Linear Minichromosomes Research Articles

Resolution of poxvirus telomeres: processing of vaccinia virus concatemer junctions by conservative strand exchange

The replication of vaccinia virus proceeds through concatemeric intermediates which are resolved into unit-length DNA. In vaccinia virus-infected cells, plasmids containing the vaccinia virus DNA junction fragment that connects concatemers are resolved into linear minichromosomes of vector DNA flanked by hairpin loops. Resolution requires two copies of a specific nucleotide sequence conserved among poxviruses and found proximal to the hairpin loop. This study demonstrates that orientation of each sequence with respect to the other as well as to the axis of symmetry is critical for resolution, the processing of plasmids containing heterologous pairs of resolution sites is influenced by mismatched nucleotides between the sites, and the vaccinia virus hairpin in the linear minichromosome is a heteroduplex composed of DNA from each strand of the concatemer junction. A model incorporating site-specific recombination and orientated branch migration is proposed to account for resolution of the vaccinia virus concatemer junction.

Introduction of large linear minichromosomes into Schizosaccharomyces pombe by an improved transformation procedure.

The efficiency of transformation of Schizosaccharomyces pombe has been increased 10- to 50-fold over previously reported methods. By using 1 microgram of plasmid, 7.0 x 10(5) transformants are regularly obtained. This increased transformation efficiency is mainly due to the inclusion of the cationic liposome-forming reagent Lipofectin in the protocol. Various parameters affecting transformation of Sc. pombe in the presence of Lipofectin have been examined. Lipofectin can also be used to increase transformation efficiency in Saccharomyces cerevisiae. It is also demonstrated that by using this improved transformation procedure, linear minichromosomes of greater than 500 kilobases can be introduced into Sc. pombe with relative ease. These minichromosomes can replicate as stable linear molecules upon reintroduction into Sc. pombe, demonstrating that Sc. pombe telomeres retain function when reintroduced as naked DNA. The ability of Sc. pombe to admit large DNA molecules indicates that it should be feasible to clone large DNA from other organisms in Sc. pombe.

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

Characterization of Schizosaccharomyces pombe minichromosome deletion derivatives and a functional allocation of their centromere.

A 530 kb long Schizosaccharomyces pombe linear minichromosome, Ch16, containing a centric region of chromosome III, has previously been made. In the present study, we constructed a number of deletions in the right and/or left arms of Ch16, and compared their structure and behaviour with Ch16. The functional centromere, cen3, is allocated within a 120 kb long region which is covered by the shortest derivative, Ch10, and is comprised mostly of centromeric repeating sequences. The shortest minichromosome is stable in mitosis and the copy number control is apparently precise. In monosomic meiosis it segregates normally. In disomic meioses, however, the frequency of non-disjunction is very high, suggesting that it may not form a pair. The mitotic loss rate of one of the left-arm deletions, ChR32, which lacks a part of the centromeric repeating sequence, is the highest of all the deletions. This deletion also exhibits the highest precocious sister chromatid separation in meiosis I, suggesting that sister chromatid association might become weakened in ChR32. Our results indicate that the proper meiotic segregation of S.pombe minichromosomes is dependent upon the formation of a bivalent. S.pombe may not have the 'distributive segregation' found with Saccharomyces cerevisiae minichromosomes.

Molecular cloning of human telomeres in yeast

Telomeres are the DNA sequences found at the ends of linear chromosomes. They define the boundaries of the genetical and physical maps of such chromosomes and so are particularly important for the complete mapping of large genomes that is now being attempted. Telomeres have been intensively studied in the yeast Saccharomyces cerevisiae and in ciliated protozoa: in these organisms the telomeric DNA consists of arrays of tandemly repeated short sequences in which one strand is guanosine-rich and oriented 5' to 3' towards the chromosome end. The conservation of these structural features is reflected in the observation that telomeric DNA from a variety of protozoa will function as telomeres on artificial linear mini-chromosomes in yeast. Tandem arrays of the sequence TTAGGG have been identified at the telomeres of humans and other mammals and also of trypanosomes. This indicates that the structural features of telomeres are conserved between higher and lower eukaryotes and implies that human telomeric DNA could function in yeast. I have used this idea to develop a strategy to isolate a specific human telomere as a molecular clone in yeast and have devised a simple and effective way of cloning other human telomeres and their associated sequences.

Identification of healed terminal DNA fragments in linear minichromosomes of Schizosaccharomyces pombe.

The minichromosome Ch16 of the fission yeast Schizosaccharomyces pombe is derived from the centromeric region of chromosome III. We show that Ch16 and a shorter derivative, Ch12, made by gamma-ray cleavage, are linear molecules of 530 and 280 kilobases, respectively. Each minichromosome has two novel telomeres, as shown by genomic Southern hybridization with an S. pombe telomere probe. Comparison by hybridization of the minichromosomes and their chromosomal counterparts showed no signs of gross rearrangement. Cosmid clones covering the ends of the long arms of Ch16 and Ch12 were isolated, and subcloned fragments that contained the breakage sites were identified. They are apparently unique in the genome. By hybridization and Bal 31 digestion, the ends appear to consist of the broken-end sequences directly associated with short stretches (about 300 base pairs) of new DNA that hybridizes to a cloned S. pombe telomere. They do not contain the telomere-adjacent repeated sequences that are present in the normal chromosomes. The sizes of the short telomeric stretches are roughly the same as those of the normal chromosomes. Our results show that broken chromosomal ends in S. pombe can be healed by the de novo addition of the short telomeric repeats. The formation of Ch16 must have required two breakage-healing events, whereas a single cleavage-healing event in the long arm of Ch16 yielded Ch12.

