Major Immediate-early Research Articles

Hydrogen Peroxide Induce Human Cytomegalovirus Replication through the Activation of p38-MAPK Signaling Pathway.

Human cytomegalovirus (HCMV) is a major risk factor in transplantation and AIDS patients, which induces high morbidity and mortality. These patients infected with HCMV experience an imbalance of redox homeostasis that cause accumulation of reactive oxygen species (ROS) at the cellular level. H2O2, the most common reactive oxygen species, is the main byproduct of oxidative metabolism. However, the function of H2O2 on HCMV infection is not yet fully understood and the effect and mechanism of N-acetylcysteine (NAC) on H2O2-stimulated HCMV replication is unclear. We, therefore, examined the effect of NAC on H2O2-induced HCMV production in human foreskin fibroblast cells. In the present study, we found that H2O2 enhanced HCMV lytic replication through promoting major immediate early (MIE) promoter activity and immediate early (IE) gene transcription. Conversely, NAC inhibited H2O2-upregulated viral IE gene expression and viral replication. The suppressive effect of NAC on CMV in an acute CMV-infected mouse model also showed a relationship between antioxidants and viral lytic replication. Intriguingly, the enhancement of HCMV replication via supplementation with H2O2 was accompanied with the activation of the p38 mitogen-activated protein kinase pathway. Similar to NAC, the p38 inhibitor SB203580 inhibited H2O2-induced p38 phosphorylation and HCMV upregulation, while upregulation of inducible ROS was unaffected. These results directly relate HCMV replication to H2O2, suggesting that treatment with antioxidants may be an attractive preventive and therapeutic strategy for HCMV.

Glucocorticoids facilitate the transcription from the human cytomegalovirus major immediate early promoter in glucocorticoid receptor- and nuclear factor-I-like protein-dependent manner

Human cytomegalovirus (HCMV) is a common and usually asymptomatic virus agent in healthy individuals. Initiation of HCMV productive infection depends on expression of the major immediate early (MIE) genes. The transcription of HCMV MIE genes is regulated by a diverse set of transcription factors. It was previously reported that productive HCMV infection is triggered probably by elevation of the plasma hydroxycorticoid level. However, it is poorly understood whether the transcription of MIE genes is directly regulated by glucocorticoid. Here, we found that the dexamethasone (DEX), a synthetic glucocorticoid, facilitates the transcription of HCMV MIE genes through the MIE promoter and enhancer in a glucocorticoid receptor (GR)-dependent manner. By competitive EMSA and reporter assays, we revealed that an NF-I like protein is involved in DEX-mediated transcriptional activation of the MIE promoter. Thus, this study supports a notion that the increased level of hydroxycorticoid in the third trimester of pregnancy reactivates HCMV virus production from the latent state.

Development of a high-content screen for the identification of inhibitors directed against the early steps of the cytomegalovirus infectious cycle

Human cytomegalovirus (CMV) is a latent and persistent virus whose proliferation increases morbidity and mortality of immune-compromised individuals. The current anti-CMV therapeutics targeting the viral DNA polymerase or the major immediate-early (MIE) gene locus are somewhat effective at limiting CMV-associated disease. However, due to low bioavailability, severe toxicity, and the development of drug resistant CMV strains following prolonged treatment, current anti-CMV therapeutics are insufficient. To help address this shortfall, we established a high-content assay to identify inhibitors targeting CMV entry and the early steps of infection. The infection of primary human fibroblasts with a variant of the CMV laboratory strain AD169 expressing a chimeric IE2-yellow fluorescence protein (YFP) (AD169IE2-YFP) provided the basis for the high-content assay. The localization of IE2-YFP to the nucleus shortly following an AD169IE2-YFP infection induced a robust fluorescent signal that was quantified using confocal microscopy. The assay was optimized to achieve outstanding assay fitness and high Z’ scores. We then screened a bioactive chemical library consisting of 2080 compounds and identified hit compounds based on the decrease of fluorescence signal from IE2-YFP nuclear expression. The hit compounds likely target various cellular processes involved in the early steps of infection including capsid transport, chromatin remodeling, and viral gene expression. Extensive secondary assays confirmed the ability of a hit compound, convallatoxin, to inhibit infection of both laboratory and clinical CMV strains and limit virus proliferation. Collectively, the data demonstrate that we have established a robust high-content screen to identify compounds that limit the early steps of the CMV life cycle, and that novel inhibitors of early infection events may serve as viable CMV therapeutics.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Viral Enhancer Mimicry of Host Innate-Immune Promoters

