Low Strength Buffer Research Articles

VASP is a processive actin polymerase that requires monomeric actin for barbed end association

Ena/VASP proteins regulate the actin cytoskeleton during cell migration and morphogenesis and promote assembly of both filopodial and lamellipodial actin networks. To understand the molecular mechanisms underlying their cellular functions we used total internal reflection fluorescence microscopy to visualize VASP tetramers interacting with static and growing actin filaments in vitro. We observed multiple filament binding modes: (1) static side binding, (2) side binding with one-dimensional diffusion, and (3) processive barbed end tracking. Actin monomers antagonize side binding but promote high affinity (K(d) = 9 nM) barbed end attachment. In low ionic strength buffers, VASP tetramers are weakly processive (K(off) = 0.69 s(-1)) polymerases that deliver multiple actin monomers per barbed end-binding event and effectively antagonize filament capping. In higher ionic strength buffers, VASP requires profilin for effective polymerase and anti-capping activity. Based on our observations, we propose a mechanism that accounts for all three binding modes and provides a model for how VASP promotes actin filament assembly.

Impact of pre-concentration to covalently biofunctionalize suspended nanoparticles

The effective biofunctionalization of nanoparticles is crucial for biomedical applications. Inthis study we investigated the covalent biofunctionalization of magnetic nanoparticles basedon carbodiimide activation. An important aspect in the covalent biofunctionalization ofnanoparticles has been neglected, namely pre-concentration. Exploiting the electrostaticattraction forces between a protein and the nanoparticle surface will favor the covalentimmobilization. We showed that low ionic strength buffers with a pH slightly lower than thepI of the selected biomolecules is needed to increase the yield of covalent immobilization.Additionally, it is demonstrated that the covalently immobilized proteins arebioactive, relying on a sandwich assay using gold nanoparticles as reporter labels.

State of oncomarker protein B23/nucleophosmin in HeLa cells

Western blot after SDS-PAGE for protein separation showed two immunoreactive bands corresponding to monomers (38-40 kDa) and oligomers (210-230 kDa) of nucleophosmin in HeLa cell lysates. Decreasing the buffer ionic strength during the incubation of cells and nuclei destabilized these oligomers. We also showed the existence of two B23/nucleophosmin pools in nuclei of HeLa cells with different sensitivity to hypotonic buffer treatment: one extractable from the nucleus and the other non-extractable and tightly bound to the nucleus. A detailed structural analysis of the extractable B23 pool was carried out: two closely related nucleophosmin isoforms (B23.1 and B23.2) were identified as a result of analysis of C-terminal amino acid sequences using carboxypeptidase hydrolysis; the N-termini of both isoforms are blocked by an acetyl group. As a result of sequencing of the deacetylated proteins, it has been established that the N-terminal amino acid sequence of nucleophosmin in these preparations is truncated by nine amino acid residues and the acetylated residue is Ser. The truncated monomer of nucleophosmin (represented only by the extractable part of the protein) on addition of magnesium ions to low ionic strength buffer or increase in buffer ionic strength was shown to form oligomers with molecular weights (210-230 kDa) similar to those revealed in the total cell lysate. It should be noted that the set of oligomers in this case differs from the one in total cell lysate. Our strategy of characterization of B23 forms for HeLa cells can be applied for other tumor cells.

Efficient Light Harvesting by Photosystem II Requires an Optimized Protein Packing Density in Grana Thylakoids

A recently developed technique for dilution of the naturally high protein packing density in isolated grana membranes was applied to study the dependence of the light harvesting efficiency of photosystem (PS) II on macromolecular crowding. Slight dilution of the protein packing from 80% area fraction to the value found in intact grana thylakoids (70%) leads to an improved functionality of PSII (increased antenna size, enhanced connectivity between reaction centers). Further dilution induces a functional disconnection of light-harvesting complex (LHC) II from PSII. It is concluded that efficient light harvesting by PSII requires an optimal protein packing density in grana membranes that is close to 70%. We hypothesize that the decreased efficiency in overcrowded isolated grana thylakoids is caused by excited state quenching in LHCII, which has previously been correlated with neoxanthin distortion. Resonance Raman spectroscopy confirms this increase in neoxanthin distortion in overcrowded grana as compared with intact thylakoids. Furthermore, analysis of the changes in the antenna size in highly diluted membranes indicates a lipid-induced dissociation of up to two trimeric LHCII from PSII, leaving one trimer connected. This observation supports a hierarchy of LHCII-binding sites on PSII.

