Lipoic Acid Synthesis Research Articles

Mis-targeting of the mitochondrial protein LIPT2 leads to apoptotic cell death.

Lipoyl(Octanoyl) Transferase 2 (LIPT2) is a protein involved in the post-translational modification of key energy metabolism enzymes in humans. Defects of lipoic acid synthesis and transfer start to emerge as causes of fatal or severe early-onset disease. We show that the first 31 amino acids of the N-terminus of LIPT2 represent a mitochondrial targeting sequence and inhibition of the transit of LIPT2 to the mitochondrion results in apoptotic cell death associated with activation of the apoptotic volume decrease (AVD) current in normotonic conditions, as well as over-activation of the swelling-activated chloride current (IClswell), mitochondrial membrane potential collapse, caspase-3 cleavage and nuclear DNA fragmentation. The findings presented here may help elucidate the molecular mechanisms underlying derangements of lipoic acid biosynthesis.

Mitochondrial Protein Lipoylation and the 2-Oxoglutarate Dehydrogenase Complex Controls HIF1α Stability in Aerobic Conditions

SummaryHypoxia-inducible transcription factors (HIFs) control adaptation to low oxygen environments by activating genes involved in metabolism, angiogenesis, and redox homeostasis. The finding that HIFs are also regulated by small molecule metabolites highlights the need to understand the complexity of their cellular regulation. Here we use a forward genetic screen in near-haploid human cells to identify genes that stabilize HIFs under aerobic conditions. We identify two mitochondrial genes, oxoglutarate dehydrogenase (OGDH) and lipoic acid synthase (LIAS), which when mutated stabilize HIF1α in a non-hydroxylated form. Disruption of OGDH complex activity in OGDH or LIAS mutants promotes L-2-hydroxyglutarate formation, which inhibits the activity of the HIFα prolyl hydroxylases (PHDs) and TET 2-oxoglutarate dependent dioxygenases. We also find that PHD activity is decreased in patients with homozygous germline mutations in lipoic acid synthesis, leading to HIF1 activation. Thus, mutations affecting OGDHC activity may have broad implications for epigenetic regulation and tumorigenesis.

Staphylococcus aureus SufT: an essential iron-sulphur cluster assembly factor in cells experiencing a high-demand for lipoic acid.

Staphylococcus aureus SufT is composed solely of the domain of unknown function 59 (DUF59) and has a role in the maturation of iron-sulphur (Fe-S) proteins. We report that SufT is essential for S. aureus when growth is heavily reliant upon lipoamide-utilizing enzymes, but dispensable when this reliance is decreased. LipA requires Fe-S clusters for lipoic acid (LA) synthesis and a ΔsufT strain had phenotypes suggestive of decreased LA production and decreased activities of lipoamide-requiring enzymes. Fermentative growth, a null clpC allele, or decreased flux through the TCA cycle diminished the demand for LA and rendered SufT non-essential. Abundance of the Fe-S cluster carrier Nfu was increased in a ΔclpC strain and a null clpC allele was unable to suppress the LA requirement of a ΔsufT Δnfu strain. Over-expression of nfu suppressed the LA requirement of the ΔsufT strain. We propose a model wherein SufT, and by extension the DUF59, is essential for the maturation of holo-LipA in S. aureus cells experiencing a high demand for lipoamide-dependent enzymes. The findings presented suggest that the demand for products of Fe-S enzymes is a factor governing the usage of one Fe-S cluster assembly factor over another in the maturation of apo-proteins.

Differential diagnosis of lipoic acid synthesis defects.

Lipoic acid (LA) is an essential cofactor required for the activity of five multienzymatic complexes that play a central role in the mitochondrial energy metabolism: four 2-oxoacid dehydrogenase complexes [pyruvate dehydrogenase (PDH), branched-chain ketoacid dehydrogenase (BCKDH), 2-ketoglutarate dehydrogenase (2-KGDH), and 2-oxoadipate dehydrogenase (2-OADH)] and the glycine cleavage system (GCS). LA is synthesized in a complex multistep process that requires appropriate function of the mitochondrial fatty acid synthesis (mtFASII) and the biogenesis of iron-sulphur (Fe-S) clusters. Defects in the biosynthesis of LA have been reported to be associated with multiple and severe defects of the mitochondrial energy metabolism. In recent years, disease-causing mutations in genes encoding for proteins involved in LA metabolism have been reported: NFU1, BOLA3, IBA57, LIAS, GLRX5, LIPT1, ISCA2, and LIPT2. These studies represented important progress in understanding the pathophysiology and molecular bases underlying these disorders. Here we review current knowledge regarding involvement of LA synthesis defects in human diseases with special emphasis on the diagnostic strategies for these disorders. The clinical and biochemical characteristics of patients with LA synthesis defects are discussed and a workup for the differential diagnosis proposed.

