Lysozyme Gene Research Articles

Role of the tumor necrosis factor receptor-associated factor-type zinc finger domain containing protein 1 (TRAFD1) from the hard tick Haemaphysalis longicornis in immunity against bacterial infection

A tumor necrosis factor receptor-associated factor-type zinc finger domain containing protein 1 (TRAFD1) is a negative feedback regulator that controls excessive immune responses in vertebrates. The sequence of tick hemolymph TRAFD1 from the hard tick Haemaphysalis longicornis (HlTRAFD1) was analyzed after identification and cloning from the expressed sequence tag database. RT-PCR and Western blot analyses showed that HlTRAFD1 transcript and protein levels after blood feeding were present in all developmental stages, and the transcript level was consistently high in all organs examined from adult female ticks upon engorgement. Knockdown of HlTRAFD1 gene by RNA interference did not affect blood feeding or oviposition. However, HlTRAFD1 silencing affected the expression of the longicin gene, a defensin-like molecule, but not the lysozyme gene. Moreover, the survival rate of HlTRAFD1-silenced ticks was lower, and the number of E. coli was higher in the hemolymph and plasmatocytes after E. coli injection compared to the control group. These results suggested that HlTRAFD1 strongly affected both the humoral and cellular immunity of ticks.

Splice variants and regulatory networks associated with host resistance to the intestinal worm Cooperia oncophora in cattle

To elucidate the molecular mechanism of host resistance, we characterized the jejunal transcriptome of Angus cattle selected for parasite resistance for over 20 years in response to infection caused by the intestinal worm Cooperia oncophora. The transcript abundance of 56 genes, such as that of mucin 12 (MUC12) and intestinal alkaline phosphatase (ALPI), was significantly higher in resistant cattle. Novel splicing variants, exon skipping events, and gene fusion events, were also detected. An algorithm for the reconstruction of accurate cellular networks (ARACNE) was used to infer de novo regulatory molecular networks in the interactome between the parasite and host. Under a combined cutoff of an error tolerance (ϵ=0.10) and a stringent P-value threshold of mutual information (1.0×10−5), a total of 229,100 direct interactions controlled by 20,288 hub genes were identified. Among these hub genes, 7651 genes had ≥100 direct neighbors while the top 9778 hub genes controlled more than 50% of total direct interactions. Three lysozyme genes (LYZ1, LYZ2, and LYZ3), which are co-located in bovine chromosome 5 in tandem and are strongly upregulated in resistant cattle, shared a common regulatory network of 55 genes. These ancient antimicrobials were likely involved in regulating host–parasite interactions by affecting host gut microbiome. Notably, ALPI, known as a gut mucosal defense factor, controlled a molecular network consisting 410 genes, including 14 transcription factors (TF) and 10 genes that were significantly regulated in resistant cattle. Several large regulatory networks were controlled by TF, such as STAT6, SREBF1, and ELF4. Gene ontology (GO) processes significantly enriched in the regulatory network controlled by STAT6 included lipid metabolism. Our findings provide insights into the immune regulation of host–parasite interactions and the molecular mechanisms of host resistance in cattle.

Immunomodulatory effect ofCynodon dactylonagainst white tail disease of giant freshwater prawn,Macrobrachium rosenbergii(de Man, 1879)

The giant freshwater prawn, Macrobrachium rosenbergii, is an economically important and extensively cultured crustacean worldwide. The viral pathogens, Macrobrachium rosenbergii nodavirus (MrNV) and extra small virus (XSV) are responsible for causing severe mortalities in the hatchery and nursery phases. This study investigates the protection of postlarvae of freshwater against white tail disease (WTD) using plant extract derived from Cyanodon dactylon and the modulation of the prawn non-specific immunity. To determine the immunomodulatory effect of C. dactylon extract, the prawn was injected with plant extract and various immunological parameters were estimated. The immunological parameters such as proPO, SOD, THC and clotting time were found to be significantly higher in the plant extract-injected prawn when compared with control groups. The results of real time PCR analysis revealed up regulation on the expression proPO, SOD and lysozyme genes in MrNV and XSV challenged prawn postlarvae treated with C. dactylon extract. Infectivity experiment showed high relative per cent survival in MrNV and XSV-challenged prawn postlarvae treated with C. dactylon extract. These results strongly indicate that the administration of C. dactylon plant extract enhances immunity of the prawn. Based on the results, this study recommends that the immersion of postlarvae in C. dactylon plant extract is a potential prophylactic agent against WTD.

