Library Preparation Research Articles

Museomic analyses clarify species diversity in the icefish genus Channichthys

The rapid diversification of notothenioid fishes in Antarctic waters is a prime example of the process of adaptive radiation. Within around 10 million years, Antarctic notothenioids have diversified into over 100 species with a broad range of lifestyles and ecological adaptations. However, the exact number of species within this radiation has long been unclear. Particularly challenging is the taxonomy of the genus Channichthys, for which between one and nine species have been recognized by different authors. The putative species of this genus are known from a limited number of specimens, of which most were sampled decades ago. Here, we investigated the mitochondrial genomes of museum specimens representing the four species Unicorn Icefish (C. rhinoceratus), Red Icefish (C. rugosus), Sailfish Pike (C. velifer), and Charcoal Icefish (C. panticapaei), complemented by morphological analyses. All analyzed specimens were collected in the 1960s and 1970s and fixed in formaldehyde, and their DNA has been heavily degraded. Applying ancient-DNA protocols for DNA extraction and single-stranded library preparation, we were able to obtain sufficient endogenous DNA to reconstruct the mitochondrial genomes of one specimen per species. These mitochondrial genome sequences were nearly identical for the three specimens assigned to Unicorn Icefish, Red Icefish, and Sailfish Pike, while greater divergence was observed for the Charcoal Icefish specimens. We discuss possible explanations of the contrast between these molecular results and the recognizable morphological variation found among the four species, and recommend that at least the Charcoal Icefish be included in the list of valid notothenioid species.

P-2169. Establishment of multiplex PCR method for nearly whole-genome sequencing of human parainfluenza/rubula virus 4 from a clinical sample

Abstract Background Human parainfluenza/rubula virus 4 (HPIV4) has two subtypes (4a/4b). HPIV4 infection is usually mild but can be severe in young children, older adults, and immunocompromised individuals. However, sequence information on HPIV4 is limited worldwide, including in tropical areas. Whole-genome sequencing is useful for the molecular epidemiological analysis of virus introduction and transmission routes. Thus, this study aimed to establish nearly whole-genome sequencing of HPIV4 subtypes using multiplex PCR (mPCR) methods and to identify genetic characterization in the Philippines. Methods We collected 29 (4a; n=17, 4b; n=12) HPIV4-positive samples from children (< 5 years old) with severe pneumonia at three hospitals (Leyte, Biliran, and Palawan) in the Philippines from 2012 to 2019. HPIV4 positive samples showed cycle threshold (Ct) values ranging from 21.1 to 36.9. An online pipeline tool (Primal Scheme) was used to design mPCR primer panels for HPIV4 subtype-specific viruses to cover the whole genome. For the sequencing experiment, viral RNA was purified from clinical samples and synthesized cDNA. cDNA was amplified using mPCR with each primer panel. The PCR amplicon was library preparation with a tag for the Illumina sequencing platform. Data of whole-genome sequencing was obtained using a CLC genomic workbench. Results All of the 29 HPIV4-positive samples were amplified by mPCR for whole-genome sequencing. The whole-genome sequencing results for HPIV4a showed that the length of consensus sequences generated at a coverage depth of 30X ranged from 85% to 99%. The sample with the lowest coverage (85%) had a Ct value 28.9. The results for HPIV4b showed that at a coverage depth of 30X, the length of consensus sequences ranged from 97% to 99%. The Ct values of the samples that showed 97% coverage were 22.6 and 30.4. Although some HPIV4 strains detected in the Philippines belonged to the same clade, others were in different clades. These clades included strains detected in various areas, such as Asia and North America. Conclusion This study established that the HPIV4 subtype-specific primer panels allow users to obtain the whole genome of HPIV4 directly from clinical samples. This method provides a universal, rapid, and effective tool for genomics surveillance. Disclosures All Authors: No reported disclosures

P-2165. Comprehensive Next-Generation Sequencing-Based Assay for Antimicrobial Resistance Gene Marker Identification in Urine