The inflammatory milieu is the natural habitat for a pathogenic infection, characterised by activity of pro-inflammatory signalling pathways and inflammatory cytokines. Viral entry rapidly activates a range of innate-immune signalling events such as the activation of Pattern Recognition Receptors (PRRs) [1]–[5]. A virus must therefore counteract intrinsic cellular and innate-immune responses to successfully complete the replication cycle. Frequently this is accomplished by encoding viral effector molecules that block these cellular responses by working as either structural or functional mimics of host target proteins [6]–[11]. Nuclear DNA viruses are dependent on the host transcriptional machinery to express the first viral genes; for example the immediate-early (IE) control elements of DNA viruses are by definition absolutely dependent on host transcription factors (TF) [12]. Therefore, these viruses are particularly hostage to their host transcriptional environment [13], [14]. Here we propose that mimicry of regulatory DNA sequences by viral regulatory regions may also provide an additional strategy to counteract at IE times of infection the innate-immune response. In this context, viral IE control elements might functionally mimic innate-immune enhancers, taking advantage of the activated immune signalling TFs for promoting viral IE gene expression. In other words: “If you can't beat ‘em. Join ‘em.” In exploring this possibility, we present a synopsis of the promoter-regulatory elements from seven extensively studied mammalian viruses with a DNA stage, and seven promoters representing prototypical cellular innate-immune genes. These are the SV-40 early enhancer, the E1A enhancer of HAdV5, the long terminal repeat (LTR) of HIV-1, the E6/7 long control region (LCR) of both HPV-16 and HPV-18, the major IE (MIE) enhancer of HCMV, and the enhancer-1 (Eh-1) regulatory region of HBV for viral sequences, and the enhancer regions of human IFNB1, IFNG, TNF, IRF1, IL8, IL12B, and IL1B for host sequences. First, we consider similarities between the primary sequence structures of the enhancers. Second, we present arguments for convergent evolution and structural flexibility inherent to enhancer sequences. Third, we discuss functional features and regulatory hallmarks that may be used to define viral enhancer mimicry of cellular immune enhancers.

Inhibition of human cytomegalovirus replication by overexpression of CREB1

Expression of the human cytomegalovirus (HCMV) major immediate-early (MIE) genes is regulated by a strong enhancer-containing promoter with multiple binding sites for various transcription factors, including cyclic AMP response element binding protein 1 (CREB1). Here we show that overexpression of CREB1 potently blocked MIE transcription and HCMV replication. Surprisingly, CREB1 still exhibited strong inhibition of the MIE promoter when all five CREB binding sites within the enhancer were mutated, suggesting that CREB1 regulated the MIE gene expression indirectly. Promoter deletion analysis and site-directed mutagenesis identified the region between −130 and −50 upstream of the transcription start site of the MIE gene as the “CREB1 responsive region”. Mutations of SP1/3 and NF-κB binding sites within this region interrupted the inhibitory effect induced by CREB1 overexpression. Our findings suggest that overexpression of CREB1 can cause repression of HCMV replication and may contribute to the development of new anti-HCMV strategies.

Nucleosome maps of the human cytomegalovirus genome reveal a temporal switch in chromatin organization linked to a major IE protein

