Local Laser Research Articles

Crack detection in metallic components with varying surface characteristics using laser spot scanning thermography

Cracks are the most common cause of failure in the manufacturing of metal parts, hence technologies for detecting them are essential for defect-free production. In this study, a local laser spot excitation combined with robotic scanning is used to identify vertical cracks in titanium. It is feasible to observe anisotropies in the lateral diffusivity by capturing temporal temperature data with an infrared camera utilizing local thermal stimulation. The crack parameter may then be quantified based on the regional transient behavior of temperature distribution. In doing so, we present an advanced technique for distinguishing between contrast created by the surface oxide layer and contrast caused by the vertical crack. In addition, we provide results from a numerical simulation that looked at the notion of local heat excitation for crack parameter quantification. Thermal conduction, radiation, and convection all play a role in the simulation. The experimental and theoretical findings were found to be quite consistent.

Analytical modeling of surface roughness of metal manufactured components based on building history

The realization of metal physical objects by localized laser fusion techniques requires the building under specified and predictable conditions in order to reduce errors in that phase. The stratification and the dimension got by solidified melt bath pools determine the geometry and the surface micro-characteristics appearing on the manufactured component. The relationship between internal microstructure and external characteristics are proposed by a analytical modeling in which internal variables such as the melt pool surfaces detected in the sectioned part of the specimen are given as input to describe the surface roughness at given positions of the surface of the object. The proposed method is based on the use of melt pool areas directly as obtained by the building history and on the use of an interpolating equation able to approximate their trend in order to reduce the variability got by real process. The obtained analytical models are able not only to correlate but to describe in detail the surface roughness as a function of internal bath areas. The modeling approach proposed is based on the regression analysis in which different variables affecting the geometry and the surface roughness are considered and their significance evaluated. An improvement in the predictive ability of the model using the interpolated melt pool areas is obtained.

Relationship between Microstructure and Corrodibility of Local Dry Underwater Laser Welded 304 Stainless Steel

To understand the relationship between microstructure and corrosion, in this study, underwater bead-on-plate laser welding was compared with the in-air laser welding of 10-mm-thick 304 stainless steel plates at different laser powers (2, 4, and 6 kW). Welding was performed via local dry underwater laser welding (UWLW) using a custom-designed nozzle and a fiber laser at a water depth of 70 mm. The best weld quality was obtained in both underwater and in-air environments using 2 kW of laser power. To understand the relationship between the microstructure and corrosion resistance of 304ss in underwater laser welding (UWLW), this study was conducted using a custom-designed nozzle. The grain boundary analysis revealed that the specimen prepared by UWLW had high-angle grain boundaries content approximately 1.5 times higher than that of the specimen produced by in-air laser welding, and the fraction of the coincidence site lattice (CSL) boundaries was increased remarkably. High residual stress and microchromium precipitation were observed in the UWLW specimen, and the corrosion rate of the same at 2 kW laser power was considerably similar to that of the in-air laser weld specimen.

Multiple Tb/s Coherent Optical Transceivers for Short Reach Interconnect

This paper investigates coherent optical transceivers for short-reach interconnect, where a local oscillator laser is used to boost received optical signals for high receiver sensitivity. We review the state-of-the-art technologies and propose a miniature Mach-Zehnder modulator (mMZM) array with 3D silicon photonic-electronic integration to enable high-density, low-power multiple Tb/s coherent transceivers. For design optimization at transceiver level performances, we develop methodology and models to simulate PN junction and mMZM for high-efficiency high-speed modulation, which can be linked to system performances, including high-speed performances, receiver sensitivity, optical link budget, and coherent optical transceiver power consumption. With the optimized design and state-of-the-art technologies, we achieve highly integrated multiple Tb/s coherent transceivers with high density, high speed, and low power. Our simulation results show 3 pJ/bit for integrated driver/mMZM, 5 pJ/bit for integrated PIC/IC and 6.5 pJ/bit with transceiver optics for 6.4 Tb/s with 60 Gbaud 16QAM. Compared with conventional long phase shifter (PS) MZM (4 mm), mMZM with short PS (2.4 mm) only have an extra loss of ∼2 dB under 60 Gbaud 16QAM modulation with optimized designs. We study the scalability from 6.4 Tb/s to 12.8 Tb/s using 120 Gbaud 16QAM for intra-DC interconnect. The results show that further improvement for modulation efficiency, frequency response and laser output power are needed to enable the 12.8 Tb/s.

