Main Production Regions Research Articles

Agricultural socialized services to stimulate the green production behavior of smallholder farmers: the case of fertilization of rice production in south China

Introduction: This study investigates the impact of Agricultural Socialized Services (ASSs) on the green production behavior (GPB) of smallholder farmers in the main rice production region of southern China. The research aims to address the gap in understanding the relationship between ASSs and the adoption of sustainable agricultural practices by smallholder farmers.Methodology: Data was collected from 741 smallholder farmers in Hunan, Jiangxi, and Zhejiang provinces using a structured questionnaire. A probit model was employed to examine the relationship between ASSs and smallholder farmers’ GPB.Results and Discussion: The study revealed that ASSs have a significant and positive impact on smallholder farmers’ GPB. Farmers who received ASSs tended to adopt more sustainable agricultural practices such as using organic fertilizer and soil-tested formula fertilizer. The findings of this study have important implications for policymakers. The results suggest that policymakers should prioritize the development of services to agricultural producers and strengthen Agricultural Service Systems. This can be achieved through optimizing the public administration service system, establishing joint service organizations, and creating a good financial and legal service environment. By doing so, policymakers can promote the adoption of sustainable agricultural practices and the overall development of the agricultural sector.

CropQuant-Air: an AI-powered system to enable phenotypic analysis of yield- and performance-related traits using wheat canopy imagery collected by low-cost drones.

As one of the most consumed stable foods around the world, wheat plays a crucial role in ensuring global food security. The ability to quantify key yield components under complex field conditions can help breeders and researchers assess wheat's yield performance effectively. Nevertheless, it is still challenging to conduct large-scale phenotyping to analyse canopy-level wheat spikes and relevant performance traits, in the field and in an automated manner. Here, we present CropQuant-Air, an AI-powered software system that combines state-of-the-art deep learning (DL) models and image processing algorithms to enable the detection of wheat spikes and phenotypic analysis using wheat canopy images acquired by low-cost drones. The system includes the YOLACT-Plot model for plot segmentation, an optimised YOLOv7 model for quantifying the spike number per m2 (SNpM2) trait, and performance-related trait analysis using spectral and texture features at the canopy level. Besides using our labelled dataset for model training, we also employed the Global Wheat Head Detection dataset to incorporate varietal features into the DL models, facilitating us to perform reliable yield-based analysis from hundreds of varieties selected from main wheat production regions in China. Finally, we employed the SNpM2 and performance traits to develop a yield classification model using the Extreme Gradient Boosting (XGBoost) ensemble and obtained significant positive correlations between the computational analysis results and manual scoring, indicating the reliability of CropQuant-Air. To ensure that our work could reach wider researchers, we created a graphical user interface for CropQuant-Air, so that non-expert users could readily use our work. We believe that our work represents valuable advances in yield-based field phenotyping and phenotypic analysis, providing useful and reliable toolkits to enable breeders, researchers, growers, and farmers to assess crop-yield performance in a cost-effective approach.

Spatiotemporal divergence and convergence test of green total factor productivity of grain in China: based on the dual perspective of carbon emissions and surface source pollution.

The topic of grain production and quality has always been a fundamental issue for the country's livelihood. With the purpose of contributing to high-quality grain development and ensuring national food security, this paper explores the spatial and temporal evolution, regional differences and convergence of grain green total factor productivity (GTFP) in the main grain-producing regions of China from the dual perspectives of carbon emissions and surface pollution with the help of EBM-GML model, kernel density function estimation and convergence methods. The results show that (1) Grain GTFP has generally shown a positive growth trend, although there exists obvious spatial differences. (2) In terms of decomposition indices, technological progress is the source of the increase in grain GTFP. (3) There are σ convergence, absolute β convergence and conditional β convergence in the main producing region as well as in the Yellow River basin and the Yangtze River basin; there are only absolute β convergence and conditional β convergence in the Songhua River basin. Grain GTFP has a single high-efficiency convergence point, and the grain GTFP is enhancing year by year in each province, and the inter-provincial gap is shrinking.