Sub-clinical infection of dogs from the Ivory Coast and Gabon with Ehrlichia, Anaplasma, Mycoplasma and Rickettsia species

In 2003, we carried out a field survey in order to investigate the significance of sub-clinical tickborne bacterial infections in African dogs from the Ivory Coast (n = 137) and Gabon (n = 255). So far, only limited data on this topic are available in Africa when compared with the USA and Europe, and in most of the cases, serological techniques have been applied [1]. In this study, we used PCR amplification and DNA sequencing to screen different tick-borne bacterial pathogens in the blood of dogs. The dogs from the Ivory Coast were resident in the capital Abidjan and were used for surveillance purposes by protection companies. They were kept in 16 different kennels and received regular medical prophylaxis including vaccinations and external anti-parasitic treatments. Dogs from Gabon were recruited in 15 small villages in the area of Ogooue-Ivindo, situated in the northeastern part of the country. They were nonkennelled companion animals and received no specific medical prevention. All the dogs appeared healthy at the time of the examination. All Gabonese dogs were infested by fleas and some of them by Haemaphysalis leachi ticks, while no ectoparasites were found in dogs from the Ivory Coast. Blood was collected in EDTA-anticoagulated tubes kept deep-frozen at )20 C until further processing. In the laboratory, DNA extraction was carried out using QIAamp DNA Mini Kits (Qiagen Ltd, Crawley, UK) according to the manufacturer’s recommendations. Briefly, blood samples were digested for 10 min with a mixture of proteinase K and detergents at 56 C to liberate host and pathogen DNA. DNA was extracted from 200 lL of blood and purified DNA was eluted in 100 lL of low ionic strength buffer, pH 8.0. DNA from individual dogs was screened by PCR, using specific primers, for the presence of Ehrlichia and Anaplasma species (Ivory Coast), and Ehrlichia and Anaplasma species, Mycoplasma spp. and Rickettsia spp. (Gabon). PCR assays amplified a 350 base pair fragment of the 16S rRNA gene for Ehrlichia ⁄Anaplasma species (primer sequences: ggtaccyacagaagaagtcc and tagcactcatcgtttacagc), 16S rRNA gene for Mycoplasma spp. (primer sequences: atacggcccatattcctacg and tgctccaccacttgttca) and ompB gene for Rickettsia spp. (primer sequences: gacaattaatatcggtgacgg and tgcatcagcattaccgcttgc). Sequencing was required to further characterise positive results for Ehrlichia ⁄Anaplasma PCR and limited sequencing was performed for Mycoplasma spp. Overall, 10 ⁄ 392 (2.6%) of the tested dogs were positive for E. canis and 5 ⁄ 392 (1.3%) for A. platys (Table 1). The majority of them was from the Ivory Coast; 10 were positive for E. canis and two for A. platys. In Gabon, only three dogs were positive for A. platys and none was positive for E. canis. In this latter country, a high proportion of dogs (114 ⁄ 255, 44.7%) was positive for Mycoplasma spp. Sequencing of 10 Mycoplasma positive samples revealed four Mycoplasma haemocanis, one Mycoplasma haemofelis, and five samples of a novel Mycoplasma. No sample was positive for Rickettsia spp. The three Gabonese dogs positive for A. platys were co-infected with Mycoplasma spp. No E. canis and A. platys co-infections were present in the Ivory Coast dogs. Ehrlichia canis is responsible for canine monocytic ehrlichiosis, a widespread infectious disease in the distribution area of its vector Rhipicephalus sanguineus, the brown dog tick. Interestingly, in a previous seroprevalence survey of E. canis infection in the same population of dogs [1], 67.8% of Corresponding author and reprint requests: J.-L. Marie, Secteur Veterinaire de Marseille, BP 48, 13998 Marseille Armees, Marseille, France E-mail: jean-lou.marie@wanadoo.fr