Response and Function of Solanum lycopersicum L. SlSGR2 Gene under Cadmium Stress

Cd stress can cause severe damage to the chloroplast structure and plant function. The chloroplast stay-green gene (SGR2) is senescence-inducible and has several important functions such as regulating senescence, responding to abiotic stress, and regulating seed and fruit ripening. The SlSGR2 gene was cloned from the tomato “Hongluocheng” (full-length of 819 bp encoding 272 amino acids). Subcellular localization prediction and laser confocal observation revealed that the SlSGR2 protein was localized to the chloroplast of A. thaliana protoplasts. A qRT-PCR analysis suggested that the SlSGR2 gene was upregulated by different Cd concentrations and that the gene expression was significantly upregulated in tomato roots and leaves under 50 μM CdCl2 treatment. The pCAMBIA2300-SlSGR2 overexpression constructs were introduced into wild-type Arabidopsis plants via Agrobacterium-mediated transformation. Homozygous mutant lines of sgr2 were identified using the three-primer method. The growth of SlSGR2-overexpressed lines under Cd stress was significantly better than that of WT and sgr2. The chlorophyll, SOD, POD, and CAT contents of OE4-1 and OE4-2 were significantly higher than those of WT and sgr2 while the MDA content was significantly lower than other lines under cadmium stress. This study showed that the SlSGR2 gene is involved in Cd-induced plant senescence and is a negative regulator of plant chlorophyll degradation.

Localized versus 360-degree laser photocoagulation with limited pars plana vitrectomy in the management of primary rhegmatogenous retinal detachment

BackgroundTo compare the efficacy of intraoperative localized and 360-degree laser photocoagulation in 23-gauge limited pars plana vitrectomy (PPV) for rhegmatogenous retinal detachment (RRD).MethodsThis retrospective, comparative, consecutive, interventional study included 155 eyes of 155 patients who underwent primary repair of RRD utilizing 23-gauge PPV with at least six months of follow up. Medical records were retrospectively reviewed, and the corresponding demographic data, preoperative ophthalmic features, surgical management, and postoperative course were recorded. Main outcome measures included single surgery anatomical success, pre- and post-operative visual acuity, and complications.ResultsEighty-three patients (group A) received localized laser photocoagulation in PPV, while the remaining 72 patients (group B) received underwent circumferential 360-degree laser photocoagulation in PPV. Two skilled-surgeons performed all the surgeries, and 23-gauge PPV instrumentation, a wide-angle viewing system, endolaser photocoagulation, and gas tamponade were used in each case. No significant difference was identified in baseline characteristics. The single surgery anatomical success rate was 96.4 % in group A, and 95.8 % in group B, showing no significant difference (p = 1.00). Primary anatomical failure was caused by re-detachment due to break in 2 eyes in each group (no new break 1 eye, new break 1eye in group A, 2 eyes with no new break in group B), and proliferative vitreoretinopathy in 1 eye in each group. Other complications were epiretinal membrane in 7 eyes (3 in group A, 4 in group B), and macular hole in 1 eye in group B. There were no differences in pre- and post-operative best-corrected visual acuity (BCVA) as well as BCVA improvement (p=0.144, p=0.866 and p=0.263, respectively).ConclusionLocalized laser photocoagulation showed no difference in anatomic and visual outcome in RRD patients, when compared with 360-degree laser photocoagulation in limited PPV. Routine circumferential 360-degree laser photocoagulation may not be necessary in vitrectomy surgery for primary rhegmatogenous retinal detachment without severe PVR.

Development of an Inundation Model for Creating Industrial Park-Scale Risk Information for Area-BCM

