Adipose Liver Research Articles

Adipose tissue-derived microRNA-450a-5p induces type 2 diabetes mellitus by downregulating DUSP10.

Type 2 diabetes mellitus (T2DM) has rapidly increased worldwide, emerging as the fifth leading cause of death. The treatment of T2DM is challenging due to the side effects of oral hypoglycemic drugs and the limited efficacy of long-term insulin therapy, which can lead to insulin resistance (IR). Consequently, there is significant in discovering new drugs that have minimal side effects and a pronounced hypoglycemic effect. In obesity, microRNA levels have been implicated in glucose metabolism disorders and T2DM, although many aspects remain unresolved. Here, we confirmed that visceral adipose tissue and serum microRNA-450a-5p content increased under obesity and T2DM, and it was significantly positively associated with fasting blood glucose, triglycerides, cholesterol, low-density lipoproteins-cholesterol levels of the subjects. In high-fat diet (HFD)-induced obese mice, microRNA-450a-5p expression was increased in the serum, liver, and white adipose tissue. Moreover, the adipose Dicer-knockout mouse model was constructed to identify adipose tissue as the main source of microRNA-450a-5p. microRNA-450a-5p could inactivate the insulin signal pathway by targeting the inhibited Dual Specificity Phosphatase 10 (DUSP10) and inducing IR and glucose metabolism disorders in vitro cultured hepatocytes and adipocytes. Additionally, microRNA-450a-5p was found to regulate DUSP10 expression and insulin signaling activity, influencing glucose tolerance and insulin sensitivity across various models, including normal diet, HFD-induced obese, adipose tissue-specific microRNA-450a-5p-knockout, and db/db mice. Furthermore, gallic acid might play a potential role in inhibiting glucose levels by decreasing microRNA-450a-5p expression. Thus, microRNA-450a-5p emerges as an attractive therapeutic target for addressing obesity, IR, and T2DM.

Upregulation of p52-ZER6 (ZNF398) increases reactive oxygen species by suppressing metallothionein-3 in neuronal cells.

ZNF398/ZER6 belongs to the Krüppel-associated box (KRAB) domain-containing zinc finger proteins (K-ZNFs), the largest family of transcriptional repressors in higher organisms. ZER6 exists in two isoforms, p52 and p71, generated through alternative splicing. Our investigation revealed that p71-ZER6 is abundantly expressed in the stomach, kidney, liver, heart, and brown adipose tissue, while p52-ZER6 is predominantly found in the stomach and brain. The role of p52-ZER6 in neurons has remained unclear. Leveraging open-source RNA-seq data, we identified metallothionein 3 (MT3) as a target gene of p52-ZER6 in mouse hippocampal neuronal HT-22cells. Through chromatin immunoprecipitation assays, we identified the putative DNA-binding motif (CTAGGGGGGTTGTTATCTCTTTGG) of p52-ZER6 in the promoter region of MT3. Furthermore, we demonstrated an interaction between p52-ZER6 and estrogen receptor alpha (ERα) in the nucleus of SH-SY5Y cells, which led to the inhibition of p52-ZER6's DNA occupancy on the promoter of the MT3 gene. MT3 is a cysteine-rich, low molecular-weight protein known for reducing oxidative stress, reactive oxygen species (ROS), and metal toxicity. Our study revealed that overexpression of p52-ZER6 reduced the levels of MT3, increasing ROS levels, which was mitigated by co-overexpression of ERα. Notably, we also observed upregulation of p52-ZER6 and reduction of MT3 in the cortex of 5xFAD, an Alzheimer's disease (AD) mouse model. These findings suggest a potential pathological mechanism involving p52-ZER6-mediated ROS production in AD pathogenesis.

Age-invariant genes: multi-tissue identification and characterization of murine reference genes.