Identification of healed terminal DNA fragments in linear minichromosomes of Schizosaccharomyces pombe.

The minichromosome Ch16 of the fission yeast Schizosaccharomyces pombe is derived from the centromeric region of chromosome III. We show that Ch16 and a shorter derivative, Ch12, made by gamma-ray cleavage, are linear molecules of 530 and 280 kilobases, respectively. Each minichromosome has two novel telomeres, as shown by genomic Southern hybridization with an S. pombe telomere probe. Comparison by hybridization of the minichromosomes and their chromosomal counterparts showed no signs of gross rearrangement. Cosmid clones covering the ends of the long arms of Ch16 and Ch12 were isolated, and subcloned fragments that contained the breakage sites were identified. They are apparently unique in the genome. By hybridization and Bal 31 digestion, the ends appear to consist of the broken-end sequences directly associated with short stretches (about 300 base pairs) of new DNA that hybridizes to a cloned S. pombe telomere. They do not contain the telomere-adjacent repeated sequences that are present in the normal chromosomes. The sizes of the short telomeric stretches are roughly the same as those of the normal chromosomes. Our results show that broken chromosomal ends in S. pombe can be healed by the de novo addition of the short telomeric repeats. The formation of Ch16 must have required two breakage-healing events, whereas a single cleavage-healing event in the long arm of Ch16 yielded Ch12.

Efficient resolution of replicated poxvirus telomeres to native hairpin structures requires two inverted symmetrical copies of a core target DNA sequence

The terminal hairpin sequences of the linear double-stranded DNA genome of the leporipoxvirus Shope fibroma virus (SFV) has been cloned in Saccharomyces cerevisiae and in recombination-deficient Escherichia coli as a palindromic insert within circular plasmid vectors. This sequence configuration is equivalent to the inverted repeat structure detected as a telomeric replicative intermediate during poxvirus replication in vivo. Previously, it has been shown that when circular plasmids containing this palindromic insert were transfected into SFV-infected cells, efficient replication and resolution generated linear minichromosomes with bona fide viral hairpin termini (A. M. DeLange, M. Reddy, D. Scraba, C. Upton, and G. McFadden, J. Virol. 59:249-259, 1986). To localize the minimal target DNA sequence required for efficient resolution, a series of staggered unidirectional deletions were constructed at both ends of the inverted repeat. Analyses of the resolution efficiencies of the various clones indicate that up to 240 base pairs (bp) centered at the symmetry axis were required for maximal resolution to minichromosomes. To investigate the role of the AT-rich central axis sequences, which in SFV include 8 nonpalindromic bp, a unique AflII site at the symmetry axis was exploited. Bidirectional deletions extending from this AflII site and insertions of synthetic oligonucleotides into one of the deletion derivatives were constructed and tested in vivo. The efficiency with which these plasmids resolved to linear minichromosomes with hairpin termini has enabled us to define the minimal target DNA sequence as two inverted copies of an identical DNA sequence between 58 and 76 bp in length. The nonpalindromic nucleotides, which, after resolution, constitute the extrahelical residues characteristic of native poxviral telomeres, were not required for resolution. The close resemblance of the SFV core target sequence to the analogous region from the orthopoxvirus vaccinia virus is consistent with a conserved mechanism for poxviral telomere resolution.

Replication and resolution of cloned poxvirus telomeres in vivo generates linear minichromosomes with intact viral hairpin termini.

The covalently closed terminal hairpins of the linear duplex-DNA genomes of the orthopoxvirus vaccinia and the leporipoxvirus Shope fibroma virus (SFV) have been cloned as imperfect palindromes within circular plasmids in yeast cells and recombination-deficient Escherichia coli. The viral telomeres inserted within these recombinant plasmids are equivalent to the inverted-repeat structures detected as telomeric replicative intermediates during poxvirus replication in vivo. Although the telomeres of vaccinia and SFV show little sequence homology, the termini from both viral genomes exist as AT-rich terminal hairpins with extrahelical bases and alternate "flip-flop" configurations. Using an in vivo replication assay in which circular plasmid DNA was transfected into poxvirus-infected cells, we demonstrated the efficient replication and resolution of the cloned imperfect palindromes to bona fide hairpin termini. The resulting linear minichromosomes, which were readily purified from transfected cells, were shown by restriction enzyme mapping and by electron microscopy to have intact covalently closed hairpin termini at both ends. In addition, staggered unidirectional deletion derivatives of both the cloned vaccinia and SFV telomeric palindromes localized an approximately 200-base-pair DNA region in which the sequence organization was highly conserved and which was necessary for the resolution event. These data suggest a conserved mechanism of the resolution of poxvirus telomeres.