Effects of perfluorooctane sulfonate on the immune responses and expression of immune-related genes in Chinese mitten-handed crab Eriocheir sinensis

Perfluorooctane sulfonate (PFOS) has been widely studied due to its global distribution, slow degradation, high bioaccumulation and toxicological effects on vertebrates. However, the potential toxicity of PFOS to crustaceans is little known. The present study investigated the effects of PFOS on the immune responses and expression of immune-related genes in the Chinese mitten-handed crab Eriocheir sinensis. Crabs were exposed to 0, 0.01, 0.1, 1.0 and 10mg/L of PFOS, and sampled on 1, 4, 7, 14 and 21days respectively. The total hemocyte count and lysozyme activity in PFOS-treated crab were significantly lower than in the control. The exposure to 10mg/L of PFOS led to a marked inhibition in phenoloxidase and superoxide dismutase activities. At other PFOS levels, phenoloxidase and superoxide dismutase showed an initial increase and a subsequent decrease over time. The alkaline and acid phosphatase activities were stimulated in 10mg/L PFOS until 21days. The mRNA expression of immune related genes including hepatopancreas-specific C-type lectin and prophenoloxidase activating factors were up-regulated after the exposure to the concentrations of 1 and 10mg/L of PFOS, while the expression of lysozyme gene was up-regulated only in the crab exposed to 0.1mg/L PFOS. The results demonstrate that the high dose of PFOS leads to immune toxicity and the hepatopancreas is a major target organ for PFOS accumulation and immunotoxicity. Hemocyte counts, phenoloxidase and acid phosphatase are useful biomarkers for the risk assessment of PFOS toxicity to crustaceans.

Binary Vector Construction and Agrobacterium tumefaciens-mediated Transformation of Lysozyme Gene in Seaweed Kappaphycus alvarezii

Binary Vector Construction and Agrobacterium tumefaciens-mediated Transformation of Lysozyme Gene in Seaweed Kappaphycus alvarezii

Vztah mezi mikrosatelitním polymorfismem makrofágového projevu lysozymového (mLys) genu a vybranými vlastnostmi mléka polských černobílých krav

The experiment was performed in the years 1998–2000 on two farms located near to Vistula Lowlands. The experimental materials were comprised of 52 daughters of bull Paran, among which 21 possessed the mLys-mic 7 allele and 31 – the mLys-mic 3 allele. The serum and whey bacteriolytic activity of the lysozyme, concentrations of selected mineral elements, technological properties of milk at successive the first lactation stages (30, 100, 150 and 200 days), somatic cell count and bacterial count were investigated in this study. The results obtained indicate that Lys-mic polymorphism has low suitability as a marker for milk production capacity in cows. The lysozyme gene, treated as a mastitis resistance factor, showed no effects on somatic cell count and bacterial count. Further investigations, conducted not only during the first lactation, but also during the next lactation in a herd threatened by a variety of pathogenic factors, would be carried to validate this Lys-mic gene polymorphism on mastitis resistance.

Molecular cloning, recombinant protein expression, tissue distribution and functional analysis of a new c-type lysozyme from Lezhi black goat rumen

Zhang, P., Wang, Y., Jiang, M., Zhu, L., Li, J., Luo, M., Ren, H. and Liu, L. 2014. Molecular cloning, recombinant protein expression, tissue distribution and functional analysis of a new c-type lysozyme from Lezhi black goat rumen. Can. J. Anim. Sci. 94: 27-34. Three major distinct types of lysozymes have been identified in the animal kingdom and most lysozymes cloned from ruminants belong to the chicken-type (c-type). In this study, a new c-type lysozyme gene, named LZRLyz, was cloned and sequenced from the Lezhi black goat rumen. The LZRLyz cDNA has a 444 bp open reading frame (ORF) encoding a 147 amino acid polypeptide. The encoded polypeptide is predicted to have an 18 amino acid signal peptide, and a 129 amino acid mature protein with an isoelectric point (pI) of 6.08. The LZRLyz amino acid sequence shares 70.27% identity with the Capra hircus blood lysozyme and is grouped with other ruminants c-type lysozymes using the phylogenetic tree estimated by Neighbor-Jointing method. The recombinant express...