The 2011 flood on the Chao Phraya River in Thailand caused enormous damage. The damage was greatest to the industrial sector, accounting for more than 70% of the estimated economic damage, and the resulting disruption of the supply chains of global companies has spread not only throughout Thailand but to other countries around the world. In order to reduce such damage, it is necessary to prepare a flood manual that makes use of past flood experiences or a business continuity planning (BCP) that assumes floods. In addition, business continuity management (BCM) is needed to establish and enhance BCP. Thus, it is essential to obtain flood information on the scale of an industrial park. Therefore, in this study, to provide detailed flood information as above, in addition to a flood inundation analysis model for the Chao Phraya River Basin, a detailed model on the scale of an industrial park was developed. Specifically, we developed a 40 m mesh industrial park-scale model based on survey data using a local aerial laser and the local river channel shape. Furthermore, using the flood discharge and river discharge output obtained from a 1 km mesh model of the Chao Phraya River Basin as inputs for the industrial park scale model for the surrounding boundary conditions, we obtained a more precise inundation analysis. As a result, the flood risk information obtained from the above analysis model can be useful for BCP/BCM. In addition, detailed flood risk information such as road inundation conditions can be obtained at any location, which could be useful in creating evacuation plans for employees.

Microstructural characteristics and tribological properties of the localized laser surface treatment of AISI 420 stainless steel

In this study, a localized laser surface treatment (LLST) of AISI 420 including transformation hardening and surface melting processes was utilized using a high-power diode laser (HPDL) under different beam travel speeds in order to obtain transformed hardened and surface melted samples. Microstructural characteristics of the laser processing areas were evaluated using field emission scanning electron microscopy (FESEM) equipped with energy dispersive spectroscopy (EDS). Moreover, the tribological properties of the as-received, transformed hardened and surface melted samples were investigated. Obtained tribological results indicated that the surface melted sample has a higher coefficient of friction (COF) and greater sliding wear rate compared with the transformed hardened sample due to the increment of surface roughness and formation of δ-ferrite precipitates respectively.

Irradiation potentiates p53 phosphorylation and p53 binding to the promoter and coding region of the TP53 gene

An essential factor of the DNA damage response is 53BP1, a multimeric protein that inhibits the resection-dependent double-strand break (DBS) repair. The p53 protein is a tumor suppressor known as a guardian of the genome. Although the interaction between 53BP1 and its p53 partner is well-known in regulating gene expression, a question remains whether genome injury can affect the interaction between 53BP1 and p53 proteins or p53 binding to DNA. Here, using mass spectrometry, we determine post-translational modifications and interaction properties of 53BP1 and p53 proteins in non-irradiated and γ-irradiated cells. In addition, we used Atomic Force Microscopy (AFM) and Fluorescent Lifetime Imaging Microscopy combined with Fluorescence Resonance Energy Transfer (FLIM-FRET) for studies of p53 binding to DNA. Also, we used local laser microirradiation as a tool of advanced confocal microscopy, showing selected protein accumulation at locally induced DNA lesions. We observed that 53BP1 and p53 proteins accumulate at microirradiated chromatin but with distinct kinetics. The density of 53BP1 (53BP1pS1778) phosphorylated form was lower in DNA lesions than in the non-specified form. By mass spectrometry, we found 22 phosphorylations, 4 acetylation sites, and methylation of arginine 1355 within the DNA-binding domain of the 53BP1 protein (aa1219-1711). The p53 protein was phosphorylated on 8 amino acids and acetylated on the N-terminal domain. Post-translational modifications (PTMs) of 53BP1 were not changed in cells exposed to γ-radiation, while γ-rays increased the level of S6ph and S15ph in p53. Interaction analysis showed that 53BP1 and p53 proteins have 54 identical interaction protein partners, and AFM revealed that p53 binds to both non-specific and TP53-specific sequences (AGACATGCCTA GGCATGTCT). Irradiation by γ-rays enhanced the density of the p53 protein at the AGACATGCCTAGGCATGTCT region, and the binding of p53 S15ph to the TP53 promoter was potentiated in irradiated cells. These findings show that γ-irradiation, in general, strengthens the binding of phosphorylated p53 protein to the encoding gene.

Microstructure and Properties of a Novel Carbon‐Martensitic Hot Work Tool Steel Processed by Laser Additive Manufacturing without Preheating

Laser additive manufacturing (LAM) techniques, such as laser‐powder bed fusion (L‐PBF) or laser‐directed energy deposition (L‐DED), allow for the production of complex‐shaped parts by either the local melting of a metallic powder bed by a laser beam (L‐PBF) or a local application and laser beam melting of powder material by a nozzle (L‐DED). In the case of carbon‐martensitic tool steels, their cold crack susceptibility limits their LAM processability and is usually counteracted by substrate preheating. As preheating can increase the oxygen take‐up of the powder and alter the part microstructure, it can be disadvantageous for part quality and powder reusability. In this study, it is investigated a carbon‐martensitic steel designed for the production of parts with low crack density by LAM without preheating, focusing on the microstructure and hardness of the L‐PBF‐ and L‐DED‐manufactured steel. The steel can be LAM‐processed without preheating, resulting in specimens with low crack densities and martensitic microstructure with retained austenite. The hardness of the as‐built material (L‐PBF: 542HV30 and L‐DED: 623HV30) is increased by quenching and tempering up to 693HV30. Direct tempering of the as‐built specimen without previous quenching leads to a shift of the secondary hardness maximum from 500 to 530 °C.

