Light Brown Research Articles

Correlation of UV Fluorescence Images With Performance Loss of Field-Retrieved Photovoltaic Modules

The ultraviolet fluorescence (UVF) imaging method has been widely used as a rapid and economic field inspection tool for investigating encapsulant discoloration of field-aged photovoltaic (PV) modules. In field-aged PV modules, encapsulant discoloration can result in a pronounced decrease in the short-circuit current. The spatial distribution of environmental stressors and therefore discoloration pattern over each cell of a module depends on the climate. In this article, we investigated the discoloration patterns (and their correlation with electrical parameters of modules and the extracted-cells from the modules) of ten modules produced at the same manufacturing facility and retrieved respectively from two distinct climates of Arizona (hot-dry; seven modules; 18 years of exposure) and Florida (hot-humid; three modules; ten years of exposure). In the Arizona modules, three distinct spatial patterns were observed in the UVF images: cell center region (intense browning); cell edge region (no browning); region between cell center; and cell edge region (light browning). However, in the Florida modules, only two distinct spatial distributions were observed: nonedge cell region (medium browning) and cell edge region (no browning). Furthermore, we employed a high-contrast UVF imaging technique to correlate the interdependence between the encapsulant discoloration pattern and the metallization/contact degradation pattern. For this correlative study, various experimental characterizations were carried out on both field-aged (Arizona and Florida) and unexposed modules and the cells extracted from the modules of the same model and they include: processed UVF and EL images, and I-V, TLM, optical microscopy, and XPS measurements.

Comparison of Histomorphometric Study of Chromaffin Cells in Adult Males Squirrel (Sciurusanomalus) and Hamster (Mesocricetusauratus)

The adrenal glands are endocrine glands that produce a diversity of hormones comprising of adrenaline, the aldosterone and cortisol. The present study aimed at investigation of the histomorphometric features of chromaffin cells. There were two types of chromaffin cells. In squirrel, the first type was columnar in shape and brownish in color contained spherical nucleus located at the base of cells, which represented the epinephrine secreting cells, and the second type was polygonal in shape and light brownish in color contained spherical nucleus located in the center of cells, which represented the norepinephrine secreting cells. The adrenal medulla of hamster consists almost entirely of columnar or polyhedral chromaffin cells forming clusters and anastomosing cords separated by sinusoids, giving a strong reaction with methylene eosin stain more than that seen in squirrel. The statistical analysis showed that the means diameter of epinephrine cells and norepinephrine cells in the right adrenal gland in squirrel were lesser than those of hamster significantly at P<0.05, but in the left adrenal gland in squirrel the means were greater than those of hamster significantly at P<0.05. In conclusion, the present findings showed the reaction of chromaffin cells of hamster with methylene –eosin stain to be stronger than with hematoxylin-eosin stain, while the opposite was true in case of the squirrel.

Two new species of Astrothelium (Trypetheliaceae) with amyloid ascospores inhabiting the canopy of Quercus humboldtii trees in Colombia

Subandine and high Andean forests are often dominated by oak trees and these are recognized as suitable phorophytes for diverse epiphyte communities. Among the latter, lichens in the upper strata appear to be understudied. Here, we report the discovery of two new species of Astrothelium (Trypetheliaceae), a diverse genus of tropical crustose lichens, both with the unusual feature of muriform, amyloid ascospores. Astrothelium mordonialensis is characterized by an olive-green thallus with solitary ascomata producing muriform and amyloid ascospores with tightened center and A. rogitamae by a light brownish to greenish grey thallus with yellow pigmented solitary ascomata, producing muriform and amyloid ascospores.