SNP fingerprinting and farmer criteria for selection, multiplication, and traceability of cacao in Nicaragua

Introduction. Genetic diversity, registration, and traceability of cacao planting material are the essential tripod to support its sustainable cultivation. In Nicaragua, cocoa planting material is mostly obtained from seeds, which leads to great variability in yield, bean quality, and tolerance to pests and diseases. Farmers, technical staff, development projects, and investors depend on a limited supply of elite trees as a reliable source of genetic material to support new cacao fronts and meet market quality standards. Therefore, the development of a national genetic improvement program and a planting material traceability system in Nicaragua are necessary to improve the sustainability of cacao cultivation. Objective. To evaluate the genetic resources on farms and provide information for future breeding programs, as well as to lay foundation for a national traceability and certification system. Materials and methods. Fourty-nine elite trees selected by farmers in the main producing regions in Nicaragua between 2018 and 2020 were sampled. Ninety-three SNP markers were used to characterize them and resolve their genetic origins. Results. The evaluated cacao trees had a narrow genetic background, mainly composed of hybrids with Amelonado (36 %), Criollo (17 %) and Iquitos (15 %) origins. A set of trees with high genetic diversity that could be incorporated into a selection and breeding program was identified. Conclusion. Fingerprinting with SNP markers was a useful tool for evaluating the genetic links of cultivated cacao and can be used for varietal identity test at the farm level. The study provided the basis for developing both a breeding program and a traceability system of cacao planting material in Nicaragua.

Heterogeneous impacts of GlobalGAP adoption on net income in small‐scale pineapple farming in Ghana: Does farm size matter?

AbstractAdoption of Global Good Agricultural Practices (GlobalGAP) improves food quality and safety along fresh produce value chains. However, adoption rates have been low among small‐scale pineapple farmers in Ghana, but with possible heterogeneous responses due to farm size economies. This study estimates the impact of GlobalGAP adoption on net incomes earned by small‐scale pineapple farmers in Ghana's main producing region, and examines size‐induced heterogeneous effects of adoption on income. Household and farm‐level data gathered from 546 small‐scale farmers were analyzed using a two‐stage regression model to estimate the impact of GlobalGAP adoption on per hectare pineapple net income. Robustness of the results was checked by re‐estimating the two‐stage model using a maximum likelihood extended regression model. GlobalGAP adoption reduced net income on small farms growing less than 1 ha of pineapples, but increased net income on small farms growing more than 1 ha of pineapples. We conclude that GlobalGAP adoption and farm size are not independent determinants of profitability, and recommend that extension and other interventions intended to promote GlobalGAP adoption among pineapple farmers in Ghana should be targeted at those who are willing and able to grow more than 1 ha of pineapples [EconLit Citations: Q16, Q13].

Corn price volatility and producer income protection

O Objective: To estimate the risk indicator of the future price of yellow corn #2 at the Chicago Futures Exchange (USA) regarding the spot price of white corn in the main producing regions in Mexico through the financial volatility indicator. Methodology: The research used the returns of the monthly time series corresponding to the spot price of white corn from January 1998 to December 2020, considering five producer-consumer regions of Mexico and the future price of yellow corn #2 as listed on the Chicago Stock Exchange. To quantify volatility, the generalized autoregressive conditional heteroskedasticity model of order (1,1) was estimated. Results: The yellow corn #2 volatility indicator was 0.9870 (future price). In the case of the spot price of white corn in Mexico, the volatility was 0.7977 for the national price, 0.3385 for the central region, 0.3206 for the western region, and 0.0078 for the southeast region. Implications: The high volatility of yellow corn #2 (close to unity) shows that the international market for this commodity is riskier than the national market or regional markets in Mexico. Conclusions: The national white corn market proved to be riskier than the west, center, and southeast regional markets, which have a higher volatility indicator.