Local laser oxidation of titanium film for the post-fabrication trimming of photonic integrated circuits

Local laser oxidation of a thin titanium film is considered as a means of a precise adjustment of losses and effective refractive index of dielectric optical waveguides. A fine phase control of an operating point and extinction ratio enhancement up to 57 dB were demonstrated using an integrated optical Ti:LiNbO3 Mach-Zehnder modulator. This technique only slightly affects the dielectric waveguide material and is very promising for a high precision permanent trimming of photonic devices based on dielectric waveguides of different material platforms and fabrication technologies.

Research on in situ laser cladding of 304 stainless steel coating on Q235 substrate in underwater environment

In this research, 304 stainless steel coating was prepared on the surface of Q235 steel by in situ laser cladding technology in both underwater and in-air environments. The optimal process parameters of laser cladding in the underwater environment were first investigated by using a homemade local dry laser torch. The effects of the laser power, scanning speed, and wire feed speed on macroscopic forming, geometric characteristics, and the microstructure of the cladding layers were investigated. Under the optimal process parameters, the effects of the water environment on macroscopic forming, geometric characteristics, and the microstructure and microhardness of the cladding layers were studied. The results showed that as the environment transferred from underwater to air, the height (H) and cladding angle (α) of the deposited region (DR) decreased, but the fusion width (W) and the depth (h) of the fusion region (FR) increased due to the slow cooling rate and long residence time at high temperatures. For both underwater and in-air cladding layers, the microstructure of DR and FR was equiaxed dendrites and columnar dendrites. Besides, a cellular structure appeared in the FR of the underwater cladding layer. The width of the lathy δ ferrite in the FR in the underwater environment was smaller than that of the in-air environment. Finally, the grain size of the underwater specimen was finer, so the average microhardness value of the in-air specimen was lower than that of the underwater specimen.

A green route for lignin-derived graphene electrodes: A disposable platform for electrochemical biosensors

The tremendous growth of disposable electrode-based portable devices for point-of-care testing requires mass production of disposable electrodes in a low-cost and sustainable manner. Here, we demonstrate a green route for the conversion of biomass lignin, patterning, and reduction of the lignin-derived graphene electrodes by sequential laser lithography, water lift-off and sodium borohydride (NaBH4) treatment, and their use for electrochemical lactate biosensors. Energy-saving and localized laser lithography converted the aromatic ring-rich lignin into porous laser-induced graphene (LIG). The conductivity and attachment of the LIG to the substrate were optimized in a factorial experiment with laser power and scan speed as variables. Characterization results revealed the conversion of partial heteroatoms (e.g., Na, S, O) into granular inorganic compounds on the LIG surface under laser treatment. Water was used as an eco-friendly solvent for the patterning of the LIG (P-LIG) by a lift-off process, where the inorganic residues and un-reacted lignin were dissolved, exposing the macro-/micro-pores in the P-LIG. NaBH4 induced a reduction of the P-LIG (P-rLIG) resulting in improved electrochemical kinetics with lower charge transfer resistance (27.3 Ω) compared to the LIG (248.1 Ω) and the P-LIG (61.4 Ω). The porous P-rLIG served as a 3D electrode for the deposition of Prussian blue and lactate oxidase for disposable electrochemical lactate biosensors, delivering a good analytical performance towards lactate detection with a linear range up to 16 mM and a high sensitivity (1.21 μA mM−1). These lignin-derived disposable electrodes, utilizing renewable resources together with low-energy consumption fabrication and patterning, may contribute to the sustainable manufacturing of biosensors for point-of-care and point-of-use applications.