<p><strong><em>Leucoagaricus fragilis sp. nov.</em></strong><strong> (Agaricaceae) from Punjab, Pakistan</strong></p>

A novel species, Leucoagaricus fragilis, is described from the vicinity of the Cholistan desert, Punjab, Pakistan. The taxon is characterized by white, fragile basidiomata with a light brown, umbonate disk, a radially fibrillose pileus surface rarely splitting radially, pinkish brown lamellae at maturity, a white, bent stipe that stains yellowish upon handling, an inferior annulus, sub-globose to ellipsoid basidiospores, broadly clavate to abundantly sphaeropedunculate cheilocystidia, and cylindrical pileipellis hyphae intermixed with broader clavate elements with rounded ends. Morpho-anatomical and molecular phylogenetic analyses of nrITS and nrLSU datasets confirmed a new taxon in L. sect. Piloselli. A key to the known species of Leucoagaricus in Pakistan is also provided.

Evolution of UV/VIS Photoluminescence of Aged Zn(acac)2 Solutions in Correlation with Carbon Precipitation

Evolution of photoluminescence of ethanol solutions of Zn(acac) from near UV to VIS was monitored for time period of several months. It has been found that transparent solutions with time colored in light brown that is accompanied by development of strong visible photoluminescence. This phenomenon is analyzed and discussed in terms of carbon precipitation. It has been demonstrated that at short aging period the photoluminescence is observed as relatively narrow and excitation independent emission band centered at at about 400 nm. In course of aging period emission is converted from violet to blue and green with corresponding shift of excitation band from UV to VIS. Electron paramagnetic resonance spectroscopy allows to identify carbon precipitates in the solutions approving hypothesis on nanocarbon nature of the photoluminescence.

A chromo-fluorogenic HMT sensor for Ag+ and the resultant HMT-Ag complex turn-off probe for F− in DMSO: experimental and theoretical studies

The photophysical properties of Hexamethylenetetramine (HMT) were investigated through physical methods and spectroscopically in dimethyl sulfoxide (DMSO) at ambient temperature. Evidently, HMT turned out as a sensor, selective and sensitive to silver ion (Ag+) only, among other cations, through colorimetric and fluorometric activities (observable by naked eye) and spectrally, both by UV-Vis and fluorescence spectroscopy. The resulting complex pedant (HMT-Ag) is highly responsive to the presence of fluoride ion (F−) in aqueous soluble DMSO, evidenced by changes in absorption spectra as well as fluorescence quenching, upon addition of the respective ions. Consequently, spectral changes induced by the addition of these ions, were consistently concomitant with colour changes, from colourless to light brown (HMT-Ag) to dark brown (HMT-Ag-F) in daylight condition, while bright light blue colour (HMT) to dark blue brownish (HMT-Ag) under UV-light conditions. The experimental results were complimented by theoretical studies, which are well within agreement of one another.

EMBRYOGENESIS, LEUKOCYTIC PROFILE AND LIVER MORPHOLOGY OF PREGNANT RATES UNDER THE ACTION OF CITRIC ACID

The article presents the results of studies on the effects of citric acid on the female’s body. The studies were performed on white laboratory rats of the Wistar line, which at the age of 3 - 3.5 months with a body weight of 192 - 210 g were divided into two groups of 4 individuals in each. The animals of the experimental group were fed by citric acid at a concentration of 80 mg/l of drinking water during the period physiological and puberty, fertilization and pregnancy. A control group of female rats was fed by water. The animals had free access to drinkers and food. Indicators of embryogenesis, leukocyte profile of blood and body weight of animals, weighting factor, histological changes of the liver were determined.
 Female rats were found to have no abortions or premature births, however, the number of corpora lutea of pregnancy decreased by 19.2%, although there was no significant difference in control. The number of implantation sites per female was significantly lower by 28.8%. The mortality rate of embryos was 15.8%, which is 3.8 times higher than in intact animals. Regarding white blood cells, the analysis of the results indicates a tendency to increase the percentage of eosinophils in 2 times in the relation to the animals in the control group on the background of a probable increase in leukocytes by 42.4%.
 The applied dose of citric acid caused certain changes in the macro- and microstructure of the liver. It is macroscopically established that under the influence of citric acid the organ is slightly enlarged, sluggish consistency and changed its color from light red to light brown. The relative weighting factors of the liver are probably higher in the relation to the control (52.12 ± 8.16 g/kg vs 43.38 ± 1.96 g/ kg).
 The results of morphological studies indicate a partial violation of the lamellar structure of the organ in the centro-lobular region, which is due to turbid swelling of the cytoplasm of hepatocytes. In most cells, the contours are blurred, the cytoplasm is poorly stained, their nuclei are weakly basophilic, and hepatocytes with a lysed nucleus in a necrobiosis condition also occur. However, among dystrophic altered cells are clearly isolated hepatocytes with a uniformly colored basophilic cytoplasm, nucleus, rich in chromatin, which indicated the activation of reparative processes. Kupffer cells in this area are mostly round, located in the lumen of the sinusoid. Therefore, occurs a violation of lipoprotein complexes of cells and increase the permeability of cell membranes, which is reflected in the development of protein dystrophy with varying degrees of severity. Activation of reparative processes of hepatocytes is also determined.