Vinculin Nucleates Actin Polymerization and Modifies Actin Filament Structure

Vinculin links integrins to the actin cytoskeleton by binding F-actin. Little is known with respect to how this interaction occurs or affects actin dynamics. Here we assess the consequence of the vinculin tail (VT) on actin dynamics by examining its binding to monomeric and filamentous yeast actins. VT causes pyrene-labeled G-actin to polymerize in low ionic strength buffer (G-buffer), conditions that normally do not promote actin polymerization. Analysis by electron microscopy shows that, under these conditions, the filaments form small bundles at low VT concentrations, which gradually increase in size until saturation occurs at a ratio of 2 VT:1 actin. Addition of VT to pyrene-labeled mutant yeast G-actin (S265C) produced a fluorescence excimer band, which requires a relatively normal filament geometry. In higher ionic strength polymerization-promoting F-buffer, substoichiometric amounts of VT accelerate the polymerization of pyrene-labeled WT actin. However, the amplitude of the pyrene fluorescence caused by actin polymerization is quenched as the VT concentration increases without an effect on net actin polymerization as determined by centrifugation assays. Finally, addition of VT to preformed pyrene-labeled S265C F-actin causes a concentration-dependent decrease in the maximum amplitude of the pyrene fluorescence band demonstrating the ability of VT to remodel the conformation of the actin filament. These observations support the idea that vinculin can link adhesion plaques to the cytoskeleton by initiating the formation of bundled actin filaments or by remodeling existing filaments.

Interaction of TorsinA with Its Major Binding Partners Is Impaired by the Dystonia-associated ΔGAG Deletion

Early onset (DYT1) torsion dystonia is a dominantly inherited movement disorder associated with a three-base pair (DeltaGAG) deletion that removes a glutamic acid residue from the protein torsinA. TorsinA is an essential AAA(+) (ATPases associated with a variety of cellular activities) ATPase found in the endoplasmic reticulum and nuclear envelope of higher eukaryotes, but what it does and how changes caused by the DeltaGAG deletion lead to dystonia are not known. Here, we asked how the DYT1 mutation affects association of torsinA with interacting proteins. Using immunoprecipitation and mass spectrometry, we first established that the related transmembrane proteins LULL1 and LAP1 are prominent binding partners for torsinA in U2OS cells. Comparative analysis demonstrates that these two proteins are targeted to the endoplasmic reticulum or nuclear envelope by their divergent N-terminal domains. Binding of torsinA to their C-terminal lumenal domains is stabilized when residues in any one of three motifs implicated in ATP hydrolysis (Walker B, sensor 1, and sensor 2) are mutated. Importantly, the DeltaGAG deletion does not stabilize this binding. Indeed, deleting the DeltaGAG encoded glutamic acid residue from any of the three ATP hydrolysis mutants destabilizes their association with LULL1 and LAP1C, suggesting a possible basis for loss of torsinA function. Impaired interaction of torsinA with LULL1 and/or LAP1 may thus contribute to the development of dystonia.

Conformational Properties of β-PrP

Prion propagation involves a conformational transition of the cellular form of prion protein (PrPC) to a disease-specific isomer (PrPSc), shifting from a predominantly alpha-helical conformation to one dominated by beta-sheet structure. This conformational transition is of critical importance in understanding the molecular basis for prion disease. Here, we elucidate the conformational properties of a disulfide-reduced fragment of human PrP spanning residues 91-231 under acidic conditions, using a combination of heteronuclear NMR, analytical ultracentrifugation, and circular dichroism. We find that this form of the protein, which similarly to PrPSc, is a potent inhibitor of the 26 S proteasome, assembles into soluble oligomers that have significant beta-sheet content. The monomeric precursor to these oligomers exhibits many of the characteristics of a molten globule intermediate with some helical character in regions that form helices I and III in the PrPC conformation, whereas helix II exhibits little evidence for adopting a helical conformation, suggesting that this region is a likely source of interaction within the initial phases of the transformation to a beta-rich conformation. This precursor state is almost as compact as the folded PrPC structure and, as it assembles, only residues 126-227 are immobilized within the oligomeric structure, leaving the remainder in a mobile, random-coil state.