Studies of the aging transcriptome focus on genes that change with age. But what can we learn from age-invariant genes-those that remain unchanged throughout the aging process? These genes also have a practical application: they can serve as reference genes in expression studies. Reference genes have mostly been identified and validated in young organisms, and no systematic investigation has been done across the lifespan. Here, we build upon a common pipeline for identifying reference genes in RNA-seq datasets to identify age-invariant genes across seventeen C57BL/6 mouse tissues (brain, lung, bone marrow, muscle, white blood cells, heart, small intestine, kidney, liver, pancreas, skin, brown, gonadal, marrow, and subcutaneous adipose tissue) spanning 1 to 21+ months of age. We identify 9 pan-tissue age-invariant genes, and many tissue-specific age-invariant genes. These genes are stable across the lifespan and are validated in independent bulk RNA-seq datasets and RT-qPCR. Age-invariant genes have shorter transcripts and are enriched for CpG islands. Interestingly, pathway enrichment analysis for age-invariant genes identifies an overrepresentation of molecular functions associated with some, but not all, hallmarks of aging. Thus, even though hallmarks of aging typically involve change, select genes associated with these hallmarks resist age-related change. Finally, our analysis provides a list of murine tissues where classical reference genes are appropriate for application in aging studies. However, no classical reference gene is appropriate across all aging tissues. Instead, we provide novel tissue-specific and pan-tissue reference genes for assays utilizing gene normalization (RT-qPCR) that can be applied to mice across the lifespan.

Downregulation of collagen IV deposition and ITGB1-FAK signaling pathway to inhibit adipogenesis: A novel mechanism of swertiamarin in treating type 2 diabetes mellitus.

Extracellular matrix (ECM) and integrins are important biological macromolecules. ECM especially collagen IV (COLIV) deposition modulates the integrin-FAK signaling pathway involved in adipogenesis and is strongly associated with insulin resistance. Type 2 diabetes mellitus (T2DM) mice were given swertiamarin (STM) by intragastric administration. STM reduced body weight, blood glucose, and lipid levels and enhanced insulin sensitivity in diabetic mice. The lipid accumulation in liver, gastrocnemius muscle, and inguinal subcutaneous white adipose tissue (igSWAT) were significantly reduced by STM. Bioinformatics analysis revealed a connection between ECM, ITGB1/FAK, and PI3K/Akt signaling pathways. STM downregulated the adipogenesis, IRβ expression, COLIV deposition, ITGB1/FAK, and PI3K/Akt signaling pathways in igSWAT of diabetic mice. In vitro, STM inhibited the glucose uptake and differentiation of adipocytes, and downregulated adipogenesis-related gene and protein expression. STM is bound to ITGB1 and downregulated COLIV deposition, ITGB1/FAK, and PI3K/Akt signaling pathways. When we overexpressed FAK, the effects of STM on downstream PI3K/Akt signaling pathway and adipogenesis were attenuated. In conclusion, STM reduced COLIV deposition and binding with ITGB1 to downregulate ITGB1/FAK signaling pathway, further the downstream PI3K/Akt signaling pathway was inhibited to reduce adipogenesis and ameliorated T2DM. Thus, these signals may be a novel mechanism of STM in treating T2DM.

Tetragonia tetragonioides extract prevented high-fat diet-induced obesity and changed hepatic and adipose transcriptomic signatures in C57BL/6J male mice.

Obesity, often driven by high-fat diets (HFD), is a major global health issue, necessitating effective preventive measures. Tetragonia tetragonoides, a plant with known medicinal properties, has not been extensively studied for its effects on HFD-induced obesity and related genetic changes in mice. This study explores the impact of Tetragonia tetragonoides extract (TTE; 300 mg/kg) on obesity-related traits in C57BL/6J male mice, with a focus on transcriptomic changes in the liver and white adipose tissue (WAT). Over eight weeks, TTE supplementation led to significant reductions in obesity-related phenotypes and modulated gene expression altered by HFD. Key genes like Cd180 and MUPs, linked to immune responses and lipid metabolism, were notably influenced by TTE. The study highlighted TTE's effects on lipid metabolism pathways in the liver and immune processes in WAT, underscoring its potential as an anti-obesity agent, while advocating for further research into its bioactive components.

Dietary caloric input and tumor growth accelerate senescence and modulate liver and adipose tissue crosstalk

Metabolic alterations are related to tumorigenesis and other age-related diseases that are accelerated by “Westernized” diets. In fact, hypercaloric nutrition is associated with an increased incidence of cancers and faster aging. Conversely, lifespan-extending strategies, such as caloric restriction, impose beneficial effects on both processes. Here, we investigated the metabolic consequences of hypercaloric-induced aging on tumor growth in female mice. Our findings indicate that a high-fat high-sucrose diet increases tumor growth mainly due to the boosted oxidation of glucose and fatty acids. Consequently, through an increased expression of lactate, IGFBP3, and PTHLH, tumors modulate liver and white adipose tissue metabolism. In the liver, the induced tumor increases fibrosis and accelerates the senescence process, despite the lower systemic pro-inflammatory state. Importantly, the induced tumor induces the wasting and browning of white adipose tissue, thereby reversing diet-induced insulin resistance. Finally, we suggest that tumor growth alters liver-adipose tissue crosstalk that upregulates Fgf21, induces senescence, and negatively modulates lipids and carbohydrates metabolism even in caloric-restricted-fed mice.