First Report of Root Rot Caused by Bipolaris zeicola on Maize in Hebei Province.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Darker Skin Color Measured by Von Luschan Chromatic Scale and Increased Sunlight Exposure Time Are Independently Associated with Decreased Odds of Vitamin D Deficiency in Thai Ambulatory Patients.

Background Little is known about the association among skin color, sunlight exposure. and vitamin D status in Southeast Asian population. Objective To investigate the association between skin color measured by von Luschan chromatic scale (VLCS) and vitamin D status in Thai medical ambulatory patients. Methods Medical ambulatory patients were enrolled. The eligibility criteria were as follows: aged >18 years, stable medical conditions, and no conditions directly affecting vitamin D status. Serum 25-hydroxyvitamin D [25(OH)D] levels were assessed. Skin color at the outer forearm was assessed using VLCS which grades skin color from the lightest score of 1 to the darkest score of 36. Patients were systematically interviewed to estimate daily sunlight exposure time. Results A total of 334 patients were enrolled. Data were expressed as mean ± SD. The mean serum 25(OH)D was 25.21 ± 10.06 ng/mL. There were 17 (5.1%), 217 (65.0%), and 100 (29.9%) patients who had light brown (VLCS score 18–20), medium brown (VLCS score 21–24), and dark brown (VLCS score 25–27) skin colors, respectively. The mean serum 25(OH)D level was higher in patients with dark brown skin than in patients with medium brown and light brown skin (28.31 ± 10.34 vs. 24.28 ± 9.57 and 19.43 ± 9.92 ng/mL, respectively, both p < 0.05). Multivariate analysis showed that darker skin color and increased sunlight exposure time were independently associated with decreased odds of vitamin D deficiency (dark brown vs. light brown: odds ratio, 0.263, 95% CI: 0.081–0.851, p=0.026; medium brown vs. light brown: odds ratio, 0.369, 95% CI: 0.987–1.003, p=0.067; sunlight exposure time odds ratio per 1 minute/day increase 0.955, 95% CI: 0.991–1.000, p=0.037), after adjusting for possible confounders. Conclusions We found that darker skin color at sunlight exposure area and increased sunlight exposure time were independently associated with decreased odds of vitamin D deficiency in Thai medical ambulatory patients.

Effects of Plant Growth Regulators and Sugars on Ehretia asperula Zoll. et Mor. Cell Cultures

Background: Belonging to the Boraginacae family, Ehretia asperula Zoll. et Mor., called “Xa den”, is a precious medicinal plant also known as the “cancer tree” by the Muong ethnic group in Hoa Binh Province, Vietnam. Xa den has been demonstrated to inhibit the development of malignant tumors, reduce oxidation and enhance the human immune system. This research focused on examining friable callus induction from young stems of Ehretia asperula Zoll. et Mor. Methods: Samples of Xa den were less than two years old. Young stems with 2 to 6 leaves served as explants for callus induction. Explants placed on autoclaved B5 nutrients incubated at 25oC, in the dark. The testing factors were concentrations of 2,4-Dichlorophenoxyacetic acid (2,4-D) and Benzyl adenine (BA), types and concentrations of sugars.Result: Friable callus was induced on B5 medium with 0.4 mg/L of 2,4-D, 0.1 mg/L of BA and 30 g/L of glucose at the highest rate (100%). Additionally, callus grew best after 5 weeks of culture weighing 0.194 g. Friable callus was used as material for cell suspension cultures. After two weeks, the Xa den cell suspension cultures contained single cells and small cell clumps. The liquid medium had changed from dark yellow to light brown.