RNA biophysics has come of age

RNA biophysics has come of age

Differential Regulation of Actin Polymerization and Structure by Yeast Formin Isoforms

The budding yeast formins, Bnr1 and Bni1, behave very differently with respect to their interactions with muscle actin. However, the mechanisms underlying these differences are unclear, and these formins do not interact with muscle actin in vivo. We use yeast wild type and mutant actins to further assess these differences between Bnr1 and Bni1. Low ionic strength G-buffer does not promote actin polymerization. However, Bnr1, but not Bni1, causes the polymerization of pyrene-labeled Mg-G-actin in G-buffer into single filaments based on fluorometric and EM observations. Polymerization by Bnr1 does not occur with Ca-G-actin. By cosedimentation, maximum filament formation occurs at a Bnr1:actin ratio of 1:2. The interaction of Bnr1 with pyrene-labeled S265C Mg-actin yields a pyrene excimer peak, from the cross-strand interaction of pyrene probes, which only occurs in the context of F-actin. In F-buffer, Bnr1 promotes much faster yeast actin polymerization than Bni1. It also bundles the F-actin in contrast to the low ionic strength situation where only single filaments form. Thus, the differences previously observed with muscle actin are not actin isoform-specific. The binding of both formins to F-actin saturate at an equimolar ratio, but only about 30% of each formin cosediments with F-actin. Finally, addition of Bnr1 but not Bni1 to pyrene-labeled wild type and S265C Mg-F actins enhanced the pyrene- and pyrene-excimer fluorescence, respectively, suggesting Bnr1 also alters F-actin structure. These differences may facilitate the ability of Bnr1 to form the actin cables needed for polarized delivery of nutrients and organelles to the growing yeast bud.

The Processivity of Kinesin-2 Motors Suggests Diminished Front-Head Gating

Kinesin-2 motors, which are involved in intraflagellar transport and cargo transport along cytoplasmic microtubules, differ from motors in the canonical kinesin-1 family by having a heterodimeric rather than homodimeric structure and possessing a three amino acid insertion in their neck linker domain. To determine how these structural features alter the chemomechanical coupling in kinesin-2, we used single-molecule bead experiments to measure the processivity and velocity of mouse kinesin-2 heterodimer (KIF3A/B) and the engineered homodimers KIF3A/A and KIF3B/B and compared their behavior to Drosophila kinesin-1 heavy chain (KHC). Single-motor run lengths of kinesin-2 were 4-fold shorter than those of kinesin-1. Extending the kinesin-1 neck linker by three amino acids led to a similar reduction in processivity. Furthermore, kinesin-2 processivity varied inversely with ATP concentration. Stochastic simulations of the kinesin-1 and kinesin-2 hydrolysis cycles suggest that "front-head gating," in which rearward tension prevents ATP binding to the front head when both heads are bound to the microtubule, is diminished in kinesin-2. Because the mechanical tension that underlies front-head gating must be transmitted through the neck linker domains, we propose that the diminished coordination in kinesin-2 is a result of its longer and, hence, more compliant neck linker element.

Time course of peptide fingerprints in semimembranosus and biceps femoris muscles during Bayonne ham processing

The aim of this work was to define reliable markers of muscle and processing time in dry-cured ham using a rapid, precise semi quantitative method for the protein fraction soluble in low ionic strength buffer. For this purpose protein labchip Agilent was used to separate proteins and peptides and accurately determine their molecular weights and concentrations electrophoretically. In this way the protein fingerprinting of dry-cured ham at different process times was characterised, together with targets and products of proteolysis. In addition, the comparison of all the electrophoregrams indicated muscle and dry-curing process markers.

