Lubuskie Region Research Articles

Renovation of the Lapidarium in Kożuchów

Sacred monuments are an important part of the landscape of the Lubuskie region. Kożuchów, a small town some 30 km from the provincial capital Zielona Góra, is a town with a long and rich history, whose area is full of buildings in need of care. One of the important elements in its landscape is the museum of gravestone sculpture - the Lapidarium. The sepulchral lapidarium in Kozuchow is one of the best-preserved sets of tomb sculpture in Poland. It was established in the 1970s on the site of a former Protestant cemetery, for the establishment of which the Evangelical community received permission in 1634. Restoration work is in progress to preserve and protect this regionally and nationally significant sacred monument. In this article, the authors present the renovation processes underway since 2018 and the stages planned for the coming years. The purpose of this article as to point out the remarkable regional importance of a unique example of a sacred monument, which is the Lapidarium in Kozuchow. The uniqueness of the gravestone sculptures with epitaphs contained therein, their exceptional level of craftsmanship and state of preservation predispose the Lapidarium to be saved from destruction and made available to the public.

Śladami Żydów na Ziemi Lubuskiej. Ziemia Międzyrzecka – dziedzictwo materialne

The authors aim to present examples of the material legacy of the presence of Jews, the potential of Jewish cultural heritage that the Lubuskie Region has at its disposal in terms of the area of the contemporary Lubuskie Voivodeship. For many, not only the inhabitants of the area in question, but Poles as a nation, the heritage left in our lands by the Jewish community remains unrealized. That is why it needs to be exposed, described and communicated to those who live here today. At this stage of research, we are interested in material heritage - existing and non-existent. This article is the first in the series and the considerations are focused on the area of Międzyrzecz Land understood as the area of the contemporary Międzyrzecki poviat.

Two Buddhist figures – An Interesting Case from the Museum of Lubuskie Region in Zielona Góra

Two Buddhist figures – An Interesting Case from the Museum of Lubuskie Region in Zielona Góra

Sustainable Consumption in the Behavior of Young Consumers

The aim of the article is to characterize the attitude of young consumers towards the concept of sustainable consumption in the area of food consumption, which is manifested, among others, in the declared engagement in sustainable behaviors both in the market as well as in households. The research was conducted using the CAWI method on a sample of Polish consumers from the Lubuskie region. The article consists of two parts. The first part explores the problems of sustainable consumption. The second part presents the results of research on consumer attitudes towards the concept of sustainable consumption in the area of food consumption. Particular attention was paid to the awareness of the implications of consumer behavior in the process of satisfying food needs. Behaviors, attitudes and beliefs of consumers related to sustainable consumption were characterized, and an attempt was subsequently made to determine the extent of the gap existing between behaviors and attitudes. The conducted survey research constituted an attempt at highlighting certain consumption problems among young people, to have them share their views on the different issues of sustainable consumption, as well as to emphasize the importance of various factors in shaping sustainable food consumption patterns. The article certainly is not an exhaustive examination of all the problems areas of sustainable consumption, but it should make these more easily identifiable all while stressing the real role and importance of sustainable behaviors among young consumers in the modern economy.
 Keywords: sustainable consumption, sustainable development, young consumer.

Lektura Lubuskich podróży ze smakiem peregrynacją dla przyjemności i intelektualną wędrówką po wiedzę (spojrzenie filologa-lingwokulturologa

The extraordinary character of a contemporary ‘Baedeker’-type culinary-tourist guide,whichappeals to the senses of its reader, is perfect to showcase the region al specialties of the Lubuskie Region. Such a guide will also act as an inspiration to consider the richness and diversity of the Lubuskie Region. The subject, and thus the objective of this articleis to prezent Lubuskie’s culinary heritage and, throughit, the virtues of Lubuskie’s fauna and flora, the advantages of Lubuskie’s agrotourism farms and Lubuskie’s ethnotourism. The spiritual/symbolich eritagethatis preserved in this guideshows off the Lubuskie Region as an attractive are a where the past is an integral part of the present.