Genetic analysis of seed coat colour in adzuki bean (Vigna angularis L.)

AbstractSeed coat colour is an important quality trait, domestication trait and morphological marker, and is closely associated with flavonoid and anthocyanin metabolism pathways. The seed coat colour of adzuki bean, an important legume crop, influences the processing quality of its paste, the commodity and its nutritional quality. In this study, the genetic relationships of seed coat colour were analysed using 12 hybridized combinations of F2 individuals and four F3 families derived from hybridized combinations between the accessions of eight seed coat colours. The loci of the colour traits were analysed based on phenotypes and using the chi-square test. Ivory colour is recessive to red and is controlled by a single R locus. Black, black mottle on grey, black mottle on red, light brown, golden and brown are all dominant to red. The phenotypes of black mottle on red, light brown, golden and brown are all controlled by a single genetic locus. Black mottle on grey is controlled by two loci. Black is controlled with two loci, and the black locus shows dominant epistasis to another locus. A genetic model of these seed coat colours was predicted. Our results will be important for gene mapping and cloning of seed coat colour characters and for providing further insight into the regulatory network of seed coat colour.

How sauce color affects consumer emotional response and purchase intention: a structural equation modeling approach for sensory analysis

PurposeHere the authors investigate the effects of a visual color cue (brown color) on saltiness expectations, emotional responses and purchase intention of commercial soy sauce products.Design/methodology/approachThe study enrolled 100 participates, and three sauce colors (light brown, medium brown and dark brown) were used as treatments in this experimental design research. The data analysis was done by a structural equation modeling (SEM) approach with repeated measures.FindingsThe findings indicated that, for the medium and dark brown sauces, the final model revealed a positive effect of sauce color intensity on saltiness expectation, a positive impact of saltiness expectation on emotion and a positive impact of emotion on purchase intention with statistically indifferent factor loadings. Hence, both the medium and dark brown colors soy sauces were the preferred choices for consumers. However, for the light brown color, the test result was unsatisfactory.Originality/valueSeveral empirical studies have identified visual cues as useful for sodium reduction. However, from a marketing perspective, a causal relationship between the color intensity and a customer's purchase intention has not been explored in soy sauce products using an experimental design concept and SEM.

&lt;p class="Textbody"&gt;&lt;strong&gt;A new and intriguing brown-spored &lt;em&gt;Leucocoprinus&lt;/em&gt; species&lt;/strong&gt;&lt;/p&gt;

Leucocoprinus brunneosporus sp. nov., collected at the Santa Catalina Reserve (Buenos Aires, Argentina), is proposed as a new species. We performed separate phylogenetic analyses of the nuclear rDNA large subunit (28S) and the complete nuclear rDNA internal transcribed spacer region (ITS) to establish the placement of the new species in the phylogeny of the Agaricaceae. This new species has a macromorphology similar to that of Lc. birnbaumii, but the spore print is light brown. Detailed descriptions and illustrations of the macro- and microscopic characters are provided.

First Report of Choanephora cucurbitarum Causing Leaf Wilt, Flower Rot, and Stem Necrosis on Crotalaria breviflora.