The structure of the cytoplasm of lens fibers as determined by conical tomography

Studies using conventional electron microscopy describe the cytoplasm of lens fiber cells as having essentially an amorphous structure. We hypothesized that significant structural detail might have been lost as a result of projecting the entire thickness of the section (50–100nm) onto a single plane (the “projection artifact”). To test this hypothesis, we studied the 3D-structure of rat lens cortical fibers before and after extracting the “soluble” crystallins with low ionic strength buffers to make “ghosts.” Tomographic series in conical geometry were collected at 55° tilts and by 5° rotations until completing a 360° turn by low dose methods. They were aligned using fiduciary points, reconstructed with the weighted back projection algorithm and refined by projection matching. Analysis of the 3D-maps included semiautomatic density segmentation using a computer program based on the watershed algorithm. We found that the cytoplasm of cortical fibers, though appearing amorphous in regions of the highest density, was in fact comprised of an ordered structure resembling a “clustered matrix.” The matrix was comprised of thin (∼6nm diameter) filaments bent sharply at 110–120° angles and studded with cube-shaped particles (the “beaded” filaments). In cortical fibers, the particles measured a=14±2, b=13±2 and c=10±2.4nm (n=30, mean±SD) and were spaced at distances measuring 27.5±2.4nm apart (n=8, mean±SD), center-to-center. The matrix was formed as “beaded” filaments, bound to clusters of “soluble” proteins, crossed each other at nearly perpendicular angles. The matrix also made contact with the plasma membrane at a large number of distinct regions. We thus concluded that the cytoplasm of cortical lens fibers is comprised of a cytoskeletal matrix of “beaded” filaments that organize the “soluble” crystallins in separate regions. The association of this matrix with the plasma membrane allows the lens to maintain its structural integrity, while its association with crystallins yields its long-term transparency. Loss of either function likely would play a significant role in cataract formation.

Alteration of α-spectrin ubiquitination after hemorrhagic shock

Background RBC deformability after trauma and hemorrhagic shock (T/HS) leads to the microcirculatory dysfunction and clinical manifestations of organ failure. However, the cellular mechanism of this phenomenon remains unknown. Spectrins are important for the shape and physical properties of erythrocytes, such as deformability and resistance to mechanical stress. Previous studies have shown that erythrocyte α-spectrin is ubiquitinated. Studies of sickled cells and aged erythrocytes, 2 conditions known to have decreased RBC deformability, have shown decreased α-spectrin ubiquitination, which may contribute to the inability of these cells to change shape. It was hypothesized that decreased α-spectrin ubiquitination could participate in the mechanism(s) whereby T/HS erythrocytes become less deformable. Methods The level of α-spectrin ubiquitination in erythrocytes isolated from T/HS rats was determined and compared with erythrocytes from control sham-shocked (T/SS) animals. After T/SS (n = 4) or T/HS (n = 7), α- and β-spectrin subunits were isolated using a low ionic–strength buffer at 37°C for 30 minutes. The relative amount of ubiquitinated α-spectrin was evaluated by Western blotting using a monoclonal antibody to ubiquitin. Results The relative level of α-spectrin ubiquitination (normalized to total α-spectrin in the same preparation) was found to be significantly decreased after T/HS (.319 ± .03) compared with T/SS control erythrocytes (.485 ± .06, P < .05). To evaluate the content and relative amounts of the other membrane proteins, the profiles of T/HS and T/SS erythrocytes were compared by sodium dodecyl sulphate–polyacrylamide gel electrophoresis. This did not reveal any significant quantitative differences between T/SS and T/HS spectrin or other membrane proteins. Conclusions The finding of decreased α-spectrin ubiquitination after T/HS suggests that this mechanism could contribute to increased rigidity of the erythrocyte membrane.