A leaky splicing mutation in NFU1 is associated with a particular biochemical phenotype. Consequences for the diagnosis

Mutations in NFU1 were recently identified in patients with fatal encephalopathy. NFU1 is an iron–sulfur cluster protein necessary for the activity of the mitochondrial respiratory chain complexes I–II and the synthesis of lipoic acid. We report two NFU1 compound heterozygous individuals with normal complex I and lipoic acid-dependent enzymatic activities and low, but detectable, levels of lipoylated proteins. We demonstrated a leaky splicing regulation due to a splice site mutation (c.545+5G>A) that produces small amounts of wild type NFU1 mRNA that might result in enough protein to partially lipoylate and restore the activity of lipoic acid-dependent enzymes and the assembly and activity of complex I. These results allowed us to gain insights into the molecular basis underlying this disease and should be considered for the diagnosis of NFU1 patients.

Total synthesis of (R)-lipoic acid and (S)-lipoic acid via an Mn (III)-salen-catalyzed oxidative kinetic resolution

The asymmetric synthesis of both the antipodes of α-lipoic acid is described. The total synthesis of racemic and asymmetric lipoic acid is achieved from propane 1,3-diol. This work reports the use of Mn (III)-salen-catalyzed oxidative kinetic resolution as the key step to obtain enantiomerically pure (R)- and (S)-lipoic acid. The undesired product formed during the resolution can be recycled to achieve the desired isomer.

A new regulatory mechanism for bacterial lipoic acid synthesis

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic Acid (C75), an Inhibitor of Fatty-acid Synthase, Suppresses the Mitochondrial Fatty Acid Synthesis Pathway and Impairs Mitochondrial Function

4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment.

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression.

Mutations in human lipoyltransferase gene LIPT1cause a Leigh disease with secondary deficiency for pyruvate and alpha-ketoglutarate dehydrogenase

BackgroundSynthesis and apoenzyme attachment of lipoic acid have emerged as a new complex metabolic pathway. Mutations in several genes involved in the lipoic acid de novo pathway have recently been described (i.e., LIAS, NFU1, BOLA3, IBA57), but no mutation was found so far in genes involved in the specific process of attachment of lipoic acid to apoenzymes pyruvate dehydrogenase (PDHc), α-ketoglutarate dehydrogenase (α-KGDHc) and branched chain α-keto acid dehydrogenase (BCKDHc) complexes.MethodsExome capture was performed in a boy who developed Leigh disease following a gastroenteritis and had combined PDH and α-KGDH deficiency with a unique amino acid profile that partly ressembled E3 subunit (dihydrolipoamide dehydrogenase / DLD) deficiency. Functional studies on patient fibroblasts were performed. Lipoic acid administration was tested on the LIPT1 ortholog lip3 deletion strain yeast and on patient fibroblasts.ResultsExome sequencing identified two heterozygous mutations (c.875C > G and c.535A > G) in the LIPT1 gene that encodes a mitochondrial lipoyltransferase which is thought to catalyze the attachment of lipoic acid on PDHc, α-KGDHc, and BCKDHc. Anti-lipoic acid antibodies revealed absent expression of PDH E2, BCKDH E2 and α-KGDH E2 subunits. Accordingly, the production of 14CO2 by patient fibroblasts after incubation with 14Cglucose, 14Cbutyrate or 14C3OHbutyrate was very low compared to controls. cDNA transfection experiments on patient fibroblasts rescued PDH and α-KGDH activities and normalized the levels of pyruvate and 3OHbutyrate in cell supernatants. The yeast lip3 deletion strain showed improved growth on ethanol medium after lipoic acid supplementation and incubation of the patient fibroblasts with lipoic acid decreased lactate level in cell supernatants.ConclusionWe report here a putative case of impaired free or H protein-derived lipoic acid attachment due to LIPT1 mutations as a cause of PDH and α-KGDH deficiencies. Our study calls for renewed efforts to understand the mechanisms of pathology of lipoic acid-related defects and their heterogeneous biochemical expression, in order to devise efficient diagnostic procedures and possible therapies.