Crotalaria breviflora (Fabaceae) is used as green manure crop because of its nitrogen fixation and nematode control (Nascimento et al. 2020). In April 2018, leaf wilting, flower rot, and stem necrosis symptoms were observed on C. breviflora with 100% incidence, in Sorriso (12° 33' 31″ S, 55º 42' 51″ W), Santa Carmem (11° 55' 52″ S, 55º 16' 47″ W), and Sapezal (12º 59' 22″ S, 58º 45' 52″ W) counties in the state of Mato Grosso, Brazil. Three monosporic isolates were isolated from symptomatic leaves, cultivated in potato dextrose agar (PDA) medium, and deposited at the Cultures Collection of the University of Brasilia (codes CCUB 1293, CCUB 1667, CCUB 1668). Colonies on PDA were white and cottony with presence of hyaline and coenocytic hyphae. The mycelia later became pale yellow with abundant reproductive structures. Sporangiophores were hyaline, aseptate, unbranched, and apically dilated to form a clavate vesicle, which produced secondary vesicles bearing sporangiola. Secondary vesicles were clavate, light brown, and 37 to 51 µm in diameter. Sporangia were brown to dark brown, globular to ellipsoid, 115 to 140 µm long, and 96 to 122 µm wide. Sporangiospores (n=30) were brown to reddish-brown, ellipsoid to ovoid, with longitudinal striae, 14 to 19 µm long, and 8 to 12 µm wide. Some with hyaline appendages at both ends. Their morphological characteristics were consistent with the descriptions of Choanephora cucurbitarum (Kirk 1984). To confirm the identity, the DNA of the three isolates was extracted and the sequences of Small Subunit (SSU), Large Subunit (LSU), and complete Internal Transcribed Spacer (ITS) of rDNA were amplified using V9G, ITS3, and LR5 primers (GenBank acc. no: MN897836, MN897837 and MN897838). The sequences were aligned with the MAFFT software. The alignment matrix was subjected to Maximum Likelihood (ML) analysis using RAxML v. 8 and Bayesian Inference performed in MrBayes v.3.1.2. The tree was edited in the FigTree software. The sequences showed 100% identity with the sequences from C. cucurbitarum found on the GenBank. To confirm pathogenicity, a suspension at 5.4 ×106 spores/ml was prepared from a 15-day-old culture grown at 25°C and sprayed on asymptomatic plants of C. breviflora. Sterilized water was sprayed as the control. Plants were kept in a humid chamber at 20°C for 48 h. Initial symptoms were visualized 16 days after inoculation. Complete necrosis of leaves and stems with spore mass on infected tissue was observed 19 days after inoculation. To satisfy the Koch's postulates, the fungus was successfully reisolated from the infected tissues. No symptoms were observed on the control plants. In Brazil, this pathogen has been reported on Brassica oleracea var. capitata, Capsicum annuum, Crotalaria spectabilis, Cucurbita sp., and Vigna unguiculata (Alfenas et al. 2018; Mendes and Urben, 2019). C. cucurbitarum has been reported to have a wide range of hosts (Farr and Rossman, 2020). It can infect the crops grown in rotation or in succession, including common bean, corn, cotton, quinoa, soybean, and sunflower. Therefore, this pathogen is of epidemiological importance and poses a threat to the croplands where environmental conditions are conducive to the disease to develop and spread. To our knowledge, this is the first report of C. cucurbitarum causing leaf and flower wilt, and stem rot on C. breviflora in the world. Acknowledgment We thank the Environmental Sciences Graduate Program, Federal University of Mato Grosso, University of Brasilia, PROPeq/PROPG-UFMT, EMBRAPA, CODEX/UFMT, Institute of Agricultural and Environmental Sciences (ICAA)/UFMT and CAPES for providing the Master's scholarship. References Alfenas, R. F., et al. 2018. Plant Dis.102:1456. https://doi.org/10.1094/PDIS-10-17-1610-PDN, Google Scholar. Farr, D. F., and Rossman, A. Y. 2020. Fungal Databases, Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved May 26, 2020 from https://nt.ars-grin.gov/fungaldatabases/, Google Scholar. Kirk, P. M. 1984. Mycol Paper. 152:1. Google Scholar. Mendes, M. A. S., and Urben, A. F. 2020. Fungos relatados em plantas no Brasil, Retrived May 26, 2020 from http://pragawall.cenargen.embrapa.br/aiqweb/michtml/fgbanco01.asp, Google Scholar. Nascimento, D. D. et al. 2020. Bioscience Journal. 36:713. https://doi.org/10.14393/BJ-v36n3a2020-42248, Google Scholar.