Skeletal and Adipose Manifestations of Stress in a Contemporary Pediatric Sample.

Adverse experiences leading to physiological disruptions (stress) in early life produce cascade effects on various biological systems, including the endocrine and metabolic systems, which, in turn, shape the developing skeletal system. To evaluate the effects of stress on adipose and skeletal tissues, we examine the relationship between skeletal indicators of stress (porotic hyperostosis [PH] and cribra orbitalia [CO]), bone mineral density (BMD), vertebral neural canal (VNC) diameters, and adipose tissue distribution in a contemporary pediatric autopsy sample. Data is from 702 (409 males, 293 females) individuals from a pediatric (0.5-20.9 years) autopsy sample from New Mexico who died between 2011 and 2022. Data includes visceral adipose tissue (VAT) in the abdomen, heart, and liver, CO/PH, VNC size of the fifth lumbar vertebra, and BMD. We find that adipose tissue distribution and location are differentially associated with CO/PH, BMD, and VNC size; VNC size is smaller, and liver adiposity is higher in those with CO/PH. Further, increased VAT and small VNC size are associated with PH presence and low BMD. Body mass index categories do not correspond with porous cranial lesion presence. This paper provides evidence for the complex relationship between skeletal markers of early-life stress (CO/PH, reduced VNC size, low BMD) and endocrine system function. VAT distribution and VNC size are partly shaped by stressors during gestation, likely through alterations of the HPA axis. It is possible that alterations of the HPA axis due to gestational stress also shape the expression of porous cranial lesionsduring exposure to childhood stressors.

Comparative analysis of barley dietary fiber fermented with and without Lactiplantibacillus plantarum dy-1 in promoting gut health and regulating hepatic energy metabolism in high-fat diet-induced obese mice.

A previous study has revealed that Lactiplantibacillus plantarum (Lp. plantarum) dy-1 fermentation changed the structural properties and in vitro fecal fermentation characteristics of barley dietary fiber. However, the health-promoting effects of fermented dietary fiber in vivo remained unclear. This study was aimed at comparing the ameliorative effects of barley dietary fiber fermented with or without Lp. plantarum dy-1 on lipid metabolism, gut microbiota composition and hepatic energy metabolism. After a twelve-week intervention, fermented barley dietary fiber (FBDF) reduced the body weight and fat accumulation in liver and epididymal white adipose tissue, improved HFD-induced hyperlipidemia and glucose intolerance, and increased short chain fatty acid (SCFA) levels, exhibiting effects that were better than those of raw barley dietary fiber (RBDF). FBDF supplementation improved the gut microbiota composition, specifically enhancing the abundance of probiotic and SCFA-producing bacteria, such as Akkermansia and Muribaculaceae, while RBDF exhibited regulatory effects on harmful bacteria (Escherichia-Shigella and Desulfovibrionaceae). Additionally, FBDF up-regulated the expression of genes related to energy metabolic processes, such as aerobic respiration and oxidative phosphorylation, inhibited the genes related to lipid biosynthetic metabolism, and improved the activities of hepatic energy metabolism-related enzymes, demonstrating effects that were better than those of RBDF. Therefore, this study indicated the potential of using FBDFs as healthy food resources to prevent obesity or as prebiotics to improve gut microbiota.

Enhancing metabolic and inflammatory status in insulin-resistant rats: Acute intervention with cocoa flavanols and submaximal aerobic exercise activates intracellular signaling pathways for glucose metabolism.