Human CMV (hCMV) establishes lifelong infections in most of us, causing developmental defects in human embryos and life-threatening disease in immunocompromised individuals. During productive infection, the viral >230,000-bp dsDNA genome is expressed widely and in a temporal cascade. The hCMV genome does not carry histones when encapsidated but has been proposed to form nucleosomes after release into the host cell nucleus. Here, we present hCMV genome-wide nucleosome occupancy and nascent transcript maps during infection of permissive human primary cells. We show that nucleosomes occupy nuclear viral DNA in a nonrandom and highly predictable fashion. At early times of infection, nucleosomes associate with the hCMV genome largely according to their intrinsic DNA sequence preferences, indicating that initial nucleosome formation is genetically encoded in the virus. However, as infection proceeds to the late phase, nucleosomes redistribute extensively to establish patterns mostly determined by nongenetic factors. We propose that these factors include key regulators of viral gene expression encoded at the hCMV major immediate-early (IE) locus. Indeed, mutant virus genomes deficient for IE1 expression exhibit globally increased nucleosome loads and reduced nucleosome dynamics compared with WT genomes. The temporal nucleosome occupancy differences between IE1-deficient and WT viruses correlate inversely with changes in the pattern of viral nascent and total transcript accumulation. These results provide a framework of spatial and temporal nucleosome organization across the genome of a major human pathogen and suggest that an hCMV major IE protein governs overall viral chromatin structure and function.

Human Cytomegalovirus pUL97 Regulates the Viral Major Immediate Early Promoter by Phosphorylation-Mediated Disruption of Histone Deacetylase 1 Binding

Human cytomegalovirus (HCMV) is a common agent of congenital infection and causes severe disease in immunocompromised patients. Current approved therapies focus on inhibiting viral DNA replication. The HCMV kinase pUL97 contributes to multiple stages of viral infection including DNA replication, controlling the cell cycle, and virion maturation. Our studies demonstrate that pUL97 also functions by influencing immediate early (IE) gene expression during the initial stages of infection. Inhibition of kinase activity using the antiviral compound maribavir or deletion of the UL97 gene resulted in decreased expression of viral immediate early genes during infection. Expression of pUL97 was sufficient to transactivate IE1 gene expression from the viral genome, which was dependent on viral kinase activity. We observed that pUL97 associates with histone deacetylase 1 (HDAC1). HDAC1 is a transcriptional corepressor that acts to silence expression of viral genes. We observed that inhibition or deletion of pUL97 kinase resulted in increased HDAC1 and decreased histone H3 lysine 9 acetylation associating with the viral major immediate early (MIE) promoter. IE expression during pUL97 inhibition or deletion was rescued following inhibition of deacetylase activity. HDAC1 associates with chromatin by protein-protein interactions. Expression of active but not inactive pUL97 kinase decreased HDAC1 interaction with the transcriptional repressor protein DAXX. Finally, using mass spectrometry, we found that HDAC1 is uniquely phosphorylated upon expression of pUL97. Our results support the conclusion that HCMV pUL97 kinase regulates viral immediate early gene expression by phosphorylation-mediated disruption of HDAC1 binding to the MIE promoter.

Human Cytomegalovirus pp71 Stimulates Major Histocompatibility Complex Class I Presentation of IE1-Derived Peptides at Immediate Early Times of Infection

Suppression of major histocompatibility complex (MHC) class I-mediated presentation of human cytomegalovirus (HCMV) peptides is an important mechanism to avoid CD8 T lymphocyte recognition and killing of infected cells. Of particular interest is how MHC class I presentation of essential regulatory immediate early (IE) proteins of HCMV can be effectively compromised at times when known viral immunoevasins are not abundantly expressed. The tegument protein pp71 had been suggested to be involved in MHC class I downregulation. Intriguingly, this polypeptide is also critically engaged in the initial derepression of the major IE gene locus, leading to enhanced expression of IE proteins IE1-pp72 and IE2-pp86. Using a set of viral mutants, we addressed the role of pp71 in MHC class I presentation of IE1-pp72-derived peptides. We show that the amount of "incoming" pp71 positively correlates with IE1-pp72 protein levels and with the presentation of IE1-derived peptides. This indicates that the amount of the IE1 protein, induced by pp71, rather than a putative immunoevasive function of the tegument protein, determines MHC class I antigen presentation of IE1-derived peptides. This process proved to be independent of the presence of pp65, which had been reported to interfere with IE1 presentation. It may thus be beneficial for the success of HCMV replication to limit the level of pp71 delivered from infecting particles in order to avoid critical levels of MHC class I presentation of IE protein-derived peptides.