Synthesis of lipoic acid–peptide conjugates and their effect on collagen and melanogenesis

We report new examples of lipoic acid (LA)–peptide conjugates, their potential as codrugs having anti-melanogenic and anti-aging properties was evaluated. These multifunctional molecules were prepared by linking lipophilic moiety (LA) to the pentapeptide KTTKS. The inhibitory effect of LA–peptide conjugates on melanin synthesis and tyrosinase activity is stronger than that of LA or the pentapeptide alone. Importantly, the conjugates display no cytotoxicity at a high concentration. LA–KTTKS and LA–PEG–KTTKS also inhibit UV-induced matrix metalloproteinase-1 expression up to 49.5% and 69.5% at 0.5 mM, respectively. LA–peptide conjugates stimulate collagen biosynthesis in fibroblasts more efficiently than their parent molecules do. These data suggest that LA–peptide conjugates may have cosmeceutical application as anti-melanogenic and anti-aging agents.

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis

The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis.

A key role for lipoic acid synthesis duringPlasmodiumliver stage development

The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepaticparasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analogue 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines.

Mitochondrial lipoic acid scavenging is essential for Plasmodium berghei liver stage development

Lipoic acid is an essential cofactor for enzymes that participate in key metabolic pathways in most organisms. While in mammalian cells lipoylated proteins reside exclusively in the mitochondria, apicomplexan parasites of the genus Plasmodium harbour two independent lipoylation pathways in the mitochondrion and the apicoplast, a second organelle of endosymbiotic origin. Protein lipoylation in the apicoplast relies on de novo lipoic acid synthesis while lipoylation of proteins in the mitochondrion depends on scavenging of lipoic acid from the host cell. Here, we analyse the impact of lipoic acid scavenging on the development of Plasmodium berghei liver stage parasites. Treatment of P. berghei-infected HepG2 cells with the lipoic acid analogue 8-bromo-octanoic acid (8-BOA) abolished lipoylation of mitochondrial enzyme complexes in the parasite while lipoylation of apicoplast proteins was not affected. Parasite growth as well as the ability of the parasites to successfully complete liver stage development by merosome formation were severely impaired but not completely blocked by 8-BOA. Liver stage parasites were most sensitive to 8-BOA treatment during schizogony, the phase of development when the parasite grows and undergoes extensive nuclear division to form a multinucleated syncytium. Live cell imaging as well as immunofluorescence analysis and electronmicroscopy studies revealed a close association of both host cell and parasite mitochondria with the parasitophorous vacuole membrane suggesting that host cell mitochondria might be involved in lipoic acid uptake by the parasite from the host cell.

A novel amidotransferase required for lipoic acid cofactor assembly in Bacillus subtilis

In the companion paper we reported that Bacillus subtilis requires three proteins for lipoic acid metabolism, all of which are members of the lipoate protein ligase family. Two of the proteins, LipM and LplJ, have been shown to be an octanoyltransferase and a lipoate : protein ligase respectively. The third protein, LipL, is essential for lipoic acid synthesis, but had no detectable octanoyltransferase or ligase activity either in vitro or in vivo. We report that LipM specifically modifies the glycine cleavage system protein, GcvH, and therefore another mechanism must exist for modification of other lipoic acid requiring enzymes (e.g. pyruvate dehydrogenase). We show that this function is provided by LipL, which catalyses the amidotransfer (transamidation) of the octanoyl moiety from octanoyl-GcvH to the E2 subunit of pyruvate dehydrogenase. LipL activity was demonstrated in vitro with purified components and proceeds via a thioester-linked acyl-enzyme intermediate. As predicted, ΔgcvH strains are lipoate auxotrophs. LipL represents a new enzyme activity. It is a GcvH:[lipoyl domain] amidotransferase that probably uses a Cys-Lys catalytic dyad. Although the active site cysteine residues of LipL and LipB are located in different positions within the polypeptide chains, alignment of their structures show these residues occupy similar positions. Thus, these two homologous enzymes have convergent architectures.