Estado nutricional de melancia irrigada com água salobra em diferentes sistemas de plantio

ABSTRACT Watermelon is cultivated in practically all Brazilian states; however, there are still disagreements as to the best way to propagate it. In addition, the Northeast region, the main producing region in the country, is increasingly facing the scarcity of low-salinity water. Given this context, this study aimed to evaluate the morphophysiology and mineral contents of the watermelon crop subjected to irrigation water of different electrical conductivities, using seedlings or direct seeding. A randomized block experimental design with split plots was used, with four replications. The plot was formed by the electrical conductivities of the irrigation water (0.3, 1.5, 3.0, and 4.5 dS m-1) and the subplot by the planting methods - DS = direct seeding, TP1 = transplanting of the seedling produced with water of moderate salinity (1.5 dS m-1), and TP2 = transplanting of the seedling produced with water of low salinity (0.3 dS m-1). The highest biomass accumulation was obtained in the direct seeding method. Salt stress increases the intrinsic water use efficiency in watermelon plants. The TP1 and TP2 planting methods led to the highest contents of P and K in the leaf. The increase in the salinity level increases the content of S and reduces the content of Cu and Mn.

Breeding and Growth Performance of 'Ningzhi 4', a New Blackberry Cultivar with High Yield Potential and Good Quality in China.

The thornless blackberry cultivar 'Ningzhi 4' was developed by the Institute of Botany, Jiangsu Province and the Chinese Academy of Sciences (Nanjing Botanical Garden Mem. Sun Yat-Sen). The new blackberry cultivar was selected from the 'Kiowa' (female parent) and 'Hull Thornless' (male parent) F1 hybrid. 'Ningzhi 4' had excellent plant characteristics, including thornlessness, semi-erect to erect canes, vigorous growth and good disease resistance. 'Ningzhi 4' had large fruit and high yield. In addition, the parents of the superior hybrid plant were further identified by SSR markers, which provided the basis for the fingerprint of the new blackberry cultivar 'Ningzhi 4'. This is a commercial cultivar to be grown for fruit production for either shipping or local sales. It also has value as a home-garden plant. This unique type of blackberry fruit was a traditional summer fruit. This new cultivar has thornless semi-erect to erect canes and produces high-quality berries with large size, good firmness, excellent flavor, and potential for shipping and postharvest storage. The new blackberry cultivar 'Ningzhi 4' is adapted to all areas of southern China and is expected to replace or complement 'Kiowa', 'Hull Thornless', 'Chester Thornless' and 'Triple Crown'. A local cultivar patent has been approved by the Jiangsu Variety Approval Committee as 'Rubus spp. Ningzhi 4' in 2020 (S-SV-RS-014-2020). In the future, 'Ningzhi 4' could be promoted as an advantageous thornless blackberry cultivar in the main production regions of China.

Shortwave radiation balance modulates potential evapotranspiration over China

ABSTRACT Shortwave radiation is an influential driver of global hydrological cycle, as its variation will alter evapotranspiration (ET). While climate change discussion extensively examined ET response to temperature, wind speed and land use/cover variations, little is known about the contribution of shortwave radiation balance on ET partly because of data availability. In this study, we applied the newly-released Global LAnd Surface Satellite (GLASS) products to detect changes in shortwave radiation and albedo for 2003–2018 over China, and quantified their contributions on potential evapotranspiration (PET) which is the upper limit of ET and generally the basis to estimate it. The results showed that downward shortwave radiation declined, together with a slight decrease in albedo, causing a decrease of net shortwave radiation. While climate change affected PET, the decreased net shortwave radiation reduced PET during the period. We identified a hotspot area in the north China plain that is one of the main agricultural production regions, as the radiation balance induced a contrasting effect on PET for the warm and the cold seasons. Our study indicates that it is important to consider shortwave radiation balance when estimating PET and ET to make reliable evaluation of climate change on hydrological cycle and ecosystem response.