Abstract Background Antimicrobial resistance (AMR) is a growing threat to human health contributing to 1.27 million global deaths annually. Due to the limited genetic repertoire necessary to confer bacterial resistance, new genetic variants regularly emerge. In the diagnosis of urinary tract infections (UTIs), culture and phenotypic resistance testing are considered the gold standard. However, due to their limitations (false negative culture, long turnaround time), inconclusive results can frequently lead to empirical treatment. Conversely, polymerase chain reaction (PCR)-based testing is fast, but primer design may not be able to keep up with rapid evolution and large numbers of potential genes. Next-generation sequencing (NGS) offers an effective path to rapid and comprehensive AMR diagnosis with “evolution-proof” assays. Methods Culture positive clinical urine specimens (n=168) were processed with the clinical-grade BIOTIA-ID Urine NGS Assay including DNA extraction, library preparation, Illumina-NextSeq sequencing and BIOTIA-DX analysis to identify urogenital pathogens and AMR genes. Identified AMR genes were confirmed with qPCR. An additional cohort of culture negative (< 100k CFU/mL) urine specimens (n=201) were processed from patients with pyuria and UTI symptoms (Advarra Pro00038083, IRBNet 1950413-1). Results We used NGS to identify seven AMR markers (TEM, SHV, sul1, KPC, CTX-M, vanA, mecA) directly in urine. NGS results were compared to PCR testing with corresponding accuracy between 96-100% for all tested genes. Of 369 specimens where a pathogen was identified 59.3% contained at least one AMR gene. Different AMR profiles could be distinguished based on the presence of different pathogens and AMR genes could generally be associated with specific pathogens. Beta-lactamases were the most prevalent type of AMR gene markers accounting for 55.3% of all identified genes. Conclusion NGS is an effective tool to identify AMR markers directly from clinical urine specimens. It can identify AMR with high accuracy, can map AMR to a particular pathogen, and can be built into an existing NGS-based diagnostic assay. NGS is agnostic to the specific sequences of AMR markers; therefore, it can be used to detect and identify novel markers that arise through mutation. Disclosures Gabor Fidler, PhD, Biotia: Employee of Biotia|Biotia: Stocks/Bonds (Private Company) Mara Couto-Rodriguez, MS, Biotia: Employee|Biotia: Stocks/Bonds (Private Company)|Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company) Xavier O. Jirau Serrano, MS, Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company) Heather L. Wells, MPH, PhD Candidate, Biotia, Inc.: Employee Sol Rey, BS, Biotia: Employee|Biotia: Stocks/Bonds (Private Company) Tiara Rivera, B.S., Biotia: Employee|Biotia: Stocks/Bonds (Private Company) John C. Papciak, BS, Biotia: Employee|Biotia: Stocks/Bonds (Private Company) Patrick F. Combs, PhD, Biotia: Employee Christopher E. Mason, PhD, Biotia: Board Member|Biotia: Honoraria|Biotia: Ownership Interest|Biotia: Stocks/Bonds (Private Company) Niamh B. O'Hara, PhD, Biotia: Board Member|Biotia: Two patents related to genomic sequence analysis of microbial species|Biotia: Ownership Interest|Biotia: Stocks/Bonds (Private Company) Dorottya Nagy-Szakal, MD PhD, Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company) David C. Danko, Ph.D., Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company)

295. Methods for Cost-efficient Real-time Whole Genome Sequencing Surveillance for Enhanced Detection of Outbreaks in a Hospital Setting