Resolution of linear minichromosomes with hairpin ends from circular plasmids containing vaccinia virus concatemer junctions

The junctions, separating unit-length genomes in intracellular concatemeric forms of vaccinia virus DNA, are duplex copies of the hairpin loops that form the ends of mature DNA molecules present in infectious virus particles. Circular E. coli plasmids with palindromic junction fragments were replicated in vaccinia virus-infected cells and resolved into linear minichromosomes with vector DNA in the center and vaccinia virus DNA hairpins at the two ends. Resolution did not occur when the concatemer joint was less than 250 bp or when plasmids were transfected into uninfected cells, indicating requirements for a specific DNA structure and viral trans-acting factors. These studies indicate that concatemers can serve as replicative intermediates and account for the generation of flip-flop sequence variation of the hairpins at the ends of the mature vaccinia virus genome.

Size threshold for Saccharomyces cerevisiae chromosomes: generation of telocentric chromosomes from an unstable minichromosome.

A 9-kilobase pair CEN4 linear minichromosome constructed in vitro transformed Saccharomyces cerevisiae with high frequency but duplicated or segregated inefficiently in most cells. Stable transformants were only produced by events which fundamentally altered the structure of the minichromosome: elimination of telomeres, alteration of the centromere, or an increase of fivefold or greater in its size. Half of the stable transformants arose via homologous recombination between an intact chromosome IV and the CEN4 minichromosome. This event generated a new chromosome from each arm of chromosome IV. The other "arm" of each new chromosome was identical to one "arm" of the unstable minichromosome. Unlike natural yeast chromosomes, these new chromosomes were telocentric: their centromeres were either 3.9 or 5.4 kilobases from one end of the chromosome. The mitotic stability of the telocentric chromosome derived from the right arm of chromosome IV was determined by a visual assay and found to be comparable to that of natural yeast chromosomes. Both new chromosomes duplicated, paired, and segregated properly in meiosis. Moreover, their structure, as deduced from mobilities in orthogonal field gels, did not change with continued mitotic growth or after passage through meiosis, indicating that they did not give rise to isochromosomes or suffer large deletions or additions. Thus, in S. cerevisiae the close spacing of centromeres and telomeres on a DNA molecule of chromosomal size does not markedly alter the efficiency with which it is maintained. Taken together these data suggest that there is a size threshold below which stable propagation of linear chromosomes is no longer possible.

Size threshold for Saccharomyces cerevisiae chromosomes: generation of telocentric chromosomes from an unstable minichromosome.

A 9-kilobase pair CEN4 linear minichromosome constructed in vitro transformed Saccharomyces cerevisiae with high frequency but duplicated or segregated inefficiently in most cells. Stable transformants were only produced by events which fundamentally altered the structure of the minichromosome: elimination of telomeres, alteration of the centromere, or an increase of fivefold or greater in its size. Half of the stable transformants arose via homologous recombination between an intact chromosome IV and the CEN4 minichromosome. This event generated a new chromosome from each arm of chromosome IV. The other "arm" of each new chromosome was identical to one "arm" of the unstable minichromosome. Unlike natural yeast chromosomes, these new chromosomes were telocentric: their centromeres were either 3.9 or 5.4 kilobases from one end of the chromosome. The mitotic stability of the telocentric chromosome derived from the right arm of chromosome IV was determined by a visual assay and found to be comparable to that of natural yeast chromosomes. Both new chromosomes duplicated, paired, and segregated properly in meiosis. Moreover, their structure, as deduced from mobilities in orthogonal field gels, did not change with continued mitotic growth or after passage through meiosis, indicating that they did not give rise to isochromosomes or suffer large deletions or additions. Thus, in S. cerevisiae the close spacing of centromeres and telomeres on a DNA molecule of chromosomal size does not markedly alter the efficiency with which it is maintained. Taken together these data suggest that there is a size threshold below which stable propagation of linear chromosomes is no longer possible.

Replication of adenovirus mini-chromosomes

We have isolated adenovirus origins of DNA replication from both the right and left ends of the genome, which are functional on linear autonomously replicating mini-chromosomes. The mini-chromosomes contain two cloned inverted adenovirus termini and require non-defective adenovirus as a helper. Replicated molecules are covalently attached to protein, and DNA synthesis is initiated at the correct nucleotide even when the origins are not located at molecular ends. The activity of embedded origins leads to the generation of linear minichromosomes from circular or linear molecules. These observations therefore suggest that sequences within the adenovirus origin of replication position the protein priming event at the adenovirus terminus. Experiments investigating the regeneration of deleted viral inverted terminal repeat sequences show a sequence-independent requirement for inverted sequences in this process. This result strongly suggests that repair results from the formation of a panhandle structure by a displaced single strand. On the basis of these observations we propose a model for the generation of adenovirus mini-chromosomes from larger molecules.