Przestępstwa popełnione przez żołnierzy Armii Czerwonej na Środkowym Nadodrzu po zakończeniu II wojny światowej (1945–1946) w świetle repertoriów Prokuratury Sądu Okręgowego w Zielonej Górze

The western and northern territories of Poland (former German territory) were a troubled area in the few months after the end of the war. In the first post-war period, there were no stable power structures, including organs of justice and public order. The prevailing state of anarchy in this territory was the reason for an increase in crime. The perpetrators of crimes were not only civilian settlers but also Red Army soldiers stationed in the area. It should be emphasized that they often treated the territories of the western and northern territories as a conquered territory, and not as part of an allied state. The author presents the issue of post-war criminality in the Lubuskie Region (the so-called recovered territory), where the perpetrators were soldiers of the Red Army. This article was developed on the basis of the indexes of Prosecutor’s Office of the Regional Court in Zielona Góra from 1945-1946. The prosecutor’s office of the Regional Court in Zielona Góra, like the Regional Court in Zielona Góra, started its operation in the early autumn of 1945. Initially, the judiciary and public order authorities in the Lubuskie Region were struggling with personnel and organizational problems typical of the post-war period, therefore their effectiveness in prosecuting and preventing crime was relatively low. Moreover, it should be remembered that the Red Army soldiers were not subject to the jurisdiction of Polish courts and the prosecutor’s office. Cases concerning crimes committed by Soviet soldiers, registered by the prosecutor’s office in Zielona Góra, were transferred to the Military Prosecutor’s Office of the Red Army in Poznań.

(Circular) Path Dependence—The Role of Vineyards in Land Use, Society and Regional Development—The Case of Lubuskie Region (Poland)

The main goals of the article are: (a) presentation of the wine traditions of the region in the context of the concept of path dependence and wastescapes, as well as their impact on the spatial, social and promotional aspect of wine making; (b) identification and characteristics of the vineyards in Lubuskie Region in 2021; and (c) linking wine traditions with creating the identity of the region and implementing activities supporting its development. A case study was performed in accordance with the triangulation of research methods and techniques: (1) analysis of existing data and relating them to the activities of vineyards; (2) covert participant observation technique; and (3) qualitative field interviews with vineyard owners or managers. The vineyards of the Lubuskie Region are an important tourist attraction and local wines enrich the local food offers. However, the scale of production, still being rather small, comes with higher costs of obtaining the final product. At the social level, wine-growing activity presents a great deal of value and importance, and appears to be a reflection of positive endeavours. Wine making in the region is a complex example of contemporary cultural and social processes that are only just beginning to be observed in area.

High school students’ attitudes towards SARS-CoV-2 pandemic: an online cross-sectional survey

BackgroundAdolescents play a major role in SARS-CoV-2 spread. The study objective was to assess COVID-19 attitudes among Polish final year high school students.MethodsAn online cross-sectional survey was conducted between December 2020-March 2021; 24 high schools were randomly selected in Lubuskie region, followed by a random selection of 51 classes. Students' attitudes were assessed by an anonymous questionnaire before an online lecture on SARS-CoV-2.ResultsResponse rate was 72%, 638 students responded (360 females, mean age 18.4±0.6 years); 438 attended schools in towns with <100,000 inhabitants; 201 were in the science program; 7.4% reported past SARS-CoV-2 infection (5% females vs 10.8% males; p = 0.006). 52.2% believed COVID-19 is a serious disease (more females, those in larger cities and in the science program, p = 0.02; p < 0.001; p < 0.001 respectively). However, 71.3% were not afraid of getting SARS-CoV-2 infection (more males and those not in the science program, p = 0.0007; p = 0.01 respectively); 59.1% were concerned that their parents and 68.7% their grandparents will get COVID-19 (more females, those in larger cities and in the science program, both: p = 0.0004; p = 0.004; p = 0.0005 respectively). Only 16.5% believed that government recommendations effectively control the epidemic (more in the science program; p = 0.01); 44.6% supported lockdown as an effective strategy (more those in larger cities and in the science program; both: p < 0.001).ConclusionsThe findings show low awareness of SARS-CoV-2 infection risk, deficiencies in appropriate attitudes and lack of trust regarding the epidemic management among the high school students. Given attitudes determine people's actions, to limit SARS-CoV-2 transmission and strengthen positive attitudes further investigation into the factors underlying the lack of risk perception is warranted.Key messages The study provides perspectives of youth for policymakers that should be taken into account while implementing educational programs related to COVID-19.We recommend implementing COVID-19 knowledge into school curricula to improve students’ risk perception and attitudes.