Phenotypic Similarities and Differences of Genetic Characteristic Boer and PE Goat Yield Crossbreeding 1st and 2nd Generation

This research aimed to analyze the phenotypic similarity and genetic characteristics of 1st and 2nd generation (G1 and G2) goat of Boer and PE goat yield crossbreeding. The number of offsprings of G1 and G2 was46 and 28 goats, respectively. Data analysis of phenotypic characteristics was estimated by calculating the opportunities of the number of the appearance of G1 and G2 offspring. The result showed that the percentages of the G2 of W11 similarity (67.86%) more significant than G1 (26.09%). The W21was the G1 (45.65%) higher than G2 (10.71%), and W31 was G1 (28.26%) higher than G2 (21.43%). It concluded that G2 had phenotypic similarities of the characteristic (color) in total progeny. The G2 goat displays the phenotypic characters of inheritance (color)patterns that had more significant similarity than the results of the G1, as well as similarities in morphological characters that were different from the G1. The characteristics (colors) in the G2 had dark brown head color greater than G1, and body conformation approaches to Boer goat. Other colors like light brown, plain white, black, and straight black on G1 greater than G2.

Высокобелковый сорт сои Грея

The high-protein soybean cultivar Greya was developed by individual selection from the hybrid population F4 Vilana × Valenta based on a lipid-degrading model of protein accumulation in seeds. According to the results of preliminary and competitive variety testing, the productivity of the high-protein soybean cultivar Greya varied from 1.75 to 2.93 t/ha. The average yield of the new cultivar over four years of variety testing was 2.23 t/ha, which, on average, was 0.71 t/ha higher than the high-protein standard cultivar of the lipid-degrading biotype, and did not significantly differ (-0.09 t/ha) from the high-yielding medium-protein standard cultivar. The height of plants varies from 82 to 98 cm. Under the optimal plant density, the lower pods are located at the height of 15–17 cm from the soil surface. The pubescence is gray. The color of the beans is light brown. The color of the corolla is violet. The seed coat is yellow. The plants of the new cultivar are resistant to lodging and bean shattering. Under optimal cultivation conditions and the presence of mineral or bacterial nitrogen in the soil, up to 46.3 % of protein is accumulated in the seeds of the cultivar Greya. The oil content in the seeds of the cultivar Greya is lower than that of the medium-protein standard, by an average of 2.1 %, which is typical for high-protein cultivars of the lipiddegrading biotype. The growth season of the new cultivar at the latitude of Krasnodar (45°), depending on the meteorological conditions of the year, varied from 108 to 117 days, and on average, for the period of 2017–2020 it was 112 days. Therefore, it can be cultivated as the main crop in soybean-producing farms in the North Caucasus, Lower Volga and Far Eastern regions of the Russian Federation.

Plant Extract Induced Biogenic Preparation of Silver Nanoparticles and Their Potential as Catalyst for Degradation of Toxic Dyes

This study focusses on the synthesis of silver nanoparticles (Ag-nPs) by citrus fruit (Citrus paradisi) peel extract as reductant while using AgNO3 salt as source of silver ions. Successful preparation of biogenic CAg-nPs catalyst was confirmed by turning the colorless reaction mixture to light brown. The appearance of surface Plasmon resonance (SPR) band in UV-Vis spectra further assured the successful fabrication of nPs. Different techniques such as FTIR, TGA and DLS were adopted to characterize the CAg-nPs. CAg-nPs particles were found to excellent catalysts for reduction of Congo red (CR), methylene blue (MB), malachite green (MG), Rhodamine B (RhB) and 4-nitrophenol (4-NP). Reduction of CR was also performed by varying the contents of NaBH4, CR and catalyst to optimize the catalyst activity. The pseudo first order kinetic model was used to explore the value of rate constants for reduction reactions. Results also interpret that the catalytic reduction of dyes followed the Langmuir–Hinshelwood (LH) mechanism. According to the LH mechanism, the CAg-nPs role in catalysis was explained by way of electrons transfer from donor (NaBH4) to acceptor (dyes). Due to reusability and green synthesis of the CAg-nPs catalyst, it can be a promising candidate for the treatment of water sources contaminated with toxic dyes.