Polycomb Repressive Complex 2 Targets Murine Cytomegalovirus Chromatin for Modification and Associates with Viral Replication Centers

Regulation of viral transcription by chromatin structure has emerged as a fundamental determinant in the establishment of lytic and latent herpesvirus infections. The Polycomb group (PcG) of epigenetic repressors promotes heterochromatin formation by trimethylating histone H3 on lysine-27 (H3K27me3) and regulates development, stem cell renewal and differentiation and the cell cycle. These cellular processes are tightly coupled to the molecular switch between lytic and latent herpesvirus infections. Using chromatin immunoprecipitation analysis, we observed enrichment of H3K27me3 at the major immediate-early (MIE) locus of murine cytomegalovirus (MCMV) very early following infection of permissive fibroblasts. As lytic replication progressed, we observed a loss of H3K27me3 enrichment concomitant with the appearance of H3K4me3. However, late during infection, as viral replication centers are established, we observed a significant increase in PcG protein association with chromatin. Additionally, in co-immunofluorescence assays using confocal microscopy, we detected strong enrichments for PcG protein within the viral replication compartment, suggesting an association between viral DNA synthesis machinery and PcG proteins. Together, our results suggest a novel, dynamic interaction between PcG epigenetic repressors and MCMV genomes.

Human cytomegalovirus infection causes degradation of Sp100 proteins that suppress viral gene expression.

The interferon-inducible Sp100 proteins are thought to play roles in the chromatin pathway and in transcriptional regulation. Sp100A, the smallest isoform, is one of the major components of PML nuclear bodies (NBs) that exhibit intrinsic antiviral activity against several viruses. Since PML NBs are disrupted by the immediate-early 1 (IE1) protein during human cytomegalovirus (HCMV) infection, the modulation of Sp100 protein expression or activity during infection has been suggested. Here, we show that Sp100 proteins are lost largely in the late stages of HCMV infection. This event required viral gene expression and involved posttranscriptional control. The mutant virus with deletion of the sequence for IE1 (CR208) did not have Sp100 loss. In CR208 infection, PML depletion by RNA interference abrogated the accumulation of SUMO-modified Sp100A and of certain high-molecular-weight Sp100 isoforms but did not significantly affect unmodified Sp100A, suggesting that the IE1-induced disruption of PML NBs is not sufficient for the complete loss of Sp100 proteins. Sp100A loss was found to require proteasome activity. Depletion of all Sp100 proteins by RNA silencing enhanced HCMV replication and major IE (MIE) gene expression. Sp100 knockdown enhanced the acetylation level of histones associated with the MIE promoter, demonstrating that the repressive effect of Sp100 proteins may involve, at least in part, the epigenetic control of the MIE promoter. Sp100A was found to interact directly with IE1 through the N-terminal dimerization domain. These findings indicate that the IE1-dependent loss of Sp100 proteins during HCMV infection may represent an important requirement for efficient viral growth.

General blockade of human cytomegalovirus immediate-early mRNA expression in the S/G2 phase by a nuclear, Daxx- and PML-independent mechanism

The onset of human cytomegalovirus (HCMV) lytic replication is strictly controlled by the host cell division cycle. Although viral entry of S/G2-phase cells is unperturbed expression of major immediate-early (MIE) genes IE1 and IE2 is tightly blocked in these cells. Besides the finding that cyclin-dependent kinase (CDK) activity is required for IE1/IE2 repression little is known about the nature of this cell cycle-dependent block. Here, we show that the block occurs after nuclear entry of viral DNA and prevents the accumulation of IE1/IE2 mRNAs, suggesting an inhibition of transcription. Remarkably, the presence of cis-regulatory regions of the MIE locus is neither sufficient nor necessary for IE1/IE2 repression in the S/G2 phase. Furthermore, the block of viral mRNA expression also affects other immediate-early transcribed regions, i.e. the US3 and UL36-38 gene loci. This suggests a mechanism of repression that acts in a general and not a gene-specific fashion. Such a nuclear, genome-wide repression of HCMV is typically mediated by the intrinsic immune defence at nuclear domain 10 (ND10) structures. However, we found that neither Daxx nor PML, the main players of ND10-based immunity, are required for the block to viral gene expression in the S/G2 phase. In addition, the viral tegument protein pp71 (pUL82), a major antagonist of the intrinsic immunity at pre-immediate-early times of infection, proved to be functional in S-phase cells. This suggests the existence of a yet undiscovered, CDK-dependent mechanism exerting higher-level control over immediate-early mRNA expression in HCMV-infected cells.