Practices towards SARS-CoV-2 transmission prevention among Polish high school students

BackgroundAdolescents play a significant role in SARS-CoV-2 spread. The study objective was to assess practices towards COVID-19 among final year Polish high school students.MethodsBetween December 2020-March 2021 an online cross-sectional survey was conducted. Multistage random sampling selected 24 high schools in the Lubuskie region then 51 classes. Students' practices were assessed by an anonymous questionnaire. Significance was tested by Chi-square test.ResultsResponse rate was 72.3%; 638 students (360 females) participated (mean age 18.4±0.6 years); 68.7% attended schools in the cities with <100,000 inhabitants; 31.5% were in the science program. Most (81.3%) declared they always used masks in public spaces in the last month (74.3% males vs 86.1% females, p < 0.001; 77.2% of those living in smaller vs 90.5% in larger cities, p < 0.001; 89.6% in the science program vs 77.6% - in the other programs, p < 0.001); 35% always avoided crowded areas (26.9% males vs 39.4% females, p = 0.001; 29.5% living in smaller vs 47% in larger cities, p < 0.001; 43.8% in the science program vs 30.9% - in the other programs, p = 0.002); 24.3% declared always keeping social distance (19.4% males vs 27.2% females, p = 0.02), 29.9% stated they did not touch their faces (25% males vs 33.3% females, p = 0.02; 27.2% living in smaller vs 36% in larger cities, p = 0.02; 37.8% in the science program vs 26.3% - in the other programs, p = 0.003). Among those wearing masks - uncovered noses (64.6%) and masks around the neck (42.3%; 48.1% males vs 38.9% females, p = 0.02) were the most frequent incorrect practices.ConclusionsMost high school students, in particular males, living in small cities and attending non-science program have inappropriate preventive practices towards COVID-19. Health education programs are urgently needed to better equip students with COVID-19 prevention skills.Key messages The study shows data of final year high-school students' practices towards COVID-19 and maybe used by public health experts to better address educational campaigns oriented to Polish adolescents.Health education aimed at high school students would be crucial to improve compliance with SARS-CoV-2 infection control procedures.

Implementation of Food Retail Functions in Poland in the SARS-CoV-2 Pandemic

Retail trade is one of many links of the food supply chain to the consumer. Therefore, the efficiency of its operation is influenced by the earlier located links in the chain, first of all by agriculture, processing, logistics, and wholesale trade, as well as by consumers. The research problem in this paper, specified in the form of questions, is as follows: Has the 2020 pandemic reduced the performance of food retailing functions in less-developed regions of Poland? What is the assessment of the degree of their implementation? What directions should be taken at the micro and macro level to increase resilience to the negative effects of future crisis phenomena, in the implementation of the functions of this trade? The cognitive aim of the study was to examine the degree of performance of economic and social functions by the food retail trade in Poland, after one year of the SARS-CoV-2 pandemic (with the example of the Lubuskie region). For its implementation, four research hypotheses were formulated. The work was carried out in three stages, theoretical-interpretative, methodological, empirical, and consisted of three parts. In the experimental part, the method of CATI interviews with store owners/managers and the method of advanced statistics, classification, and visualization were used. The article brings new cognitive and normative value concerning food retailing in Poland. The results of the study enabled the realization of the aim of the paper and the verification of the hypotheses. The conclusions are presented in the summary of the individual parts of the empirical data analysis and in the conclusion of the paper. The paper contributes to the literature a new recognition of the degree of performance of the seven examined functions by food retail units, during the pandemic.

Development of the Market of Traditional Food Products in the Lubuskie Region in the Years 2006-2020

Abstract The paper discusses the issue of the development of the market of traditional food products in the Lubuskie province. Legal and institutional aspects of the development of the market are presented and the significance of the system of the European Union is stressed. The analysis was carried out from the point of view of sustainable development of the sector and according to the product structure as well as location of selected elements of the system of distribution. The aim of the paper is to identification and structuring of traditional food products in the Lubuskie region. Types of traditional products manufactured and sold on the market are presented, the research was conducted on the basis of secondary sources by means the analysis of information provided by the Ministry of Agriculture and Rural Development in the years 2006-2020. Changes which have taken place in the system of distribution are shown, and in particular local market places offering direct contact between producers and consumers of regional products. The analysis demonstrates increased interest in this market among regional producers.