First Report of Epicoccum sorghinum Causing Leaf Blight on Kadsura coccinea in China

HomePlant DiseaseVol. 104, No. 12First Report of Epicoccum sorghinum Causing Leaf Blight on Kadsura coccinea in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Epicoccum sorghinum Causing Leaf Blight on Kadsura coccinea in ChinaHuiyun Fan, Weiming Chen, Yicheng Huang, Qingqian Zeng, and Yong HuangHuiyun Fan†Corresponding author: H. Y. Fan; E-mail Address: fhy1262006@126.comhttps://orcid.org/0000-0002-3457-8658Guangdong Institute of Traditional Chinese Medicine, Guangzhou 510640, ChinaSearch for more papers by this author, Weiming ChenGuangdong Institute of Traditional Chinese Medicine, Guangzhou 510640, ChinaSearch for more papers by this author, Yicheng HuangGuangdong Institute of Traditional Chinese Medicine, Guangzhou 510640, ChinaSearch for more papers by this author, Qingqian ZengGuangdong Institute of Traditional Chinese Medicine, Guangzhou 510640, ChinaSearch for more papers by this author, and Yong HuangGuangdong Institute of Traditional Chinese Medicine, Guangzhou 510640, ChinaSearch for more papers by this author AffiliationsAuthors and Affiliations Huiyun Fan † Weiming Chen Yicheng Huang Qingqian Zeng Yong Huang Guangdong Institute of Traditional Chinese Medicine, Guangzhou 510640, China Published Online:13 Oct 2020https://doi.org/10.1094/PDIS-04-20-0884-PDNAboutSectionsView articlePDFSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat View articleKadsura coccinea (Lem.) A. C. Smith, a perennial medicinal woody vine in the family Schisandraceae, is mainly cultivated in Jiangxi, Guangdong, Sichuan, Guizhou, and Yunnan Provinces in China. The roots and canes of K. coccinea have been used for the treatment of chronic gastritis, bruises, rheumatism, and dysmenorrhea by local residents in China (Xu et al. 2018), and the fruit also can be eaten as a dessert. In October 2019, severe leaf blight symptoms were observed on the second year growth of six of 13 K. coccinea vines in the private garden of Guangdong Institute of Traditional Chinese Medicine (N23°10′3.09″, E113°23′47.31″) in Guangzhou, China. Zonate lesions of alternating light brown and dark brown started from the leaf tips. After surface sterilization, samples of leaf tissue taken from the margin of the lesion and healthy leaf tissue were plated on potato dextrose agar (PDA) and incubated at 28°C in the dark for 2 days. Mycelia growing from the edges of the tissue samples were transferred to new PDA plates and cultured at 28°C in the dark for 6 days. A total of 11 isolates were obtained from six diseased leaves. The colonies of the isolates were regular round and approximately 6.0 cm in diameter after 6 days of culture, and the reverse side was light brown. Aerial hyphae were villose and white. After 12 days of incubation, the colonies became pale brown and secreted a scarlet diffusible pigment that colored the underside of the colony reddish brown. Many small pycnidia (89.1 to 215.0 × 111.2 to 244.4 μm) were visible in the colony. Unicellular chlamydospores were brown to black and were 2.4 to 7.8 × 4.9 to 12.4 μm, and multicellular chlamydospores were 4.8 to 22.5 × 13.7 to 54.6 μm. Based on the above morphological characteristics, these isolates were identified as Epicoccum sp. (Zhou et al. 2018). Genomic DNA was extracted using a Fungal DNA Kit (Omega Bio-tek, Guangzhou, China). Polymerase chain reaction amplifications of the gene fragments of ribosomal internal transcribed spacer (ITS), β-tubulin (TUB), 28S nrDNA (LSU), and actin (ACT) of strain GDTCMF19 were amplified with primers ITS1/ITS4, T1/Bt2b, LR7/LROR, and ACT-512F/ACT-783R, respectively (Aveskamp et al. 2010; Carbone and Kohn 1999; Glass et al. 1995; O’Donnell et al. 1997). Sequences from isolate GDTCMF19 were deposited in GenBank (accession nos. MN915133 for ITS, MN917744 for TUB, MN915134 for LSU, and MN917745 for ACT). The identification of the isolate as Epicoccum sorghinum was validated by constructing a phylogenetic tree and that showed high congruence to E. sorghinum H10, E. sorghinum SCCZ16, and E. sorghinum SCCZ09 (shown in the supplementary materials). Pathogenicity tests were performed by inoculating unwounded leaves of six healthy second-year transplants with 6 × 6-mm mycelial discs of E. sorghinum grown on PDA. All control plants were inoculated with sterile PDA discs. All plants were maintained in a chamber at 25 to 28°C and relative air humidity of 50 to 65%. After 2 weeks, typical symptoms were observed. Small brown spots that gradually expanded were observed at the leaf margins 7 days after inoculation. After 2 weeks, zonate lesions similar to those observed in the garden were observed on 1/3 of the inoculated leaf. No symptoms appeared on control plants. The experiments were repeated three times. To fulfill Koch’s postulates, the fungus was reisolated from the inoculated leaves on PDA and confirmed as E. sorghinum. To our knowledge, this is the first report of E. sorghinum causing leaf blight on K. coccinea in China. Because K. coccinea is used medicinally by local residents, the leaf blight is of concern, and this report will assist with monitoring distribution of the disease to assist with developing management recommendations.The author(s) declare no conflict of interest.