359 A NONINVASIVE APPROACH TO DIAGNOSE TRANSGENIC CONCEPTI DURING PREGNANCY IN GOATS

The discovery of cell-free fetal DNA (cffDNA) circulating in the blood of pregnant women, and more recently in cows, ewes, and mares, paves the road towards the development of molecular tools to explore genetic features of embryos and/or fetuses before term. Albeit a wide range of analyses are in current use and development in humans, genetic diagnostic targets other than sex determination are still not described for other mammalian species. The aim of this study was to detect cffDNA from transgenic goat concepti for the human lysozyme (hLZ) gene in the blood of nontransgenic dams. Blood was collected from 3 nontransgenic goats carrying hLZ-transgenic concepti on Days 40–50, 80–90, and 110–120 of gestation. Also, blood was drawn 8 and 12 days after parturition from two other nontransgenic goats that delivered hLZ-transgenic offspring. Blood samples (10 mL) were spun at 1200 rpm for 10 min; resulting serum or plasma were stored at –20°C (serum) or 4°C (plasma). The DNA was extracted by mixing 350 µL of serum or plasma with an equal volume of TE buffer and 5 µL of proteinase K (20 mg mL–1). The mixtures were incubated at 55°C for 3 h, followed by phenol extraction and DNA precipitation by sodium acetate and 100% ethanol, with further incubation at –20°C overnight and centrifugation at 12 000 × g for 10 min. The DNA pellets were washed with 70% ethanol and eluted in 20 µL of ultrapure water. For the PCR, primer sets for the hLZ transgene (hLZ-i1-F 5′ CGGTCCAGGGCAAGGTCTTTGA 3′ and hLZ-i1-R 5′ ACTGCTCCTGGGGTTTTGCC 3′) and for GAPDH as the endogenous control were used. Reactions contained 3 µL of DNA, 200 nM of each primer, and 45 µL of PCR Mastermix (Quatro G Pesquisa & Desenvolvimento, Porto Alegre, Brazil). The DNA from serum and plasma of nontransgenic goats were used as negative controls. The cycling conditions were 95°C for 10 min, followed by 55 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s, plus a final extension at 72°C for 10 min. The PCR products were analysed by electrophoresis in 2% agarose gel. As expected, GAPDH was amplified in most of the samples (12/13). The 200-bp PCR product corresponding to hLZ was detected in the dam's serum in all 3 gestational phases, with 2 out of 3 animals being positive on 40 to 50 and 80 to 90 days, and all 3 on 110 to 120 days of pregnancy. Furthermore, the transgene was amplified from dam's plasma in all samples after parturition. Only GAPDH amplification was detected in the blood of nontransgenic goats. These results suggest that cffDNA is present in the goat's blood circulation at the fetal phase during pregnancy and at least during the first 2 weeks after parturition. This method can be safely applied as a useful tool in zygote-DNA microinjection experiments, providing an early and preterm diagnostic of transgenic concepti through the dam's blood.Research was supported by FINEP.

Biology wars: the eukaryotes strike back.

It is increasingly clear that eukaryotes have acquired bacterial DNA and function through horizontal genetransfer (HGT). In this issue of Cell Host & Microbe, Chou etal. (2014) and Metcalf etal. (2014) report multiple HGTs of bacterial tae and lysozyme genes, respectively, to diverse eukaryotic and archaeal hosts that may complement their response to bacteria.

Transcriptional Onset of Lysozyme Genes during Early Development in Olive Flounder (Paralichthys olivaceus).

The immune system in teleost fish is not completely developed during embryonic and larval stages, therefore effective innate mechanisms is very important for survival in such an environment. However, the knowledge of the development of immune system assumed to be restricted. In many species, lysozymes have been considered as important genes of the first line immune defense. The early detection of lysozyme mRNA in previous reports, led to the investigation of its presence in oocytes. As a result, c-type lysozyme mRNA transcripts were detected in unfertilized oocytes indicating maternal transfer. Therefore, we investigated the expression patterns of lysozymes in flounder, including the matured oocyte. In our results, c-type lysozyme mRNA was first detected in unfertilized oocyte stage, observed the significantly decreased until hatching stage, and was significantly increased after hatching stage. On the other hand, g-type lysozyme mRNA transcripts were first detected at late neurula stage, and the mRNA level was significantly increased after 20 dph. It may be suggest that maternally supplied mRNAs are selectively degraded prior to the activation of embryonic transcription. This study will be help in understanding the maturation and onset of humoral immunity during development of olive flounder immune system.