The Polish People’s Republic State Apparatus and the Roma people in the Lubuskie Region

Abstract The article analyzes the situation of the Roma people in the Lubuskie Region in the years 1945-1989. Being part of the so-called “Western Territories”, the Lubuskie Region, first as the Zielona Góra Voivodship and later divided into Zielona Góra Voivodship and Gorzów Voivodship, attracted a number of ethnic minorities, including Gypsies. “e article presents how local political and security authorities reacted to the presence of the Roma people, adapting central laws, most notably the 1964 forced settlement bill, to local situation. In their analysis, the authors use documents held in various local and central archives, including the Institute of National Remembrance archive and Ministry of the Interior archive.

Edukacja dzieci romskich na ziemi lubuskiej w latach 2004–2015

W artykule podjęto próbę przedstawienia zmian podejścia do edukacji dzieci romskich. Ukazano, na podstawie sprawozdań z Lubuskiego Urzędu Wojewódzkiego, jak przebiegał proces edukacji dzieci romskich w latach 2004–2015 zgodnie z działaniami zawartymi w rządowym programie na rzecz społeczności romskiej. Wyniki uzyskane w województwie lubuskim pokazują, że warto podejmować działania, które mają pomóc kolejnym pokoleniom Romów odnaleźć się w nowej rzeczywistości społecznej, na wyższym poziomie niż dotychczas.

KONSUMENT WOBEC OPAKOWAŃ AKTYWNYCH I INTELIGENTNYCH NA RYNKU PRODUKTÓW SPOŻYWCZYCH

The paper discusses the essence and the use of active and intelligent packaging in the food industry. It presents the results of a survey whose aim was to determine the knowledge and attitudes of consumers towards this type of packaging. The survey was conducted on a sample of 372 respondents – inhabitants of the Lubuskie Voivodeship. The use of active and intelligent packaging is related to the growing consumer interest in high quality food and new consumer preferences which influence the changes in the approach to food packaging. The analysis of the survey results showed that although there are new solutions for active and intelligent packaging appearing on the market, the state of knowledge on them among the inhabitants of the Lubuskie Region is insufficient.

Regionalne grupy strategiczne w przemyśle spożywczym w Polsce

This paper identifies and examines the regional strategic groups for food industry basing upon McKinsey’s modified matrix. An analysis of regional strategic groups being understood as concentration of similar regions regarding sector attractiveness as well as position and competitive potential what allows proposing acceptable strategic activities both for regions and enterprises localized on their area. The survey shows that in Poland only Masovian region is predestinated to realize development strategies in food industry. Great Poland region (Wielkopolska) is recommended to use selective options analysis as well as for enterprises operating on that market. In considering the supporting strategies basing upon selective growth, it is the most advantageous for Silesia region, South Silesia region and Minor Poland (Małopolska), Pomorze region. The strategy of profit maximizing and withdrawal strategy can be used in the following regions; Łódź region, Opole region, Lubuskie region, Podkarpacie region, Lublin region, Podlasie region, Świętokrzyski region, Warmia-Mazury region, Kujawsko- Pomorskie region.

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland.

Sources, Obstacles and Effects of Innovation Activities in the Lubuskie Region in 2009-2011 – Probit Modeling

The aim of the study was to determine the significance of the use of probit modeling and the impact of sources and barriers to innovation activity and to determine its effects, in particular investments in innovation and implementation of new solutions. The main hypothesis of this paper is the claim that the innovative activity of enterprises is dependent on the diversity of factors affecting the parties, and both the source and the barriers can be influenced in different directions. The collected material for research (545 surveys) were analyzed by means of probability. The reason for the choice of this method is the fact that in the case of dichotomous variables (ie, taking the value of 0-no, 1-yes) the use of multiple regression is pointless. The values of this function may in fact be negative, which deprives them of interpretive meaning. An alternative test method in this situation is the probit regression. Positively to the implementation of new solutions affects search for information on innovations in science. The transfer of knowledge and the creation of new technological solutions, in particular, contribute to international research bodies. This strong links with R&amp;D in the future may result in the achievement of superiority in the region. Interestingly it appears that keeping a positive effect on innovation activity affects their high cost. It’s not disstimulating on companies to implement such new products and processes. It can therefore draw the thesis that high expenditures on innovative activities of entrepreneurs make thorough preparation for innovation processes in their companies in order to minimize the risk of failure of implementing the new solution. In this way, many of them are successful. In addition, this thesis confirms the correctness of the fact that more than half of the surveyed companies indicated the cost barrier, and so much of the reasoning confirms the research sample.