The Human Cytomegalovirus Gene Products Essential for Late Viral Gene Expression Assemble into Prereplication Complexes before Viral DNA Replication

The regulation of human cytomegalovirus (HCMV) late gene expression by viral proteins is poorly understood, and these viral proteins could be targets for novel antivirals. HCMV open reading frames (ORFs) UL79, -87, and -95 encode proteins with homology to late gene transcription factors of murine gammaherpesvirus 68 ORFs 18, 24, and 34, respectively. To determine whether these HCMV proteins are also essential for late gene transcription of a betaherpesvirus, we mutated HCMV ORFs UL79, -87, and -95. Cells were infected with the recombinant viruses at high and low multiplicities of infection (MOIs). While viral DNA was detected with the recombinant viruses, infectious virus was not detected unless the wild-type viral proteins were expressed in trans. At a high MOI, mutation of ORF UL79, -87, or -95 had no effect on the level of major immediate-early (MIE) gene expression or viral DNA replication, but late viral gene expression from the UL44, -75, and -99 ORFs was not detected. At a low MOI, preexpression of UL79 or -87, but not UL95, in human fibroblast cells negatively affected the level of MIE viral gene expression and viral DNA replication. The products of ORFs UL79, -87, and -95 were expressed as early viral proteins and recruited to prereplication complexes (pre-RCs), along with UL44, before the initiation of viral DNA replication. All three HCMV ORFs are indispensable for late viral gene expression and viral growth. The roles of UL79, -87, and -95 in pre-RCs for late viral gene expression are discussed.

Histone deacetylase 3, not histone deacetylase 2, interacts with the major immediate early locus of human cytomegalovirus

Evidence suggests that genome chromatinization and the posttranslational modification of histones are involved in the regulation of viral gene expression, including the human cytomegalovirus (HCMV). We performed a ChIP-on-Chip assay to determine whether histone deacetylases (HDACs) interact with HCMV genomic DNA on a global level. Surprisingly, we found that HDAC3, but not HDAC2, interacts not only with the major immediate early (MIE) promoter but also with the entire MIE locus, suggesting a heterogeneous interaction of HDAC3 with HCMV DNA. The interaction of HDAC3 with the MIE region is related to inhibition of viral replication because HDAC3 inhibitors enhanced HCMV replication.

Human T‐lymphotropic virus tax activates human cytomegalovirus major‐immediate early promoter and improves production of recombinant proteins in HEK293 cells

The human cytomegalovirus (CMV) major immediate-early (MIE) promoter is widely used in mammalian cells for production of recombinant proteins. It is of great interest to further enhance protein production driven by the CMV promoter. Here, we report that the Tax protein of human T-lymphotropic virus stimulates the transgene expression under the control of CMV MIE promoter in HEK293 cells. At least threefold increases in transient production of recombinant proteins, including luciferase and two biopharmaceutical proteins (erythropoietin and interferon-γ), were detected. Furthermore, cyclic adenosine monophosphate (AMP)-response element binding protein 2 (CREB2) was identified as a cellular cofactor, which might be responsible for Tax transactivation of the CMV MIE promoter. Our results not only demonstrate the potential use of this novel expression strategy for improvement of recombinant protein production in HEK293 cells but also provide the molecular mechanism for Tax-mediated activation of CMV MIE promoter.

Phenotypic and genetic characterization of varicella-zoster virus mutants resistant to acyclovir, brivudine and/or foscarnet