Copernicus global crop productivity indicators: An evaluation based on regionally reported yields

Climate variability places significant pressure on climate-sensitive sectors such as agriculture. Information on crop-related climate and water indicators under climate change becomes essential. The Copernicus Climate Change Service (C3S) provides reliable information about climate change based on climate models, Earth Observations, and in situ data to support adaptation policies. Within this C3S context, the Global Agriculture Sectoral Information System (SIS) has developed a new product based on global crop productivity indicators to document the effects of climate variability on crop yield variability. This study focuses on the evaluation of climate-enhanced, earth observation (EO) based crop productivity indicators i.e., Total Weight Storage Organs (TWSO, equivalent to yield), Total Above Ground Production (TAGP). These variables provide insights into the Spatio-temporal variability of yield, productivity, and development of four major staple crops (rice, maize, soybean, and wheat) for their main production regions at the global scale for the period 2000–2018. In this study, the evaluation was carried out spatially and temporally for the United States of America, India, and China for the period 2000–2018, using reported yield statistics aggregated to the lowest available administrative level of each region. For almost all the crops in the three countries, the skilled error can be reduced by more than 25% for both the indicators TAGP and TWSO compared to the trend of reported yield, suggesting considerable performance in assessing interannual yield variability. Results indicated both indicators individually performed well in many important producing areas of the USA, India, and China. However, if we compare both the indicator’s performance in terms of production totals in the USA, India, and China, TAGP contributes ∼27–50% of total crop production in the USA and India, and ∼47–75% in China. While, TWSO contributes ∼24–41% in the USA and India, and 5–65% in China.

Evaluation of downscaling seasonal climate forecasts for crop yield forecasting in Zimbabwe

Meteorology and weather forecasting are crucial for water-limited agriculture. We evaluate the added value of downscaling seven-months global deterministic seasonal forecasts from the Climate Forecast System version 2 (CFSv2) using the Weather, Research and Forecasting (WRF) model over Zimbabwe for ten growing seasons (2011–2021). Downscaling reduces the area of significant differences between forecasted and observed total seasonal rainfall. Downscaling also improves the score for droughts as measured through the standardized precipitation index and 3-class method. Yield forecasts by the WOrld FOod STudies (WOFOST) model reveal that downscaling improves the estimated growing season evolution and maize yield in all studied regions across the country. For the main maize production region Karoi, the bias, root mean square error, mean absolute error and mean absolute percentage error reduce by 33% (0.2 ton/ha), 27% (0.4 ton/ha), 31% (0.4 ton/ha) and 27% (8.3 %) respectively by downscaling. Hence we illustrate that downscaling the deterministic seasonal forecasts may assist in food security in a crucial area in southern Africa.

Projected changes in the hotspots for agriculturally relevant compound events in Western Canada cropping regions under the RCP8.5 scenario

AbstractThe Canadian Prairies are a major grain production region, producing most of the wheat for export in Canada. Global warming and the associated changes in extreme precipitation and temperature events pose significant risks to agriculture on the Canadian Prairies. Compound hazards can cause higher crop failure than isolated events, especially in the main grain production regions in western Canada. To achieve informed climate risk management, it is critical to characterize the threats posed by compound hazards in current and future climates in western Canada. In this study, return periods of events were computed to assess the potential changes in the hotspots for agriculturally relevant compound events in western Canada using two convection‐permitting climate simulations: current (CTL) climate and future climate under the RCP8.5 scenario based on a pseudo‐global‐warming (PGW) approach. Specifically, our study analyzed agricultural drought, low precipitation, heatwaves, and cool waves related to cool‐season crops. The results showed the overall good performance of the CTL simulation in capturing spatial patterns of these compound events in western Canada. In the current climate, droughts and heatwaves co‐occur mostly in southeastern parts of the prairies. Under the RCP8.5 scenario, they are likely to increase in frequency and expand to cover the major croplands of western Canada. This study provides information that policymakers in the fields of climate change adaptation and agricultural disaster management will find useful.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Gas exchange and post-harvest quality of ‘Kent’ mango subjected to controlled water deficit in semi-arid region