Affinity of transducin for photoactivated rhodopsin: dependence on nucleotide binding state

The interaction of the rod GTP binding protein, Transducin (G(t)), with bleached Rhodopsin (R(*)) was investigated by measuring radiolabeled guanine nucleotide binding to and release from soluble and/or membrane-bound G(t) by reconstituting G(t) containing bound GDP (G(t-)GDP) or the hydrolysis-resistant GTP analog guanylyl imidodiphosphate (G(t-)p[NH]ppG) with R* under physiological conditions. Release of GDP and p[NH]ppG from G(t) occurred to the same extent and with the same light sensitivity both in the presence and absence of added GTP. Significant amounts of G(t) without bound nucleotide (G(t-)) were generated. When ROS containing bleached rhodopsin (R(*)) were centrifuged in low ionic strength buffer, G(t-) remained associated with the membrane fraction, whereas G(t-)GDP remained in the soluble fraction. These results suggest that G(t-)GDP and G(t-)p[NH]ppG have similar affinities for R(*). The results also suggest that G(t-), rather than G(t-)GDP, is the moiety which exhibits tight, "light-induced" binding to rhodopsin.

Electronic DNA hybridisation detection in low-ionic strength solutions

Fast DNA detection remains of great interest in human genetics, medicine, and drug discovery. The detection of DNA hybridisation makes the screening of point mutations in potential cancer genes or DNA fingerprinting for phylogenesis purposes possible (S.W. Yeung, T.M.H. Lee, H. Cai, and I.M. Hsing, A DNA biochip for on-the-spot multiplexed pathogen identification, Nucleic Acids Research 34 (2006), p. e118; P. Liepold, H. Wieder, H. Hillebrandt, A. Friebel, G. Hartwich, DNA-arrays with electrical detection: a label-free low cost technology for routine use in life sciences and diagnostics, Bioelectrochemistry, 67 (2005), pp. 143–150). The speed, cost and reliability of the hybridisation detection is of high importance. Electronic detection of hybridisation events using standard CMOS-fabricated devices such as Field Effect Transistors (FETs) promises fast, label-free and multiplexed read-out systems. Moreover, they hold the advantage of high-throughput and minimalisation, which makes them ideal for implementation in fast diagnostic tools such as lab-on-chip systems. Field-effect devices, however, imply the necessity of low-ionic strength buffer solutions for signal maximisation because of the occurrence of charge screening effects near the electrolyte-oxide interface layer. In this article, we present a surface chemistry-based methodology that allows FET-based recordings of hybridisation events in low-ionic strength solutions. Quartz Crystal Microbalance results show that positively-charged surfaces promote DNA hybridisation, even when performed in lower salt concentrations then commonly used. Fluorescence measurements were performed on the different surfaces to reveal the optimal DNA adsorption conditions on the surface. For proof-of-principle, the surface chemistry was applied on the surface of a floating-gate field-effect transistor, and online recordings of DNA hybridisation events were performed in low-ionic strength solutions.

Electronically Activated Actin Protein Polymerization and Alignment

Biological systems are the paragon of dynamic self-assembly, using a combination of spatially localized protein complexation, ion concentration, and protein modification to coordinate a diverse set of self-assembling components. Biomimetic materials based upon biologically inspired design principles or biological components have had some success at replicating these traits, but have difficulty capturing the dynamic aspects and diversity of biological self-assembly. Here, we demonstrate that the polymerization of ion-sensitive proteins can be dynamically regulated using electronically enhanced ion mixing and monomer concentration. Initially, the global activity of the cytoskeletal protein actin is inhibited using a low-ionic strength buffer that minimizes ion complexation and protein-protein interactions. Nucleation and growth of actin filaments are then triggered by a low-frequency AC voltage, which causes local enhancement of the actin monomer concentration and mixing with Mg(2+). The location and extent of polymerization are governed by the voltage and frequency, producing highly ordered structures unprecedented in bulk experiments. Polymerization rate and filament orientation could be independently controlled using a combination of low-frequency (approximately 100 Hz) and high frequency (1 MHz) AC voltages, creating a range of macromolecular architectures from network hydrogel microparticles to highly aligned arrays of actin filaments with approximately 750 nm periodicity. Since a wide range of proteins are activated upon complexation with charged species, this approach may be generally applicable to a variety of biopolymers and proteins.