Lipoic Acid Synthesis: A New Family of Octanoyltransferases Generally Annotated as Lipoate Protein Ligases

Bacillus subtilis lacks a recognizable homologue of the LipB octanoyltransferase, an enzyme essential for lipoic acid synthesis in Escherichia coli. LipB transfers the octanoyl moiety from octanoyl-acyl carrier protein to the lipoyl domains of the 2-oxoacid dehydrogenases via a thioester-linked octanoyl-LipB intermediate. The octanoylated dehydrogenase is then converted to the enzymatically active lipoylated species by insertion of two sulfur atoms into the octanoyl moiety by the S-adenosyl-l-methionine radical enzyme, LipA (lipoate synthase). B. subtilis synthesizes lipoic acid and contains a LipA homologue that is fully functional in E. coli. Therefore, the lack of a LipB homologue presented the puzzle of how B. subtilis synthesizes the LipA substrate. We report that B. subtilis encodes an octanoyltransferase that has virtually no sequence resemblance to E. coli LipB but instead has a sequence that resembles that of the E. coli lipoate ligase, LplA. On the basis of this resemblance, these genes have generally been annotated as encoding a lipoate ligase, an enzyme that in E. coli scavenges lipoic acid from the environment but plays no role in de novo synthesis. We have named the B. subtilis octanoyltransferase LipM and find that, like LipB, the LipM reaction proceeds through a thioester-linked acyl enzyme intermediate. The LipM active site nucleophile was identified as C150 by the finding that this thiol becomes modified when LipM is expressed in E. coli. The level of the octanoyl-LipM intermediate can be significantly decreased by blocking fatty acid synthesis during LipM expression, and C150 was confirmed as an essential active site residue by site-directed mutagenesis. LipM homologues seem the sole type of octanoyltransferase present in the firmicutes and are also present in the cyanobacteria. LipM type octanoyltransferases represent a new clade of the PF03099 protein family, suggesting that octanoyl transfer activity has evolved at least twice within this superfamily.

Development of head organizer of the mouse embryo depends on a high level of mitochondrial metabolism

Mouse genetic studies have defined a set of signaling molecules and transcription factors that are necessary to induce the forebrain. Here we describe an ENU-induced mouse mutation, nearly headless (nehe), that was identified based on the specific absence of most of the forebrain at midgestation. Positional cloning and genetic analysis show that, unlike other mouse mutants that disrupt specification of the forebrain, the nehe mutation disrupts mitochondrial metabolism. nehe is a hypomorphic allele of Lipoic acid Synthetase (Lias), the enzyme that catalyzes the synthesis of lipoic acid, an essential cofactor for several mitochondrial multienzyme complexes required for oxidative metabolism. The defect in forebrain development in nehe mutants is apparent as soon as the forebrain is specified, without a concomitant increase in apoptosis. Two tissues required for forebrain specification, the anterior visceral endoderm and the anterior definitive endoderm, develop normally in nehe mutants. However, a third head organizer tissue, the prechordal plate, fails to express markers of cell type determination and shows abnormal morphology in the mutants. We find that the level of phosphorylated (active) AMPK, a cellular energy sensor that affects cell polarity, is up-regulated in nehe mutants at the time when the prechordal plate is normally specified. The results suggest that the nehe phenotype arises because high levels of energy production are required for the specialized morphogenetic movements that generate the prechordal plate, which is required for normal development of the mammalian forebrain. We suggest that a requirement for high levels of ATP for early forebrain patterning may contribute to certain human microcephaly syndromes.