ABSTRACT Brazil is the seventh largest producer of mangoes in the world, and the São Francisco Valley is the main producing region, with ‘Kent’ as one of the main cultivars. Considering that irrigation management affects physiological events, production and fruit quality, the objective of this work was to evaluate the gas exchange in the leaves and fruit quality of ‘Kent’ mango subjected to controlled water deficit in the semi-arid region. The experiment was carried out in Petrolina-PE, semi-arid region of the São Francisco Valley. The experimental design used was randomized blocks, in a triple factorial scheme, with four irrigation depths (40, 60, 80 and 100% of crop evapotranspiration - ETc), three phenological stages (F1 - flowering, F2 - fruit growth, F3 - fruit maturation) and two production cycles (2018 and 2019), with four replicates. During the phenological stages, the physiological parameters of gas exchange were evaluated. After harvesting, the following parameters were evaluated: soluble solids content, titratable acidity, pH, firmness and peel color. Irrigation with a depth between 79.5 and 83.6% ETc during the evaluated stages promoted greater gas exchange in the leaves, greater firmness and acidity in the fruits. The reduction in irrigation depth in F1 and F3 reduced the soluble solids content, while in F2 the highest soluble solids content was obtained with irrigation between 68.24 and 74.5% ETc. The most suitable irrigation depth for ‘Kent’ mango cultivation depends on the purpose of the producer and on the phenological stage of the crop.

1H NMR-based metabolomic approach combined with machine learning algorithm to distinguish the geographic origin of huajiao (Zanthoxylum bungeanum Maxim.)

Chinese prickly ash, or huajiao (Zanthoxylum bungeanum Maxim), is the widely favored species of this spice by both the agricultural industry and the gourmet market. The geographic origin of the spice can add value, creating challenges for quality control and brand protection. In this study, 160 samples from four main production regions were analyzed by 1H NMR spectroscopy for the first time. Data analysis was performed based on 32 non-polar metabolites. Several machine learning algorithms were tested to build classification models. The best modeling results were obtained by using the non-linear discriminant random forest model, achieving an overall accuracy of 100% for the training set, 95.7% for the test set, and 87.5% for the blind dataset. The main marker compounds responsible for distinguishing these four origins were linalool, linalyl acetate, nonanal, and ocimene. This study provides a method to use 1H NMR combined with chemometrics to determine the origin of the huajiao.

Population dynamics of migrant wheat aphids in China's main wheat production region and their interactions with bacterial symbionts.

Sitobion miscanthi, Rhopalosiphum padi, and Schizaphis graminum are the three main pests in Chinese wheat-producing regions. In 2020, they are classified into the Chinese Class I list of agricultural diseases and pests, due to their severe harm to wheat plantings. S. miscanthi, R. padi, and S. graminum are migrant pests, and understanding their migration patterns and simulating their migration trajectories would improve forecasting and controlling them. Furthermore, the bacterial community of the migrant wheat aphid is also less known. In this study, we employed a suction trap to uncover the migration patterns of the three wheat aphid species in Yuanyang county, Henan province, during 2018 to 2020. And then the migration trajectories of S. miscanthi and R. padi were simulated using the NOAA HYSPLIT model. The interactions between wheat aphids and bacteria were further revealed by specific PCR and 16S rRNA amplicon sequencing. The results showed that the population dynamics of migrant wheat aphids was varied. Most of the trapped samples were identified to be R. padi, and S. graminum was the least collected sample. Typically, R. padi had two migration peaks in the 3 years, whereas S. miscanthi and S. graminum only exhibited one migration peak in 2018 and 2019. Moreover, the aphid migration trajectories varied over the years. Generally, the aphids originated from the south and migrated to the north. Herein, the infections of three main aphid facultative bacterial symbionts, Serratia symbiotica, Hamiltonella defensa, and Regiella insercticola, were detected in S. miscanthi and R. padi with specific PCR. Rickettsiella, Arsenophonus, Rickettsia, and Wolbachia were further identified with 16S rRNA amplicon sequencing. Biomarker searching indicated that Arsenophonus was significantly enriched in R. padi. Furthermore, diversity analyses showed that the bacterial community of R. padi had a higher richness and evenness than that of S. miscanthi. In conclusion, this study expands our knowledge about the migration patterns of aphids in the main wheat plant region of China and reveals the interactions between bacterial symbionts and migrant aphids.