Transcriptional Onset of Lysozyme Genes during Early Development in Olive Flounder (Paralichthys olivaceus)

ABSTRACTThe immune system in teleost fish is not completely developed during embryonic and larval stages, therefore effective innate mechanisms is very important for survival in such an environment. However, the knowledge of the development of immune system assumed to be restricted. In many species, lysozymes have been considered as important genes of the first line immune defense. The early detection of lysozyme mRNA in previous reports, led to the investigation of its presence in oocytes. As a result, c-type lysozyme mRNA transcripts were detected in unfertilized oocytes indicating maternal transfer. Therefore, we investigated the expression patterns of lysozymes in flounder, including the matured oocyte. In our results, c-type lysozyme mRNA was first detected in unfertilized oocyte stage, observed the significantly decreased until hatching stage, and was significantly increased after hatching stage. On the other hand, g-type lysozyme mRNA transcripts were first detected at late neurula stage, and the mRNA level was significantly increased after 20 dph. It may be suggest that maternally supplied mRNAs are selectively degraded prior to the activation of embryonic transcription. This study will be help in understanding the maturation and onset of humoral immunity during development of olive flounder immune system.

Expression of c-type lysozyme gene in sea cucumber (Apostichopus japonicus) is highly regulated and time dependent after salt stress.

Lysozymes have been confirmed to possess varieties of functions in a range of organisms. In the present study, we cloned and sequenced c-type lysozyme cDNAs, constructed the recombinant protein over-expression of c-type lysozyme and analyzed the expression of transcription level in various tissues. The c-type lysozyme cDNA contained an open reading frame of 759bp encoding a polypeptide of 252 amino acids. The molecular weight of the deduced amino acid of AjcLYZ is 26.7kDa with an estimated pI of 4.66. Multiple sequence alignments revealed that AjcLYZ had two highly conserved active sites (Glu147 and Asp159) and eight typical Cys residues. The tertiary structure and modeled AjcLYZ showed structural similarity to Meretrix lusoria LYZ. The results of mRNA transcripts showed that the highest expression was found in the tube foot, followed by the muscle, body wall, and coelomic fluid. In contrast, the intestine, tentacle and respiratory tree exhibited very low expression levels. Under salinity stress, significant down-regulation of AjcLYZ was observed in response to salinity stress in the intestine and coelomic fluid. Significant up-regulation and down-regulation of AjcLYZ were observed in response to salinity stress in body wall and respiratory tree. The purified recombinant protein was analyzed by SDS-PAGE and a single band with a molecular mass of 45.09kDa, which was in agreement with the theoretical size (26.7kDa for AjcLYZ and 18.39kDa Trx-His-S tags) of the recombinant protein. Radial diffusion assay was employed to determine the antimicrobial spectrum of recombinant AjcLYZ against three Gram-positive and Gram-negative bacteria, and three sea cucumber pathogenic Vibrio species. From the radius of the antimicrobial zone, it was found that recombinant AjcLYZ harbored remarkable in vitro inhibitive effect on tested Gram-positive bacteria, while lytic activity against Gram-negative bacteria was relatively weak. The results will provide new clues about the molecular mechanisms that regulate the salinity adaption system.

Impact of using different promoters and matrix attachment regions on recombinant protein expression level and stability in stably transfected CHO cells.

High expression level and long-term expression stability are required for therapeutic protein production in mammalian cells. Three commonly used promoters from the simian virus 40 (SV40), the CHO elongation factor 1α gene (EF1α), and the human cytomegalovirus major immediate early gene (CMV) and two matrix attachment regions from the chicken lysozyme gene (cMAR) and the human interferon β (iMAR) were evaluated for enhancing recombinant gene expression level and stability in stably transfected CHO cells. In the absence of MAR elements, the SV40 promoter gave lower expression level but higher stability than the EF1α promoter and the CMV promoter. The inclusion of MAR elements did not increase the integrated gene copies for all promoters but did enhance expression level for only the SV40 promoter. The enhanced gene expression was due to an increase in mRNA levels. Neither MAR elements enhance gene expression stability during long-term culture. The combinations of SV40 promoter and MAR elements are the best for obtaining both high expression level and stability. The information presented here would be valuable to those developing vectors for generation of CHO cell lines with stable and high productivity.