Opening a New Path to Lipoic Acid

Lipoic acid (Fig. 1) is a cofactor that is critical to the catalytic function of several key enzymes in intermediary metabolism that are found in all domains of life. There are two pathways to lipoyl-modified proteins. The de novo pathway from octanoylacyl carrier protein (ACP) involves the consecutive action of LipB and LipA (Fig. 2A), and the LplA-dependent salvage pathway activates and transfers environmental lipoic acid to the lipoyl protein domains (Fig. 2B). In this issue, Hermes and Cronan (6) identify gain-of-function mutations in LplA that allow cells to bypass the requirement for LipB in de novo lipoic acid formation (Fig. 2C). Normally, lipB null strains require either a lipoate or an octanoate supplement for growth, but these lplA mutants have increased affinities for octanoic acid, permitting them to utilize the low concentrations of intracellular octanoate, thus substituting for the LipB reaction. The characterization of these suppressor strains provides new information on the biochemistry of lipoate metabolism and reveals the existence of intracellular pools of medium-chain fatty acids that previously were not thought to exist. Functions of lipoic acid. Lipoic acid is essential for the functions of several enzymes in oxidative metabolism (2). A good example is pyruvate dehydrogenase (PDH), where covalently bound lipoate shuttles reaction intermediates between the active sites of a multisubunit complex (11). Lipoic acid is bound to the dihydrolipoyl transacetylase (E2) subunit in its oxidized state as a five-membered, disulfide-linked ring (Fig. 1). The E1 subunit of PDH decarboxylates pyruvate, forming 2-hydroxyethyl-2-thiamine pyrophosphate, and the lipoic acid disulfide is reduced when E2 accepts an acetaldehyde moiety from the thiamine adduct. Acetyl-coenzyme A is then released via a thioester exchange reaction with coenzyme A. The disulfide ring of lipoate is reformed by the FAD-dependent dihydrolipoyl dehydrogenase component (E3). Other important bacterial lipoyl enzymes include the glycine cleavage system, -ketoglutarate dehydrogenase, and the branched-chain ketoacid dehydrogenase that is involved in supplying branched-chain precursors for fatty acid synthesis. In Escherichia coli, strains defective in lipoic acid synthesis are unable to grow aerobically on glucose minimal medium unless it is supplemented with acetate and succinate to bypass the requirement for PDH and -ketoglutarate dehydrogenase (5, 13). Bypassing LipB. The de novo biosynthetic pathway in E. coli requires lipA and lipB (Fig. 2A). Genetic studies identified the product of the lipA gene as responsible for inserting the two sulfur atoms into the octanoate precursor (13). LipA is an S-adenosylmethionine-dependent enzyme that inserts sulfur at

Scavenging of Cytosolic Octanoic Acid by Mutant LplA Lipoate Ligases Allows Growth of Escherichia coli Strains Lacking the LipB Octanoyltransferase of Lipoic Acid Synthesis

The LipB octanoyltransferase catalyzes the first step of lipoic acid synthesis in Escherichia coli, transfer of the octanoyl moiety from octanoyl-acyl carrier protein to the lipoyl domains of the E2 subunits of the 2-oxoacid dehydrogenases of aerobic metabolism. Strains containing null mutations in lipB are auxotrophic for either lipoic acid or octanoic acid. We report the isolation of two spontaneously arising mutant strains that allow growth of lipB strains on glucose minimal medium; we determined that suppression was caused by single missense mutations within the coding sequence of the gene (lplA) that encodes lipoate-protein ligase. The LplA proteins encoded by the mutant genes have reduced K(m) values for free octanoic acid and thus are able to scavenge cytosolic octanoic acid for octanoylation of lipoyl domains.

Lipoic Acid Synthesis and Attachment in Yeast Mitochondria

Lipoic acid is a sulfur-containing cofactor required for the function of several multienzyme complexes involved in the oxidative decarboxylation of alpha-keto acids and glycine. Mechanistic details of lipoic acid metabolism are unclear in eukaryotes, despite two well defined pathways for synthesis and covalent attachment of lipoic acid in prokaryotes. We report here the involvement of four genes in the synthesis and attachment of lipoic acid in Saccharomyces cerevisiae. LIP2 and LIP5 are required for lipoylation of all three mitochondrial target proteins: Lat1 and Kgd2, the respective E2 subunits of pyruvate dehydrogenase and alpha-ketoglutarate dehydrogenase, and Gcv3, the H protein of the glycine cleavage enzyme. LIP3, which encodes a lipoate-protein ligase homolog, is necessary for lipoylation of Lat1 and Kgd2, and the enzymatic activity of Lip3 is essential for this function. Finally, GCV3, encoding the H protein target of lipoylation, is itself absolutely required for lipoylation of Lat1 and Kgd2. We show that lipoylated Gcv3, and not glycine cleavage activity per se, is responsible for this function. Demonstration that a target of lipoylation is required for lipoylation is a novel result. Through analysis of the role of these genes in protein lipoylation, we conclude that only one pathway for de novo synthesis and attachment of lipoic acid exists in yeast. We propose a model for protein lipoylation in which Lip2, Lip3, Lip5, and Gcv3 function in a complex, which may be regulated by the availability of acetyl-CoA, and which in turn may regulate mitochondrial gene expression.