Characterization of key odor-active compounds in Chinese Dornfelder wine and its regional variations by application of molecular sensory science approaches

In this study, aroma characteristics and odor-active compounds in Dornfelder wines from three main production regions of China were comprehensively investigated for the first time. The leading features of Chinese Dornfelder wines were black fruit, violet, acacia/lilac, red fruit, spice, dried plum, honey, and hay based on check-all-that-apply. Wines from the Northern Foothills of Tianshan Mountains and Eastern Foothills of Helan Mountains were dominated by floral and fruity aromas, while wines from the Jiaodong Peninsula were characterized by mushroom/earth, hay, and medicinal material notes. Aroma profiles of Dornfelder wines in three regions were successfully reconstructed with 61 volatiles determined by AEDA-GC-O/MS and OAV. Through aroma reconstitution, omission tests, and descriptive analysis, terpenoids could be regarded as varietal characteristic compounds directly contributing to floral perception in Dornfelder wines. Guaiacol, eugenol, and isoeugenol were further revealed to have a synergistic effect with linalool and geraniol on violet, acacia/lilac, spice, and black fruit.

Fungal Biomarkers in Traditional Starter Determine the Chemical Characteristics of Turbid Rice Wine from the Rim of the Sichuan Basin, China.

The fungal community in Qu plays a key role in the formation of turbid rice wine (TRW) style. The Sichuan Basin and its surrounding areas have become one of the main TRW production regions in China; however, the fungal community in Qu and how they affect the characteristics of TRW remain unknown. Therefore, this study provided insight into the fungal biomarkers in Qu from Guang'an (GQ), Dazhou (DQ), Aba (AQ), and Liangshan (LQ), as well as their relationships with compounds in TRW. The main biomarkers in GQ were Rhizopus arrhizus, Candida glabrata, Rhizomucor pusillus, Thermomyces lanuginosus and Wallemia sebi. However, they changed to Saccharomycopsis fibuligera and Mucor indicus in DQ, Lichtheimia ramose in AQ, and Rhizopus microsporus and Saccharomyces cerevisiae in LQ. As a response to fungal biomarkers, the reducing sugar, ethanol, organic acids, and volatile compounds were also changed markedly in TRWs. Among important volatile compounds (VIP > 1.00), phenethyl alcohol (14.1-29.4%) was dominant in TRWs. Meanwhile, 3-methyl-1-butanol (20.6-56.5%) was dominant in all TRWs except that fermented by GQ (GW). Acetic acid (29.4%) and ethyl palmitate (10.1%) were dominant in GW and LW, respectively. Moreover, GQ biomarkers were positively correlated with acetic acid and all unique important volatile compounds in GW. DQ biomarkers had positive correlations with unique compounds of acetoin and ethyl 5-chloro-1,3,4-thiadiazole-2-carboxylate in DW. Meanwhile, the AQ biomarkers were positively correlated with all AW unique, important, and volatile compounds. Although there were not any unique volatile compounds in LW, 16 important volatile compounds in LW were positively related to LQ biomarkers. Obviously, biomarkers in different geographic Qu played vital roles in the formation of important volatile compounds, which could contribute specific flavor to TRWs. This study provided a scientific understanding for future efforts to promote the excellent characteristics of TRW by regulating beneficial fungal communities.