Abstract Background Healthcare associated infections (HAI) are common hospital complications associated with increased length of stay, economic burden, morbidity, and mortality. Traditionally, HAI outbreaks were detected using reactive whole genome sequencing (WGS); however, with costs decreasing over time, WGS has become a practical tool for the real time detection of nosocomial outbreaks. This study describes such methods, provides a cost analysis, and reviews notable outbreaks observed while performing real time WGS surveillance of HAIs. EDS-HAT real-time genomic surveillance methodsFigure 1:EDS-HAT real-time genomic surveillance methods A) collect list generation, B) sample collection C) sample processing, D) DNA extraction, E) Library preparation, F) WGS, and G-I) Data analysis, including determining SNPs between samples and infection clusters Methods The Enhanced Detection System for Healthcare-Associated Transmission (EDS-HAT) was devised to identify potential transmitted HAIs in real time among patients admitted to the hospital for ≥ 3 days or with a previous exposure in the prior 30-days (Fig 1). We performed a cost analysis for real time genomic HAI surveillance, based on an average cutoff of 35× coverage per genome, considering personnel, reagents, supplies, and WGS platform. We also considered maximum sample counts that could be sequenced on two platforms (MiSeq or NextSeq), based on genome size (Fig 2). Bioinformatic analyses were completed following WGS, and epidemiological links were investigated for isolates that clustered with ≤ 15 pair-wise SNP differences (C. diff ≤ 2 SNPs). Maximum Sample CountsFigure 2:Maximum number of genomes that can be run on a MiSeq v3 600 cycle flow cell and NextSeq500 v2.5 300 cycle flow cell based on size (Mb). Sample counts were calculated using Illumina coverage calculator based on 80× coverage criteria. Genome size of an average run by the MiGEL lab is shown in comparison Results From November 1, 2021 to October 31, 2023, we sequenced 4,723 isolates (weekly mean N=49). The per sample cost depended on platform used and sample count, totaling $49 or $19 for MiSeq (N=32) and NextSeq (N=96), respectively (Table 1). With the inclusion of personnel costs for 1 lab technician and 1 biostatistician (salary only, based on percent effort) the average weekly cost to run EDS-HAT was $4,293 (range $3,626-$4,758). We highlight multiple outbreaks involving a common hospital unit, equipment, or location (Table 2). Following Infection Prevention (IP) intervention, no additional cases were detected for these clusters on the associated routes. Cost per sample BreakdownTable 1.Cost per sample across MiSeq, NextSeq, and commercial WGS Conclusion We describe time- and cost-efficient methods for real time outbreak surveillance and detection using WGS. These genomic methods, as described in EDS-HAT, can be utilized with traditional epidemiological methods to guide hospital IP teams to mitigate and stop the spread of deadly transmitted HAIs. Notable OutbreaksTable 2.Description of notable outbreaks detected by real-time EDS-HAT HAI surveillance Disclosures Alexander Sundermann, DrPH, CIC, FAPIC, OpGen: Honoraria Lee Harrison, MD, GSK: Advisor/Consultant|Merck: Advisor/Consultant|Pfizer: Advisor/Consultant|Sanofi: Advisor/Consultant

P-2159. Potential Application of a Clinical-Grade Next Generation Sequencing Assay for Detection of Bacterial Vaginosis Associated Organisms in Urine

Abstract Background Bacterial vaginosis (BV) is the most common cause of vaginal dysbiosis in women affecting about 21.2 million women ages 14-49 in the United States. Vaginal swabs are typically used for BV diagnosis using a combination of microscopy and PCR tests. Timely and precise diagnostics is essential for enhancing patient outcomes and minimizing antibiotic prescription. However, limitations persist within thediagnostic approaches currently employed in clinical practice. BIOTIA-ID Urine NGS Assay was assessed as a tool to diagnose BV from urine by developing an (NGS)-based Nugent score based on compositional dynamics of lactobacilli and BV-associated organisms. Methods Healthy donor (HD, n=20) and culture negative (CN, < 100k CFU/mL) urine specimens (n=201) were collected from patients with pyuria and UTI symptoms and processed with the BIOTIA-ID Urine NGS Assay including DNA extraction, library preparation, Illumina-NextSeq sequencing and BIOTIA-DX analysis to identify urogenital pathogen infections. Findings were correlated with clinical metadata (Advarra Pro00038083, IRBNet 1950413-1). Results BIOTIA-ID yielded an average of 2.15M microbial reads per sample with 100% passing laboratory QC and classified 62% of the CN-specimens as positive for dysbiosis/infection while HD specimens were negative. Gardnerella vaginalis (21.4%), Prevotella (14.9%), and Aerococcus species (6.9%) were the most often detected organisms in NGS-positive samples while 70% of HD were predominantly Lactobacillus species. 65% of the Gardnerella positive specimens were symptomatic women of reproductive age (18-49 age group) and 29.3% took a course of antibiotics 30 days prior to urine collection. Development and evaluation of an NGS-based Nugent score revealed significantly higher scores in the urine of BIOTIA-ID Gardnerella positive specimens (p< 0.0001). Conclusion Similar to PCR studies, here we demonstrate that a urine specimen, which is noninvasive, and the incorporation of an NGS-Nugent score has potential application for BV diagnostics. Prospective clinical utilization studies in which collection of vaginal swabs and urine from both HD and clinically BV-positive patients are warranted to further develop and validate BIOTIA-ID as a BV-diagnostic assay. Disclosures Mara Couto-Rodriguez, MS, Biotia: Employee|Biotia: Stocks/Bonds (Private Company)|Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company) Sol Rey, BS, Biotia: Employee|Biotia: Stocks/Bonds (Private Company) Heather L. Wells, MPH, PhD Candidate, Biotia, Inc.: Employee Tiara Rivera, B.S., Biotia: Employee|Biotia: Stocks/Bonds (Private Company) Xavier O. Jirau Serrano, MS, Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company) John C. Papciak, BS, Biotia: Employee|Biotia: Stocks/Bonds (Private Company) David C. Danko, Ph.D., Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company) Christopher E. Mason, PhD, Biotia: Board Member|Biotia: Honoraria|Biotia: Ownership Interest|Biotia: Stocks/Bonds (Private Company) Niamh B. O'Hara, PhD, Biotia: Board Member|Biotia: Two patents related to genomic sequence analysis of microbial species|Biotia: Ownership Interest|Biotia: Stocks/Bonds (Private Company) Dorottya Nagy-Szakal, MD PhD, Biotia Inc: Employee|Biotia Inc: Stocks/Bonds (Private Company)