Type 2 diabetes, characterized by hyperglycemia, is closely linked to obesity and low-grade inflammation. Acute cocoa flavanols (CF) intake has demonstrated benefits in vasoreactivity, cognitive functions, and antioxidant enzyme activity. However, the physiological mechanisms of CF concerning glucose uptake, inflammatory mediators, and their interplay with aerobic exercise remain unclear in populations with metabolic diseases. This study aims to investigate the acute effects of CF, alone or combined with acute aerobic exercise on mechanisms involved in glucose uptake and inflammatory mediators in the liver, skeletal muscle, pancreas, and adipose tissue in insulin-resistant (IR) rats. Sixty-four Wistar rats (250±10g; 15 weeks age) were subjected to a regular chow (CON) or an obesity-associated insulin-resistant (IR) state induced by a high-fat diet and fructose-rich beverage for 30 days. Seventy-two hours after an incremental maximal treadmill running test, rats received a placebo solution or CF supplementation (45mg·kg-1 of body weight). One hour later, they either rested or ran on a treadmill at 60% of peak oxygen uptake (VO2peak) for 30min. Euthanasia occurred 30min post-experimental sessions. Inflammatory and anti-inflammatory cytokines were assayed using ELISA in the liver, pancreas, gastrocnemius muscle, and epididymal adipose tissues. TRB3 and CPT1 mRNA were assessed by q-RTPCR in the liver and gastrocnemius muscle while Akt and AMPK phosphorylation were examined by immunohistochemistry. CF attenuated hyperglycemia observed after submaximal aerobic exercise in IR rats (p<0.001). In the liver, CF exhibited additive effects to aerobic exercise, enhancing Akt protein phosphorylation, potentially contributing to improved glucose uptake in IR rats. Submaximal aerobic exercise and CF increased AMPK protein phosphorylation in the liver (p<0.001) and skeletal muscle (p<0.001), reduced TRB3 gene expression (p<0.01), elevated CPT-1a gene expression (p<0.001), and ameliorated the inflammatory milieu in the pancreas, adipose tissue, liver, and gastrocnemius muscle. Acute intake, of CF combined with submaximal aerobic exercise activates key proteins and genes involved in glucose uptake and lipid metabolism, improving the inflammatory milieu. This synergistic effect may contribute to mitigating metabolic complications associated with insulin resistance.

Feline Diabetes Is Associated with Deficits in Markers of Insulin Signaling in Peripheral Tissues.

Like humans, cats have a strong relationship between decreasing insulin sensitivity and the development of diabetes with obesity. However, the underlying molecular mechanisms of impaired insulin secretion and signaling in cats remain largely unknown. A total of 54 client-owned nondiabetic lean (n = 15), overweight (n = 15), and diabetic (n = 24) cats were included in the study. The pancreas, liver, and skeletal muscle were quantified for mRNA and protein abundances of insulin and incretin signaling markers. Diabetic cats showed increased liver and muscle adiposity. The pancreas of diabetic cats had decreased transcript abundances of insulin, insulin receptor, insulin-receptor substrate (IRS)-1, glucose transporters (GLUT), and protein abundance of mitogen-activated protein kinase. In treated diabetics, protein abundance of glucagon-like peptide-1 and glucose-dependent insulinotropic peptide receptors, total and phosphorylated Akt, and GLUT-1 were increased in the pancreas, whereas untreated diabetics had downregulation of markers of insulin and incretin signaling. In the muscle and liver, diabetic cats had reduced mRNA abundances of insulin receptor, IRS-1/2, and phosphatidylinositol-3-kinase, and reduced protein abundances of GLUT-4 and phosphatidylinositol-3-kinase-p85α in muscle. We demonstrate that feline diabetes is associated with ectopic lipid deposition in the liver and skeletal muscle, deficits in insulin synthesis and incretin signaling in the pancreas, and impaired insulin signaling in the muscle and liver. These findings have implications for understanding the pathophysiological mechanisms of obesity and diabetes in humans and pets.

Sympathetic innervation of interscapular brown adipose tissue is not a predominant mediator of Oxytocin (OT)-elicited reductions of body weight gain and adiposity in male diet-induced obese rats.