An N-acetyllactosamine-specific lectin, PFA, isolated from a moth (Phalera flavescens), structurally resembles an invertebrate-type lysozyme

PFA (Phalera flavescens agglutinin) lectin purified from larvae of the lobster moth (P. flavescens) shows a strong binding ability specific to the N-acetyllactosamine (Galβ1-4GlcNAc) site. We determined the genomic and cDNA sequences of the PFA gene, which consists of five exons and spans approximately 5 kb of a genomic region. Surprisingly, the amino acid sequence (149 amino acids) was similar to invertebrate-type lysozymes and related proteins. The predicted tertiary structure of the PFA protein was similar to the lysozymes of clams such as the common orient clam (Meretrix lusoria) and Japanese littleneck (Venerupis philippinarum (Tapes japonica)). The PFA, however, lacks a catalytically essential amino acid, an Asp (D), which is one of the two important amino acids (Glu (E) and D) express the function of lysozyme. As a result, lysozyme activity assays indicated that PFA does not have lysozyme activity. Results suggest that the PFA gene evolved from a lysozyme gene through the loss of lysozyme activity sites and the acquisition of lectin activity during evolution of the genus Phalera.

A new family with hereditary lysozyme amyloidosis with gastritis and inflammatory bowel disease as prevailing symptoms.

BackgroundSystemic amyloidoses is a heterogeneous group of diseases either acquired or hereditary. Amyloidoses can involve the gastrointestinal tract and the nature of the precursor protein that forms the fibrils deposits should be identified to adjust the treatment and evaluate the prognosis. Lysozyme amyloidosis (ALys) is a rare, systemic non neuropathic hereditary amyloidosis with a heterogenous phenotype including gastrointestinal, renal and hepatic symptoms.Case presentationWe report and describe symptoms and gastrointestinal tract involvement in a new family with hereditary lysozyme amyloidosis. Clinical manifestations and organ involvement of nine affected members of a new family with the p.Trp82Arg ALys variant were recorded. All affected individuals suffered with prevailing gastrointestinal symptoms leading to the diagnosis of ALys. 8/9 had non specific upper gastrointestinal symptoms and 3/9 had rectocolic inflammation evoking inflammatory bowel disease. No other organ involvement by amyloidosis was found. Histological examination revealed amyloid deposits in all cases and all carried the p.Trp82Arg ALys variant at a heterozygous state.ConclusionHereditary amyloidosis associated with the p.Trp82Arg lysozyme variant in this new family is predominantly associated with mild upper gastrointestinal tract involvement and in some cases with inflammatory bowel disease. Amyloidosis should be considered in atypical or treatment resistant, upper or lower chronic gastrointestinal symptoms. When associated with a familial history a lysozyme gene mutation must be searched.

Dietary fermentable fiber upregulated immune related genes expression, increased innate immune response and resistance of rainbow trout (Oncorhynchus mykiss) against Aeromonas hydrophila

This trial was carried out to investigate the effects of dietary administration of Vitacel®, a commercial fermentable fiber, on immune related genes (Lysozyme, TNFα and HSP70) expression, innate immune response and resistance of rainbow trout against Aeromonas hydrophila. 120 healthy rainbow trout (81.65 ± 1.49 g) were distributed in six fiberglass tanks assigned to two treatments. The treatments were feeding rainbow trout with diets supplemented with 0 (control) or 10 g kg−1 Vitacel® for 45 days. The results revealed that administration of fermentable fiber significantly (P < 0.05) upregulated lysozyme and TNFα gene expression. HSP70 gene expression was significantly lower in Vitacel® fed fish at the end of trial (P < 0.05). Furthermore dietary administrations of Vitacel® remarkably elevated rainbow trout innate immune parameters include serum lysozyme, ACH50, bactericidal activity and agglutination antibody titer (P < 0.05). Administration of 10 g kg−1 Vitacel® significantly increased rainbow trout resistance against A. hydrophila (P < 0.05). The results of present study revealed that dietary Vitacel® can upregulates immune related genes expression and elevates innate immune response and disease resistance of rainbow trout.