ANALISIS VARIASI TEMPERATUR PRA MORDAN PEWARNA KAYU SECANG DAN DAUN JATI SERTA PENERAPAN HEDONIC TEST PADA KUALITAS SERAT KENAF INDUSTRI FASHION

This study aims to determine the effect of pre-mordant material on kenaf fiber coloring using secang wood and teak leaves, to determine the Henodic Test method in classifying its quality, as well as to determine the significant effect on the color of kenaf fiber, and to determine the level of consumer preference for kenaf fiber. natural dyes. The research method used was an experiment with a variety of pre-mordant materials (alum, lime, vinegar). From the test, it was found that the color direction of the kenaf fiber was reddish purple to light brown, so the average value of fastness to washing was 4 (good).&#x0D; From this activity, it was concluded that the addition of secang wood and teak leaves as pre- mordant materials coupled with the effect of pH on the staining of kenaf fibers with secang wood extract provided variations in the direction of color and the value of color fastness to washing. Kenaf fiber is an environmentally friendly alternative to textile raw materials. This study used the Hedonic Test method with the Kruskal Wallis test. The results of this study were that there was no significant effect on the combination of compost application and pesticide application with natural dyes of secang wood and teak leaves on the color of kenaf fibers and there was no effect on the level of consumer preference for kenaf fiber with natural dyes.

A tale of two generations: Maternal skin color and adverse birth outcomes in Black/African American women.

We examined how sociopolitical context (marked by generational cohort) and maternal skin color interacted to influence preterm delivery (PTD) rates in sample of Black women. Data were from 1410 Black women, ages 18-45 years, residing in Metropolitan Detroit, MI enrolled (2009-2011) in the Life-course Influences on Fetal Environments (LIFE) Study. Because we hypothesized that generational differences marked by changes in the sociopolitical context would influence exposure to racism, we categorized women into two cohorts by maternal birth year: a) Generation X, 1964-1983 and b) Millennial, 1984-1993. Descriptive results showed similar PTD rates by generational cohort, Generation X: 16.3% vs. Millennials: 16.1%. Yet, within each generation, PTD rates varied by women's skin tone (categorized: light, medium, and dark brown). Poisson regression models confirmed a significant interaction between generational cohort and maternal skin tone predicting PTD (P=0.001); suggesting a salubrious association between light brown skin tone (compared to medium and dark) and PTD for Generation X. However, Millennials with medium and dark brown skin experienced lower PTD rates than their light Millennial counterparts. Research should consider sociopolitical context and the salience of skin tone bias when investigating racial health disparities, including those in perinatal health.