Recent studies indicate that central administration of oxytocin (OT) reduces body weight (BW) in high fat diet-induced obese (DIO) rodents by reducing energy intake and increasing energy expenditure (EE). Previous studies in our lab have shown that administration of OT into the fourth ventricle (4V; hindbrain) elicits weight loss and stimulates interscapular brown adipose tissue temperature (TIBAT) in DIO rats. We hypothesized that OT-elicited stimulation of sympathetic nervous system (SNS) activation of IBAT contributes to its ability to activate BAT and reduce BW in DIO rats. To test this, we determined the effect of disrupting SNS activation of IBAT on OT-elicited stimulation of TIBAT and reduction of BW in DIO rats. We first confirmed that bilateral surgical SNS denervation to IBAT was successful based on having achieved ≥ 60% reduction in IBAT norepinephrine (NE) content from DIO rats. NE content was selectively reduced in IBAT by 94.7 ± 2.7, 96.8 ± 1.8 and 85.9 ± 6.1% (P<0.05) at 1, 6 and 7-weeks post-denervation, respectively, and was unchanged in liver or inguinal white adipose tissue. We then measured the impact of bilateral surgical SNS denervation to IBAT on the ability of acute 4V OT (1, 5 μg) to stimulate TIBAT in DIO rats. We found that the high dose of 4V OT (5 μg) stimulated TIBAT similarly between sham and denervated rats (P=NS) and that the effects of 4V OT to stimulate TIBAT did not require beta-3 adrenergic receptor signaling. We subsequently measured the effect of bilateral surgical denervation of IBAT on the effect of chronic 4V OT (16 nmol/day) or vehicle infusion to reduce BW, adiposity, and energy intake in DIO rats. Chronic 4V OT reduced BW gain by -7.2 ± 9.6 g and -14.1 ± 8.8 g in sham and denervated rats (P<0.05 vs vehicle treatment), respectively, and this effect was similar between groups (P=NS). These effects were associated with reductions in adiposity and energy intake (P<0.05). Collectively, these findings support the hypothesis that sympathetic innervation of IBAT is not required for central OT to increase BAT thermogenesis and reduce BW gain and adiposity in male DIO rats.

Peanut Shell Extract Improves Markers of Glucose Homeostasis in Diabetic Mice by Modulating Gut Dysbiosis and Suppressing Inflammatory Immune Response.

There is strong evidence that the tripartite interaction between glucose homeostasis, gut microbiota, and the host immune system plays a critical role in the pathophysiology of type 2 diabetes mellitus (T2DM). We reported previously that peanut shell extract (PSE) improves mitochondrial function in db/db mice by suppressing oxidative stress and inflammation in the liver, brain, and white adipose tissue. This study evaluated the impacts of PSE supplementation on glucose homeostasis, liver histology, intestinal microbiome composition, and the innate immune response in diabetic mice. Fourteen db/db mice were randomly assigned to a diabetic group (DM, AIN-93G diet) and a PSE group (1% wt/wt PSE in the AIN-93G diet) for 5 weeks. Six C57BL/6J mice received the AIN-93G diet for 5 weeks (control group). Parameters of glucose homeostasis included serum insulin, HOMA-IR, HOMA-B, and the analysis of pancreatic tissues for insulin and glucagon. We assessed the innate immune response in the colon and liver using a microarray. Gut microbiome composition of cecal contents was analyzed using 16S rRNA gene amplicon sequencing. PSE supplementation improved glucose homeostasis (decreased serum insulin concentration, HOMA-IR, and HOMA-B) and reduced hepatic lipidosis in diabetic mice. PSE supplementation reversed DM-induced shifts in the relative abundance of amplicon sequence variants of Enterorhabdus, Staphylococcus, Anaerotruncus, and Akkermansia. Relative to the DM mice, the PSE group had suppressed gene expression levels of Cd8α, Csf2, and Irf23 and increased expression levels of Tyk2, Myd88, and Gusb in the liver. This study demonstrates that PSE supplementation improves T2DM-associated disorders of diabetic mice, in part due to the suppression of innate immune inflammation.

Nidogen 2 Overexpression Promotes Hepatosteatosis and Atherosclerosis.

Clinical and genetic studies strongly support a significant connection between nonalcoholic fatty liver disease (NAFLD) and atherosclerotic cardiovascular disease (ASCVD) and identify ASCVD as the primary cause of death in NAFLD patients. Understanding the molecular factors and mechanisms regulating these diseases is critical for developing novel therapies that target them simultaneously. Our preliminary immunoblotting experiments demonstrated elevated expression of nidogen 2 (NID2), a basement membrane glycoprotein, in human atherosclerotic vascular tissues and murine steatotic livers. Therefore, we investigated the role of NID2 in regulating hepatosteatosis and atherosclerosis utilizing Western diet-fed Apoe-/- mice with/without NID2 overexpression. Quantitative real-time PCR confirmed increased NID2 mRNA expression in multiple organs (liver, heart, kidney, and adipose) of NID2-overexpressing mice. Male mice with NID2 overexpression exhibited higher liver and epididymal white adipose tissue mass, increased hepatic lipid accumulation, and fibrosis. Additionally, these mice developed larger atherosclerotic lesions in the whole aortas and aortic roots, with increased necrotic core formation. Mechanistic studies showed reduced AMPK activation in the livers of NID2-overexpressing mice compared with controls, without any effects on hepatic inflammation. In conclusion, these findings suggest that NID2 plays a deleterious role in both hepatosteatosis and atherosclerosis, making it a potential therapeutic target for these conditions.