Strategies to improve the competitiveness of an agroindustrial system for a macauba based oil production in Minas Gerais State, Brazil

The Macauba palm has been studied because of increasing global interest in multipurpose resilient plants, with no food or energy competition. The crop encompasses an opportunity to social inclusion, profitable activity and environmental care in Brazil. However, for its production to be competitive, it demands a deeper analysis of how the Agroindustrial System (AIS) is currently organized and what is needed to go forward. The objectives of the present study were to characterize and evaluate the competitiveness of macauba AIS at the main Brazilian production region, the north of Minas Gerais State. Stakeholders engaged in fruit picking and processing segments were identified and characterized. In addition, strategic actions to strengthen this AIS were proposed. The framework used to evaluate the competitiveness of the AIS includes data gathering from field interviews, direct observations and analysis of the macauba AIS. Some challenges were picked from the direct observations such as the reliance of production on unfavourable environmental conditions, the deficiencies in technical assistance and the difficulty of farmers to access credit and public policies. Despite those hurdles, the examined AIS showed potential to expand and become competitive, promoting better conditions for the permanence of family farmers/ communities in the countryside. It is important to consider that macauba exploitation is getting to a point of transition from extractive activity to a systematized planting of the palm. Some strategies to boost this growth are better coordination among the agents acting in the AIS, establishment of more active R&D and technical assistance partnerships, capacity building/ training offerings, and provision of resources for investments intended for the sustainable development of the macauba AIS and market access.

Fungal Pathogens Associated with Crown and Root Rot in Wheat-Growing Areas of Northern Kyrgyzstan.

Fungal species associated with crown and root rot diseases in wheat have been extensively studied in many parts of the world. However, no reports on the relative importance and distribution of pathogens associated with wheat crown and root rot in Kyrgyzstan have been published. Hence, fungal species associated with wheat crown/root rot were surveyed in three main wheat production regions in northern Kyrgyzstan. Fungal species were isolated on 1/5 strength potato-dextrose agar amended with streptomycin (0.1 g/L) and chloramphenicol (0.05 g/L). A total of 598 fungal isolates from symptomatic tissues were identified using morphological features of the cultures and conidia, as well as sequence analysis of the nuclear ribosomal internal transcribed spacer (ITS) region, the translation elongation factor 1α (TEF1), and the RNA polymerase II beta subunit (RPB2) genes. The percentage of fields from which each fungus was isolated and their relative percentage isolation levels were determined. Bipolaris sorokiniana, the causal agent of common root rot, was the most prevalent pathogenic species isolated, being isolated from 86.67% of the fields surveyed at a frequency of isolation of 40.64%. Fusarium spp. accounted for 53.01% of all isolates and consisted of 12 different species. The most common Fusarium species identified was Fusarium acuminatum, which was isolated from 70% of the sites surveyed with an isolation frequency of 21.57%, followed by Fusarium culmorum, Fusarium nygamai, Fusarium oxysporum, and Fusarium equiseti, all of which had a field incidence of more than 23%. Inoculation tests with 44 isolates representing 17 species on the susceptible Triticum aestivum cv. Seri 82 revealed that Fusarium pseudograminearum and F. culmorum isolates were equally the most virulent pathogens. The widespread distribution of moderately virulent B. sorokiniana appears to be a serious threat to wheat culture, limiting yield and quality. With the exception of F. culmorum, the remaining Fusarium species did not pose a significant threat to wheat production in the surveyed areas because common species, such as F. acuminatum, F. nygamai, F. oxysporum, and F. equiseti, were non-pathogenic but infrequent species, such as Fusarium redolens, Fusarium algeriense, and F. pseudograminearum, were highly or moderately virulent. Curvularia inaequalis, which was found in three different fields, was mildly virulent. The remaining Fusarium species, Fusarium solani, Fusarium proliferatum, Fusarium burgessii, and Fusarium tricinctum, as well as Microdochium bolleyi, Microdochium nivale, and Macrophomina phaseolina, were non-pathogenic and considered to be secondary colonizers. The implications of these findings are discussed.