The treatment of varicella-zoster virus (VZV) reactivation is based on nucleoside analogues acyclovir (ACV) and bromevinyldeoxyuridine (BVdU) and a phosphonic acid derivative (PFA). Drug-resistant mutants of 3 wild-type (WT) VZV strains were obtained by exposure of human retinal pigment epithelial (hRPE) cells inoculated with cell-free WT virus at increasing concentrations of ACV, BVdU, and PFA. In addition to single-drug resistance, a cross-resistance of isolates vs. ACV was observed for PFA-resistant strains. Single-nucleotide (nt) exchanges resulting in amino acid (aa) substitutions were observed within the DNA polymerase (ORF 28) and/or thymidine kinase (ORF 36) of 3 of 3 ACV-, 2 of 3 BVdU-, and 3 of 3 PFA-resistant strains. Interestingly, aa substitutions were also observed within the immediate-early regulatory protein and major transactivator IE 62 (ORF 62), and the envelope glycoprotein (g) I (ORF 67) of the BVdU-resistant mutant of strain PP. No aa substitutions were observed in the protein sequences of gene products encoded by ORF 5 (gK, a glycoprotein arranging exocytosis of viral-loaded vacuoles), ORF 14 (gC), ORF 31 (gB), ORF 37 (gH), ORF 47 (protein kinase, involved in major phosphorylating processes), ORF 60 (gL, important for syncytia forming of infected cells in combination with gH), ORF 63 (major transactivator, part of the tegument), and ORF 68 (gE, triggers fusion of viral loaded vacuoles with cell membranes by heterodimerizing with gI). Phenotypic analysis revealed a slow-growth phenotype and a formation of smaller plaques of resistant mutants. Future studies should prove the presence of those resistant mutants in herpes zoster patients and the potential consequences of their putative reduced fitness on the success of therapeutical interventions.

The activator protein 1 binding motifs within the human cytomegalovirus major immediate-early enhancer are functionally redundant and act in a cooperative manner with the NF-{kappa}B sites during acute infection.

Human cytomegalovirus (HCMV) infection causes a rapid induction of c-Fos and c-Jun, the major subunits of activator protein 1 (AP-1), which in turn have been postulated to activate the viral immediate-early (IE) genes. Accordingly, the major IE promoter (MIEP) enhancer, a critical control region for initiating lytic HCMV infection and reactivation from the latent state, contains one well-characterized AP-1 site and a second candidate interaction site. In this study we explored the role of these AP-1 elements in the context of the infection. We first show that the distal candidate AP-1 motif binds c-Fos/c-Jun heterodimers (AP-1 complex) and confers c-Fos/c-Jun-mediated activity to a core promoter. Site-directed mutagenesis studies indicate that both AP-1 response elements are critical for 12-O-tetradecanoylphorbol-13-acetate (TPA)-enhanced MIEP activity in transient-transfection assays. In marked contrast to the results obtained with the isolated promoter, disruption of the AP-1 recognition sites of the MIEP in the context of the infectious HCMV genome has no significant influence on the expression of the MIE protein IE1 or viral replication in different cell types. Moreover, a chimeric murine CMV driven by the HCMV MIEP (hMCMV-ES) with the two AP-1 binding sites mutated is not compromised in virulence, is able to grow and disseminate to different organs of the newborn mice as efficiently as the parental virus, and is competent in reactivation. We show, however, that combined inactivation of the enhancer AP-1 and NF-κB recognition sites leads to an attenuation of the hMCMV-ES in the neonatal murine infection model, not observed when each single element is abolished. Altogether, these results underline the functional redundancy of the MIEP elements, highlighting the plasticity of this region, which probably evolved to ensure maximal transcriptional performance across many diverse environments.

Alternative Splicing of the Human Cytomegalovirus Major Immediate-Early Genes Affects Infectious-Virus Replication and Control of Cellular Cyclin-Dependent Kinase

The major immediate-early (MIE) gene locus of human cytomegalovirus (HCMV) is the master switch that determines the outcomes of both lytic and latent infections. Here, we provide evidence that alteration in the splicing of HCMV (Towne strain) MIE genes affects infectious-virus replication, movement through the cell cycle, and cyclin-dependent kinase activity. Mutation of a conserved 24-nucleotide region in MIE exon 4 increased the abundance of IE1-p38 mRNA and decreased the abundance of IE1-p72 and IE2-p86 mRNAs. An increase in IE1-p38 protein was accompanied by a slight decrease in IE1-p72 protein and a significant decrease in IE2-p86 protein. The mutant virus had growth defects, which could not be complemented by wild-type IE1-p72 protein in trans. The phenotype of the mutant virus could not be explained by an increase in IE1-p38 protein, but prevention of the alternate splice returned the recombinant virus to the wild-type phenotype. The lower levels of IE1-p72 and IE2-p86 proteins correlated with a delay in early and late viral gene expression and movement into the S phase of the cell cycle. Mutant virus-infected cells had significantly higher levels of cdk-1 expression and enzymatic activity than cells infected with wild-type virus. The mutant virus induced a round-cell phenotype that accumulated in the G(2)/M compartment of the cell cycle with condensation and fragmentation of the chromatin. An inhibitor of viral DNA synthesis increased the round-cell phenotype. The round cells were characteristic of an abortive viral infection.