CT Characterization of Lipid Metabolism in Clear Cell Renal Cell Carcinoma: Relationship Between Liver Hounsfield Unit Values and Adipose Differentiation-Related Protein Gene Expression.

Radiogenomics is an emerging field that links imaging features with molecular characteristics of diseases. In clear cell renal cell carcinoma (ccRCC), metabolic reprogramming leads to lipid accumulation, influenced by the adipose differentiation-related protein (ADFP). This study aimed to investigate whether hepatic and tumoral Hounsfield Unit (HU) values could serve as noninvasive radiogenomic biomarkers for ADFP expression in ccRCC. We analyzed CT images of 185 ccRCC patients, comparing lipid-associated HU values in the liver and tumor across ADFP expression statuses. Patients with low-grade ccRCC expressing ADFP showed significantly lower minimum HU values in both liver and tumor tissue, indicating greater lipid accumulation. Additionally, ADFP expression correlated negatively with abdominal adipose tissue compartments and positively with minimum tumoral HU values, linking systemic lipid metabolism to tumor biology. These findings suggest that hepatic and tumoral HU measurements may serve as noninvasive markers of lipid accumulation related to ADFP, providing insight into metabolic alterations in ccRCC. While promising, these results require validation in larger, controlled studies due to sample size and variability limitations. This approach could enhance the radiogenomic assessment of ccRCC, supporting noninvasive insights into tumor metabolism and progression.

Effects of Prolactin Inhibition on Lipid Metabolism in Goats.

Prolactin (PRL) has recently been found to play a role in lipid metabolism in addition to its traditional roles in lactation and reproduction. However, the effects of PRL on lipid metabolism in liver and adipose tissues are unclear. Therefore, we aimed to study the role of PRL on lipid metabolism in goats. Twenty healthy eleven-month-old Yanshan cashmere goats with similar body weights (BWs) were selected and randomly divided into a control (CON) group and a bromocriptine (BCR, a PRL inhibitor, 0.06 mg/kg, BW) group. The experiment lasted for 30 days. Blood was collected on the day before BCR treatment (day 0) and on the 15th and 30th days after BCR treatment (days 15 and 30). On day 30 of treatment, all goats were slaughtered to collect their liver, subcutaneous adipose, and perirenal adipose tissues. A portion of all collected tissues was stored in 4% paraformaldehyde for histological observation, and another portion was immediately stored in liquid nitrogen for RNA extraction. The PRL inhibition had inconclusive effects found on BW and average daily feed intake (ADFI) in goats (p > 0.05). PRL inhibition decreased the hormone-sensitive lipase (HSL) levels on day 30 (p < 0.05), but the effects were inconclusive on days 0 and 15. PRL inhibition had inconclusive effects found on total cholesterol (TCH), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), fatty acid synthase (FAS), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), and acetyl-CoA carboxylase (ACC) on days 0, 15, and 30 (p > 0.05). Furthermore, hematoxylin-eosin (HE) staining of the liver, subcutaneous adipose, and perirenal adipose sections showed that PRL inhibition had inconclusive effects on the pathological changes in their histomorphology (p > 0.05), but measuring adipocytes showed that the area of perirenal adipocytes decreased in the BCR group (p < 0.05). The qPCR results showed that PRL inhibition increased the expression of PRL, long-form PRL receptor (LPRLR), and short-form PRL receptor (SPRLR) genes, as well as the expression of genes related to lipid metabolism, including sterol regulatory element binding transcription factor 1 (SREBF1); sterol regulatory element binding transcription factor 2 (SREBF2); acetyl-CoA carboxylase alpha (ACACA); fatty acid synthase (FASN); 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR); 7-dehydrocholesterol reductase (DHCR7); peroxisome proliferator-activated receptor gamma (PPARG); and lipase E, hormone-sensitive type (LIPE) in the liver (p < 0.05). In the subcutaneous adipose tissue, PRL inhibition increased SPRLR gene expression (p < 0.05) and decreased the expression of genes related to lipid metabolism, including SREBF1, SREBF2, ACACA, PPARG, and LIPE (p < 0.05). In the perirenal adipose tissue, the inhibition of PRL decreased the expression of the PRL, SREBF2, and HMGCR genes (p < 0.05). In conclusion, the inhibition of PRL decreases the serum HSL levels in cashmere goats; the effects of PRL on lipid metabolism are different in different tissues; and PRL affects lipid metabolic activity by regulating different PRLRs in liver and subcutaneous adipose tissues, as well as by decreasing the expression of the PRL, SREBF2, and HMGCR genes in perirenal adipose tissue.