Use of fly-ash for the production of hydraulic binding agents and for soil stabilisation / Zastosowanie Popiołów Lotnych Do Produkcji Spoiw Hydraulicznych I Wzmacniania Gruntu

Streszczenie Popiół lotny j est odpadem produkcyjnym, wytwarzanym w wyniku spalania węgla w kotłach energetycznych. Rocznie na świecie wytwarza się miliony ton tego odpadu, stąd niezwykle ważne jest umiejętne jego zagospodarowanie, w tym - uzyskanie materiału o wyższej jakości niż zastosowany produkt wyjściowy. Celem pracy jest określenie przydatności przetworzonych popiołów lotnych z węgla brunatnego do wzmocnienia (stabilizacji) gruntów stosowanych w budowie nasypów drogowych oraz podbudowy dróg. Wyniki pracy są sposobem na utylizację odpadów, a jednocześnie - uzyskanie nowych materiałów i technologii w budowie obiektów liniowych. Jest to zagadnienie istotne zarówno z punktu widzenia ochrony środowiska przyrodniczego, jak i pozytywnego wpływu przetworzonych popiołów lotnych na trwałość obiektów drogowych. W pracy przedstawiono wyniki badań przeprowadzonych na popiołach lotnych z węgla brunatnego wytwarzanych w Elektrowni Pątnów. Popioły te zostały najpierw zmodyfikowane (aktywowane) za pomocą „aktywatora magnetycznego Wapeco”, a następnie - użyte do wytworzenia spoiw hydraulicznych (z dodatkiem cementu) oraz mieszanek gruntowo-spoiwowych. Poszczególne mieszanki sporządzono na bazie surowców mineralnych zalegających w siedmiu różnych złożach regionu lubuskiego (zachodnia Polska). Zastabilizowano je dwoma spoiwami hydraulicznymi (o wytrzymałości 3 i 9 MPa), przy zróżnicowanym dodatku spoiwa hydraulicznego (6% i 8% w stosunku do masy gruntu). Podczas badań określono przyrost wytrzymałości badanych próbek (po upływie czasu: 14,28 i 42 dni) orazprzyrostwskaźnikanośności (bezpośrednio po zagęszczeniuipo 7 dniach). Interpretacja wyników badań pozwoliła na ocenę dynamiki wzrostu wytrzymałości na ściskanie i nośności różnych gruntów zastabilizowanych spoiwami hydraulicznymi, wytworzonymi na bazie popiołu lotnego z węgla brunatnego, oraz - wskazanie możliwości zastosowania tych materiałów. Przeprowadzona analiza wykazała, że istnieje możliwość wzmocnienia gruntów za pomocą tych spoiw, a następnie - zaliczenia gruntów uznawanych dotychczas za słabonośne (tj. piaski gliniaste, pospółki gliniaste, gliny) do materiałów w pełni przydatnych w budownictwie drogowym.

Influence the intensity of industrial relations on the innovative activity. Case of Lubuskie voivodeship in 2008-2010

Influence the intensity of industrial relations on the innovative activity. Case of Lubuskie voivodeship in 2008-2010 The main objective of the study was an attempt to search for the conditions affect the intensity of supply chains for enterprises innovative activity within the regional industrial system, and consequently determine the directions for the model of regional system of innovation, taking into account the specificities of Lubuskie Region. The study was based on a questionnaire on a group of 545 companies from Silesia. The study used probity modeling. This method is an effective research tool for large, but the static tests in which the dependent variable has a qualitative character.

Wrodzone wady rozwojowe u dzieci w wieku do 2 lat na terenie województw zielonogórskiego (1988–1997) i lubuskiego (1998–2007). Część 2. Środowisko zamieszkania matki (miasto – wieś) i płeć dziecka

MaterialAltogether there were 192,438 neonates, live born in 1988–2007 in the Lubuskie region. The analyzed population was divided into two subgroups born in two 10-years periods in two analyzed provinces:1.91,453 neonates: boys 46,629 (51.0%), girls 44,824 (49.0%), born in 1988–1997 in Zielona Góra province (ZGP): 50,615 in the towns and 40,838 in the country,2.100,985 neonates: 51,996 boys (51.5%) i 48,989 girls (48.5%), born in 1998–2007 in Lubuskie province (LP): 60,780 in the towns and 40,205 on the country. ResultsEnvironmental differences were observed in ZGP only (town – 169,7 and country – 132,5). In both provinces the totally incidence of congenital malformations was significantly higher in boys, with the biggest difference in LP: 205,6 vs 154,1. In LP (1998–2007) there was also observed a significant increase of prevalence of congenital malformations.