Human Cytomegalovirus Induces the Endoplasmic Reticulum Chaperone BiP through Increased Transcription and Activation of Translation by Using the BiP Internal Ribosome Entry Site

The endoplasmic reticulum (ER) chaperone BiP (immunoglobulin binding protein) plays a major role in the control of the unfolded protein response. We have previously shown that BiP levels are dramatically increased during human cytomegalovirus (HCMV) infection, where BiP performs unique roles in viral assembly and egress. We show that BiP mRNA levels increase during infection due to activation of the BiP promoter by the major immediate-early (MIE) proteins. The BiP promoter, like other ER stress-activated promoters, contains endoplasmic reticulum stress elements (ERSEs), which are activated by unfolded protein response (UPR)-induced transcription factors. However, these elements are not needed for MIE protein-mediated transcriptional activation; thus, a virus-specific transcriptional activation mechanism is used. Transcriptional activation results in only a 3- to 4-fold increase in BiP mRNA, suggesting that additional mechanisms for BiP production are utilized. The BiP mRNA contains an internal ribosome entry site (IRES) which increases the level of BiP mRNA translation. We show that utilization of the BiP IRES is dramatically increased in HCMV-infected cells. Utilization of the BiP IRES can be activated by the La autoantigen, also called Sjögren's syndrome antigen B (SSB). We show that SSB/La levels are significantly increased during HCMV infection, and SSB/La depletion causes the loss of BiP IRES utilization and lowers endogenous BiP levels in infected cells. Our data show that BiP levels increase in HCMV-infected cells through the combination of increased BiP gene transcription mediated by the MIE proteins and increased BiP mRNA translation due to SSB/La-induced utilization of the BiP IRES.

Phorbol ester-induced human cytomegalovirus major immediate-early (MIE) enhancer activation through PKC-delta, CREB, and NF-kappaB desilences MIE gene expression in quiescently infected human pluripotent NTera2 cells.

The ways in which human cytomegalovirus (HCMV) major immediate-early (MIE) gene expression breaks silence from latency to initiate the viral replicative cycle are poorly understood. A delineation of the signaling cascades that desilence the HCMV MIE genes during viral quiescence in the human pluripotent N-Tera2 (NT2) cell model provides insight into the molecular mechanisms underlying HCMV reactivation. In this model, we show that phorbol 12-myristate 13-acetate (PMA) immediately activates the expression of HCMV MIE RNA and protein and greatly increases the MIE-positive (MIE(+)) NT2 cell population density; levels of Oct4 (pluripotent cell marker) and HCMV genome penetration are unchanged. Decreasing PKC-delta activity (pharmacological, dominant-negative, or RNA interference [RNAi] method) attenuates PMA-activated MIE gene expression. MIE gene activation coincides with PKC-delta Thr505 phosphorylation. Mutations in MIE enhancer binding sites for either CREB (cyclic AMP [cAMP] response element [CRE]) or NF-kappaB (kappaB) partially block PMA-activated MIE gene expression; the ETS binding site is negligibly involved, and kappaB does not confer MIE gene activation by vasoactive intestinal peptide (VIP). The PMA response is also partially attenuated by the RNAi-mediated depletion of the CREB or NF-kappaB subunit RelA or p50; it is not diminished by TORC2 knockdown or accompanied by TORC2 dephosphorylation. Mutations in both CRE and kappaB fully abolish PMA-activated MIE gene expression. Thus, PMA stimulates a PKC-delta-dependent, TORC2-independent signaling cascade that acts through cellular CREB and NF-kappaB, as well as their cognate binding sites in the MIE enhancer, to immediately desilence HCMV MIE genes. This signaling cascade is distinctly different from that elicited by VIP.