Long-Term Propolis Intake-Induced Liver Lipid Remodeling in Mice: Effects on Phospholipid-to-Glycerolipid Metabolism and Free Fatty Acid-Mediated Thermogenesis.

Research on the patterns and mechanisms of liver lipid remodeling regulated by propolis is limited. In the present study, the nine-month experimental duration has shed light on the positive influences of propolis on lipid metabolism and thermogenesis capacity in the livers of mice. Eight major compounds in propolis were characterized using UPLC-QTOF-MS technology. Propolis significantly lowered serum triglycerides (TGs) and low-density lipoprotein cholesterol (LDL-C), but it also led to increased insulin (INS) levels. Lipidomics change trend analysis of 1671 lipid components across 42 categories revealed that the level of glycerophospholipids (GPs) decreased while glycerolipids (GLs) and fatty acids (FAs) increased in the liver. The expression levels of eight key genes involved in the conversion of GP to GL pathways in the liver were enhanced in the propolis group. Molecular docking results elucidated the high binding affinities between the eight components of propolis and eight receptors involved in lipid metabolism, indicating that primary compounds of propolis possess potent capabilities for phospholipid remodeling and lipolysis. These results imply that propolis could facilitate the browning of the liver adipose tissue, promote the conversion of GPs to DGs and FFAs, enhance the consumption of FFAs through thermogenic pathways, and thereby exert lipolytic and hepatoprotective functions.

Body weight control via protein kinase CK2: diet-induced obesity counteracted by pharmacological targeting

BackgroundProtein kinase CK2 is a highly conserved enzyme implicated in the pathogenesis of various human illnesses including obesity. Despite compelling evidence for the involvement of this kinase in the pathophysiology of obesity, the molecular mechanisms by which CK2 might regulate fat metabolism are still poorly understood. Methods and resultsIn this study, we aimed to elucidate the role of CK2 on lipid metabolism by employing both in vitro and in vivo approaches using mouse pre-adipocytes and a mouse model of diet-induced obesity. We show that pharmacological inhibition of CK2 by CX-4945 results in premature upregulation of p27KIP1 preventing the progression of cells into mature adipocytes by arresting their development at the intermediate phase of adipogenic differentiation. Consistent with this, we show that in vivo, CK2 regulates the expression levels and ERK-mediated phosphorylation of C/EBPβ, which is one of the earliest transcription factors responsive to adipogenic stimuli. Furthermore, we demonstrate the functional implication of CK2 in the expression of late markers of adipogenesis and factors regulating lipogenesis in liver and white adipose tissue. Finally, we show that while mice subjected to high-fat diet increased their body weight, those additionally treated with CX-4945 gained considerably less weight. NMR-based body composition analysis revealed that this is linked to significant differences in body fat mass. ConclusionsTaken together, our study provides novel insights into the role of CK2 in fat metabolism in response to chronic lipid overload and confirms CK2 pharmacological targeting as a potentially powerful strategy for body weight control and/or the treatment of obesity and related metabolic disorders.