Effect of ionic strength and presence of serum on lipoplexes structure monitorized by FRET

BackgroundSerum and high ionic strength solutions constitute important barriers to cationic lipid-mediated intravenous gene transfer. Preparation or incubation of lipoplexes in these media results in alteration of their biophysical properties, generally leading to a decrease in transfection efficiency. Accurate quantification of these changes is of paramount importance for the success of lipoplex-mediated gene transfer in vivo.ResultsIn this work, a novel time-resolved fluorescence resonance energy transfer (FRET) methodology was used to monitor lipoplex structural changes in the presence of phosphate-buffered saline solution (PBS) and fetal bovine serum. 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP)/pDNA lipoplexes, prepared in high and low ionic strength solutions, are compared in terms of complexation efficiency. Lipoplexes prepared in PBS show lower complexation efficiencies when compared to lipoplexes prepared in low ionic strength buffer followed by addition of PBS. Moreover, when serum is added to the referred formulation no significant effect on the complexation efficiency was observed. In physiological saline solutions and serum, a multilamellar arrangement of the lipoplexes is maintained, with reduced spacing distances between the FRET probes, relative to those in low ionic strength medium.ConclusionThe time-resolved FRET methodology described in this work allowed us to monitor stability and characterize quantitatively the structural changes (variations in interchromophore spacing distances and complexation efficiencies) undergone by DOTAP/DNA complexes in high ionic strength solutions and in presence of serum, as well as to determine the minimum amount of potentially cytotoxic cationic lipid necessary for complete coverage of DNA. This constitutes essential information regarding thoughtful design of future in vivo applications.

Structural concepts of chromosome axis. Chromosome scaffold and core within coiled mitotic chromatids.

The presence of axial elements in human mitotic chromosomes has been demonstrated by means of specific pretreatments and silver staining for chromosomes fixed on glass slides. Isolation buffers of high or low ionic strength, used earlier for histone depletion and extraction, were used for demonstration of the coiled organization of metaphase chromatids. Subsequent staining by silver revealed scaffolding structures in chromonemal coils, and, deeply stained cores in compact metaphase chromatids. The reality of axial elements is discussed in terms of the element's presence and function in differentially contracted mitotic chromonemata and chromatids.

Characterization of the Essential Activities of Saccharomyces cerevisiae Mtr4p, a 3′→5′ Helicase Partner of the Nuclear Exosome

Mtr4p belongs to the Ski2p family of DEVH-box containing proteins and is required for processing and degradation of a variety of RNA substrates in the nucleus. In particular, Mtr4p is required for creating the 5.8 S ribosomal RNA from its 7 S precursor, proper 3'-end processing of the U4 small nuclear RNA and some small nucleolar RNAs, and degradation of aberrant mRNAs and tRNAs. In these studies we have shown that Mtr4p has RNA-dependent ATPase (or dATPase) activity that is stimulated effectively by likely substrates (e.g. tRNA) but surprisingly weakly by poly(A). Using an RNA strand-displacement assay, we have demonstrated that Mtr4p can, in the presence of ATP or dATP, unwind the duplex region of a partial duplex RNA substrate in the 3'-->5' direction. We have examined the ability of Mtr4p to bind model RNA substrates in the presence of nucleotides that mimic the stages (i.e. ATP-bound, ADP-bound, and nucleotide-free) of the unwinding reaction. Our results demonstrate that the presence of a non-hydrolyzable ATP analog allows Mtr4p to discriminate between partial duplex RNA substrates, binding a 3'-tailed substrate with 5-fold higher affinity than a 5'-tailed substrate. In addition, Mtr4p displays a marked preference for binding to poly(A) RNA relative to an oligoribonucleotide of the same length and a random sequence. This binding exhibits apparent cooperativity and different dynamic behavior from binding to the random single-stranded RNA. This unique binding mode might be employed primarily for degradation.