Third party annotation gene data set of eutherian lysozyme genes.

The eutherian comparative genomic analysis protocol annotated most comprehensive eutherian lysozyme gene data set. Among 209 potential coding sequences, the third party annotation gene data set of eutherian lysozyme genes included 116 complete coding sequences that first described seven major gene clusters. As one new framework of future experiments, the present integrated gene annotations, phylogenetic analysis and protein molecular evolution analysis proposed new classification and nomenclature of eutherian lysozyme genes.

A novel minisequencing single-nucleotide polymorphism marker of the lysozyme gene detects high hatchability of Tsaiya ducks (Anas platyrhynchos)

Lysozyme, one of the major albumen antimicrobials, can break down the polysaccharide walls of a broad spectrum of bacteria. This study presents a novel lysozyme marker of high hatchability in the form of minisequencing single-nucleotide polymorphisms (SNPs). Recently, lysozyme was identified by complementary DNA microarray analysis as one of several differentially expressed genes noted to influence hatchability and recognized as a marker candidate for animal marker-assisted selection. Higher levels (P < 0.05) of lysozyme mRNA (via real-time polymerase chain reaction analysis) and protein (in Western blotting results) were found to be associated with a high-hatchability phenotype. In the preliminary sequence analysis of this study, TsLy1-1 and TsLy1-2 primer pairs, designed according to the lysozyme sequence, were used to amplify small-scale genomic DNA samples from animals in two extreme groups of hatchability. Sequence analysis of the amplified 763-bp DNA products clearly showed that AA and GG genotypes of SNP g.390A > G were from the ducks of the low- and high-hatchability groups, respectively. The SNP g.390A > G also created a new specificity protein 1 transcription factor binding site in the lysozyme gene. Primer pairs of TsLy2-1 and TsLy2-2 then probed the amplified 763-bp DNA products to produce a shorter fragment for easier minisequencing analysis to divide 114 ducks into GG, GA, and AA genotypes. The GG ducks had the highest hatchability, representing that a new lysozyme SNP marker of good hatchability performance can be used for the purpose of marker-assisted selection in Tsaiya ducks.

Cloning, characterization, and production of a novel lysozyme by different expression hosts.

Lysozyme is a protein found in egg white, tears, saliva, and other secretions. As a marketable natural alternative to preservatives, lysozyme can act as a natural antibiotic. In this study, we have isolated Bacillus licheniformis TIB320 from soil, which contains a lysozyme gene with various features. We have cloned and expressed the lysozyme in E. coli. The antimicrobial activity of the lysozyme showed that it had a broad antimicrobial spectrum against several standard strains. The lysozyme could maintain efficient activities in a pH range between 3 and 9 and from 20°C to 60°C, respectively. The lysozyme was resistant to pepsin and trypsin to some extent at 40°C. Production of the lysozyme was optimized by using various expression strategies in B. subtilis WB800. The lysozyme from B. licheniformis TIB320 will be promising as a food or feed additive.

Identification and characterization of a novel phage-type like lysozyme from Manila clam, Ruditapes philippinarum

A novel lysozyme gene (RpLysPh) with high similarity to the bacteriophage lysozymes was identified in Manila clam, Ruditapes philippinarum. The full length cDNA of RpLysPh is 828bp and contains a 462bp open reading frame (ORF) that codes for a 154 amino acid protein. Multiple sequence alignment analysis revealed that the three residues essential for catalytic activity in phage-type lysozyme (Glu20, Asp29, and Thr35) are conserved in RpLysPh. The comparison of the 3D models of RpLysPh and Coxiella burnetii lysozyme also suggested that the active sites involved in the binding of substrate have similar conformations. Phylogenetic analysis suggested that RpLysPh shares a similar origin with the bacterial phage-type lysozyme group. The highest level of expression of RpLysPh was observed in hemocytes, followed by mantle. Induction of RpLysPh expression was observed in gills in response to lipopolysaccharide (LPS), peptidoglycan (PGN), polyinosinic–polycytidylic acid (Poly(I:C)), and whole glucan particles (WGP) challenge. The recombinant protein of RpLysPh showed antibacterial activity against both Gram-positive and Gram-negative bacteria.