Deciphering modes of long-range energy transfer in perovskite crystals using confocal excitation and wide-field fluorescence spectral imaging

Excitation energy migration beyond mesoscale is of contemporary interest for both solar photovoltaic and light-emissive devices, especially in context of organometal halide perovskites (OMHPs) which have been shown to have very long (charge carrier) diffusion lengths. While understanding the energy propagation pathways in OMHPs is crucial for further advancement of material design and improvement of opto-electronic features, the simultaneous existence of multiple processes like carrier diffusion, photon recycling, and photon transport makes it often complex to differentiate them. In this study, we unravel the diverse yet dominant excitation energy transfer mode(s) in crystalline MAPbBr3 micron-sized 1D rods and plates by localized (confocal) laser excitation coupled with spectrally-resolved wide-field fluorescence imaging. While rarely used, this technique can efficiently probe excitation migration beyond the diffraction limit and can be realized by simple modification of existing epifluorescence microscopy setups. We find that in rods of length below ∼2 microns, carrier diffusion dominates amongst various energy transfer processes. However, the transient non-radiative defects severely inhibit the extent of carrier migration and also temporarily affect the radiative recombination dynamics of the photo-carriers. For MAPbBr3 plates of several tens of micrometers, we find that the photoluminescence (PL) spectral characteristics remain unaltered at short distances (< ∼3 μm) while at a larger distance, the spectral profile is gradually red-shifted. This implies that carrier diffusion dominates over small distances, while photon recycling, i.e., repeated re-absorption and re-emission of photons, propagates excitation energy transfer over extended length scales with assistance from wave-guided photon transport. Our findings can potentially be used for future studies on the characterization of energy transport mechanisms in semiconductor solids as well as for organic (molecular) self-assembled microstructures.

Tuning of silicon nitride micro-cavities by controlled nanolayer deposition

Integration of single-photon emitters (SPEs) with resonant photonic structures is a promising approach for realizing compact and efficient single-photon sources for quantum communications, computing, and sensing. Efficient interaction between the SPE and the photonic cavity requires that the cavity's resonance matches the SPE’s emission line. Here we demonstrate a new method for tuning silicon nitride (Si3N4) microring cavities via controlled deposition of the cladding layers. Guided by numerical simulations, we deposit silicon dioxide (SiO2) nanolayers onto Si3N4 ridge structures in steps of 50 nm. We show tuning of the cavity resonance exceeding a free spectral range (FSR) of 3.5 nm without degradation of the quality-factor (Q-factor) of the cavity. We then complement this method with localized laser heating for fine-tuning of the cavity. Finally, we verify that the cladding deposition does not alter the position and spectral properties of nanoparticles placed on the cavity, which suggests that our method can be useful for integrating SPEs with photonic structures.

Hyaluronic Acid-Enwrapped Polyoxometalate Complex for Synergistic Near Infrared-II Photothermal/Chemo-Therapy and Chemodynamic Therapy.

To enhance the efficacy of tumor therapy, the collection of functional components into a targeting system shows advantages over most homogeneous materials in inducing apoptosis of cancer cells. The security and targeting of therapeutic agents also require the effect combination of additional components. However, the construction of multifunctional composites in a simple system with intelligent cooperative responsiveness remains a challenge. Herein, a reduced polyanionic cluster (rP2W18) bearing the absorption at the near infrared (NIR) II region is used as a core carrier to bind the positively charged doxorubicin hydrochloride (DOX) through ionic interaction. To reduce the physiological toxicity, hyaluronic acid grafting β-cyclodextrin side chains is used to cover the ionic complex through host-guest inclusion to DOX. When the nanocomposite is activated by local laser exposure, the final three-component therapeutic agent is demonstrated to present targeted photothermal conversion capability and chemodynamic activity together with chemotherapy. With the controlled release of DOX under the stimulation of mild acidity in the tumor region and photothermal effect, the exposed rP2W18 is aroused by hydrogen peroxide overexpressed in a tumor microenvironment to produce toxic reactive oxygen species, 1O2. This work presents an opportunity for the development of a nanocomposite in NIR-II photothermal/chemo-therapy and chemodynamic synergistic therapy.

Secure key distribution based on hybrid chaos synchronization between semiconductor lasers subject to dual injections.

