxydim. These herbicides provided adequate control of all the goosegrass biotypes tested.Nomenclature: Clethodim; metribuzin; paraquat; sethoxydim; goosegrass, Eleusine indica L. #3 ELEIN; tomato, Lycopersicou esculentum Mill.Additional index words: Additive, antagonism, herbicide resistance, synergism.Abbreviations: GR50, herbicide concentration required to inhibit goosegrass aboveground biomass by 50%; WAT, weeks after treatment.

Rhynchospora megaplumosa(Cyperaceae), a New Species from Central Florida, with Supplemental Notes and a Key toRhynchosporaSeriesPlumosae

Rhynchospora megaplumosa is described as a new species of Rhynchospora, endemic to central Florida, in the section Rhynchospora series Plumosae. It is restricted to sandy openings in scrubby flatwoods in two localized areas of central Florida, in Polk and Manatee counties, where it flowers profusely in areas following burning. Rhynchospora megaplumosa is most closely related to R. pineticola and R. plumosa, but is distinguished by several characters, most conspicuously by its longer (5–7 mm) perianth bristles and golden-brown, narrowly lanceolate, longer spikelets. A key is provided to distinguish it from other species in the series. The habitat and associated species of R. megaplumosa, are also discussed.

First Report of Race 3 of Fusarium oxysporum f. sp. lycopersici in Southeastern Florida.

Race 3 of Fusarium oxysporum f. sp. lycopersici, cause of Fusarium wilt of tomato, Lycopersicon esculentum, was first recognized in Florida in 1982 on the west coast (Hillsborough and Manatee counties) (2). Approximately 10 years later, race 3 was reported in northeastern production areas of the state (Gadsden County) (1) and was observed on the east coast (Ft. Pierce area) (D. O. Chellemi, personal communication). During the 1998 to 1999 season, mature plants of Sanibel, a commercial tomato cultivar with resistance to races 1 and 2, were observed with symptoms of Fusarium wilt at the University of Florida's Tropical Research and Education Center in Homestead. Approximately 20% of the plants were conspicuously wilted, chlorotic, and necrotic in all or unilateral portions of the canopy. Internal, vascular discoloration in affected plants extended far into the canopy, distinguishing the disease from Fusarium crown rot, caused by F. oxysporum f. sp. radicis-lycopersici. Pure colonies of fungi were isolated from surface-disinfested (10 s with 70% ethanol, 2 min with 10% bleach) stem segments on potato dextrose agar (PDA) amended with streptomycin (100 mg/liter), rifamycin (50 mg/liter), and a commercial miticide (Danitol 2EHC [4 drops/liter]). Isolates were identified as F. oxysporum due to their production of typical falcate macroconidia with foot-shaped basal cells, microconidia borne in false heads only on mono-phialides, and chlamydospores. In replicated (three) greenhouse trials, six single-spore isolates were used to root-dip inoculate (107 conidia per ml) seedlings of differential tomato cultivars (Bonnie Best, no resistance; Manapal, race 1 resistance; Walter, race 1 and race 2 resistance). All isolates were pathogenic on each of the differential cultivars, and one isolate, 2-1, caused severe damage on Walter (mean rating of 3.5 on a 1 to 5 scale). The results were repeated in a second trial with the most virulent isolate. In both trials, pure colonies of F. oxysporum were recovered from symptomatic seedlings. Southeastern Florida is the last major tomatoproduction area in Florida to be affected by race 3 of F. oxysporum f. sp. lycopersici.