Sex dimorphism and tissue specificity of gene expression changes in aging mice

BackgroundAging is a complex process that involves all tissues in an organism and shows sex dimorphism. While transcriptional changes in aging have been well characterized, the majority of studies have focused on a single sex and sex differences in gene expression in aging are poorly understood. In this study, we explore sex dimorphism in gene expression in aging mice across three tissues.MethodsWe collected gastrocnemius muscle, liver and white adipose tissue from young (6 months, n = 14) and old (24 months, n = 14) female and male C57BL/6NIA mice and performed RNA-seq. To investigate sex dimorphism in aging, we considered two levels of comparisons: (a) differentially expressed genes between females and males in the old age group and (b) comparisons between females and males across the aging process. We utilized differential expression analysis and gene feature selection to investigate candidate genes. Gene set enrichment analysis was performed to identify candidate molecular pathways. Furthermore, we performed a co-expression network analysis and chose the gene module(s) associated with aging independent of sex or tissue-type.ResultsWe identified both tissue-specific and tissue-independent genes associated with sex dimorphism in aged mice. Unique differentially expressed genes between old males and females across tissues were mainly enriched for pathways related to specific tissue function. We found similar results when exploring sex differences in the aging process, with the exception that in the liver genes enriched for lipid metabolism and digestive system were identified in both females and males. Combining enriched pathways across analyses, we identified amino acid metabolism, digestive system, and lipid metabolism as the core mechanisms of sex dimorphism in aging. Although the vast majority of age-related genes were sex and tissue specific, we identified 127 hub genes contributing to aging independent of sex and tissue that were enriched for the immune system and signal transduction.ConclusionsThere are clear sex differences in gene expression in aging across liver, muscle and white adipose. Core pathways, including amino acid metabolism, digestive system and lipid metabolism, contribute to sex differences in aging.

Sympathetic innervation of interscapular brown adipose tissue is not a predominant mediator of OT-elicited reductions of body weight gain and adiposity in male diet-induced obese rats.

Recent studies indicate that central administration of oxytocin (OT) reduces body weight (BW) in high fat diet-induced obese (DIO) rodents by reducing energy intake and increasing energy expenditure (EE). Previous studies in our lab have shown that administration of OT into the fourth ventricle (4V; hindbrain) elicits weight loss and stimulates interscapular brown adipose tissue temperature (TIBAT) in DIO rats. We hypothesized that OT-elicited stimulation of sympathetic nervous system (SNS) activation of IBAT contributes to its ability to activate BAT and reduce BW in DIO rats. To test this, we determined the effect of disrupting SNS activation of IBAT on OT-elicited stimulation of TIBAT and reduction of BW in DIO rats. We first confirmed that bilateral surgical SNS denervation to IBAT was successful based on having achieved ≥ 60% reduction in IBAT norepinephrine (NE) content from DIO rats. NE content was selectively reduced in IBAT by 94.7 ± 2.7, 96.8 ± 1.8 and 85.9 ± 6.1% (P<0.05) at 1, 6 and 7-weeks post-denervation, respectively, and was unchanged in liver or inguinal white adipose tissue. We then measured the impact of bilateral surgical SNS denervation to IBAT on the ability of acute 4V OT (1, 5 μg) to stimulate TIBAT in DIO rats. We found that the high dose of 4V OT (5 μg) stimulated TIBAT similarly between sham and denervated rats (P=NS) and that the effects of 4V OT to stimulate TIBAT did not require beta-3 adrenergic receptor signaling. We subsequently measured the effect of bilateral surgical denervation of IBAT on the effect of chronic 4V OT (16 nmol/day) or vehicle infusion to reduce BW, adiposity, and energy intake in DIO rats. Chronic 4V OT reduced BW gain by -7.2 ± 9.6 g and -14.1 ± 8.8 g in sham and denervated rats (P<0.05 vs vehicle treatment), respectively, and this effect was similar between groups (P=NS). These effects were associated with reductions in adiposity and energy intake (P<0.05). Collectively, these findings support the hypothesis that sympathetic innervation of IBAT is not required for central OT to increase BAT thermogenesis and reduce BW gain and adiposity in male DIO rats.

Structural characterization of red yeast rice-derived polysaccharide and its promotion of lipid metabolism and gut function in high-fat diet-induced mice

This study explored the structure and biological activities of a novel polysaccharide, PRY1–1, isolated from red yeast rice (RYR) through solid-state fermentation and biotransformation by Monascus purpureus. The structure of PRY1–1 was characterized by Fourier-transform infrared (FTIR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy, and other analytical techniques, revealing distinct differences from previously identified mycelial and extracellular polysaccharides. Functional assessments were performed on high-fat diet (HFD)-induced mice to evaluate the impact of PRY1–1 on lipid metabolism and gut function. The results demonstrated that PRY1–1 effectively ameliorated HFD-induced lipid metabolism disorders in the liver and epididymal white adipose tissue (eWAT) by regulating the levels of total cholesterol (TC), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), leptin, adiponectin. Additionally, PRY1–1 protected gut function by enhancing gut barrier integrity, modulating gut microbiota composition, and regulating gut metabolite levels. This study offers new insights into the mechanisms by which RYR polysaccharides influence lipid metabolism, highlighting the potential of PRY1–1 as a functional component with significant health benefits.