We propose and numerically demonstrate a novel secure key distribution (SKD) scheme by using dynamically synchronized semiconductor lasers (SLs) subject to common dual injections from two mutually coupled SLs. The performance of hybrid chaos synchronization, complexity of chaotic signals, chaos-based key distribution, and the privacy of SKD scheme are systematically discussed. It is shown that high-quality hybrid chaos synchronization of zero lag and lead lag can be both achieved between two local lasers under different injection delay conditions, whereas low cross correlations are observed among the driving lasers and the local lasers. By randomly perturbing the injection delays with four independent random sequences, the outputs of local SLs can be dynamically synchronized. Extracting the outputs in the synchronization time slots of zero lag and lead lag, synchronous entropy sources are obtained and used to generate keys with high consistency at local ends of Alice and Bob, which are robust to the parameter mismatches of local lasers to some extent. Moreover, large BER is calculated in two types of typical illegal attacks, which demonstrates the security of the proposed scheme. This work proposed a high-level secure key distribution solution to one-time pad communication.

Large‐Scale Laser Nanopatterning of Multiband Tunable Mid‐Infrared Metasurface Absorber

AbstractLarge‐scale nanopatterning at low cost and high throughput is crucial to the practical applications of metasurfaces. Phase‐change materials equipped in these metasurfaces as modulation layers or resonators are generally applied to achieve a tunable function and have attracted significant attention. Here, an efficient method is developed by combining ultrafast laser localized modification/ablation and subsequent etching to fabricate nanostructures on a phase‐change material, Ge2Sb2Te5 (GST), over a wafer‐sized area. The localized laser treatments under gradually increased laser fluences contribute to the variety of achievable nanostructures including disk and ring structures, whose feature sizes and periods can be tuned by adjusting laser parameters and subsequent etching conditions. A mid‐infrared metasurface absorber is designed and fabricated by using the GST ring units as resonators. Notably, varying the geometrical features of rings allows generating dual‐band and tri‐band absorption peaks in the mid‐infrared spectral range, whose peak absorptivity can reach ≈92%. By converting GST from amorphous to crystalline state, a broad absorption spectral redshift of 700 nm is achieved. The large‐area high‐throughput fabrication together with high‐absorption design demonstrates their potential in mass production of phase‐change metasurface‐based absorbers.

Fluorescence-based thermometry for precise estimation of nanoparticle laser-induced heating in cancerous cells at nanoscale.

Photothermal therapy (PTT) has attracted increasing interest as a complementary method to be used alongside conventional therapies. Despite a great number of studies in this field, only a few have explored how temperatures affect the outcome of the PTT at nanoscale. In this work, we study the necrosis/apoptosis process of cancerous cells that occurs during PTT, using a combination of local laser heating and nanoscale fluorescence thermometry techniques. The temperature distribution within a whole cell was evaluated using fluorescence lifetime imaging microscopy during laser-induced hyperthermia. For this, gold nanorods were utilized as nanoheaters. The local near-infrared laser illumination produces a temperature gradient across the cells, which is precisely measured by nanoscale thermometry. This allows one to optimize the PTT conditions by varying concentration of gold nanorods associated with cells and laser power density. During the PTT procedure, such an approach enables an accurate determination of the percentages of apoptotic and necrotic cells using 2D and 3D models. According to the performed cell experiments, the influence of temperature increase during the PTT on cell death mechanisms has been verified and determined. Our investigations can improve the understanding of the PTT mechanisms and increase its therapeutic efficiency while avoiding any side effects.

Optically addressable universal holonomic quantum gates on diamond spins

The ability to individually control the numerous spins in a solid-state crystal is a promising technology for the development of large-scale quantum processors and memories. A localized laser field offers spatial selectivity for electron spin manipulation through spin–obit coupling, but it has been difficult to simultaneously achieve precise and universal manipulation. Here, we demonstrate microwave-driven holonomic quantum gates on an optically selected electron spin in a nitrogen-vacancy centre in diamond. The electron spin is precisely manipulated with global microwaves tuned to the frequency shift induced by the local optical Stark effect. We show the universality of the operations, including state initialization, preparation, readout and echo. We also generate optically addressable entanglement between the electron and adjacent nitrogen nuclear spin. High-fidelity operations are achieved by applying amplitude-alternating pulses, which are tolerant to fluctuations in microwave intensity and detuning. These techniques enable site-selective quantum teleportation transfer from a photon to a nuclear spin memory, paving the way for the realization of distributed quantum computers and the quantum Internet with large-scale quantum storage.