P-1850. Acute Babesia microti Infection in Humans Is Associated With Marked Changes In The Expression Of Peripheral Blood Coding And Noncoding RNA

Abstract Background Babesiosis is a potentially life-threatening disease transmitted by ticks. However, host and parasite determinants of human babesiosis are completely unknown. In the current study we evaluated the impact of B. microti infection, the primary cause of human babesiosis in the US, on the peripheral blood transcriptome. Figure 1. PCA of top 500 differentially expressed genes. PCA distinguishes Babesia patients at presentation from healthy controls. Methods Patients with confirmed B. microti acute infection were enrolled into a 1-year follow up cohort study at Stony Brook University Hospital, NY. Total RNA was isolated from blood using PaxGene RNA tubes and library preparation performed using Illumina's Stranded Total RNAPrep with Ribo-zero plus kit to remove human ribosomal RNA and globin RNA. 100 M RNA paired end reads were sequenced (2 x 151 bps). Low expression RNAs with less than 10 reads in 17 samples were filtered out prior to identification of differentially expressed genes (DEGs) (p< 0.05).Figure 2.Volcano Plot comparing differential gene and noncoding RNA expression between healthy controls and patients with babesiosis at presentation.Red circles represent genes whose expression are increased or decreased in patients with babesiosis at presentation compared to healthy controls. Blue circles represent genes whose expression are not significantly different. Results The peripheral blood transcriptome from 20 healthy controls was compared to 42 patients at presentation for B. microti infection and 1, 3, 6, 9 and 12 months after treatment for patients who completed the longitudinal protocol after the first visit. A total of 1860 genes or noncoding RNAs were differentially expressed in patients with babesiosis at presentation (V0) compared to healthy controls; 370 were decreased in patients with babesiosis and 1490 were increased (adj p < 0.01; expression fold change >+/- 1.) PCA analysis (Fig 1), and the Volcano Plot (Fig. 2) demonstrate that patients with babesiosis have a distinct peripheral blood gene expression profile compared to healthy control individuals. The heat map of DEGs in Fig. 3 shows the peripheral blood transcriptome in patients with babesiosis largely returned to baseline levels by 1-month post-treatment. The Qiagen IPA Graphical Summary based on DEGs is shown in Figure 4 and highlights activation of diverse immune-mediators, including TNF and interferon families, as well as growth factors, and vascularization pathways in response to B. microti infection.Figure 3.Heat map of differentially expressed genes of patients with babesiosis at presentation (0) and 1, 3, 6, 9 and 12 months post-treatment compared to healthy control individuals.Gene expression in patients with babesiosis is markedly different at presentation but is similar to levels for healthy controls by 1 month post-treatment. Conclusion Infection with B. microti results in marked changes in expression of genes and noncoding RNA in peripheral blood that largely returns to baseline by 1-month post-treatment.Figure 4:Qiagen IPA Graphical Summary of pathways likely increased (orange) or decreased (blue) in patients presenting with babesiosis. Disclosures Paul Arnaboldi, PhD, Biopeptides, Corp: Patent Holder|Biopeptides, Corp: Employee|DiaSorin: Advisor/Consultant

First report of privet leaf blotch-associated virus (PLBaV) infecting lilac (Syringa vulgaris L.) in France.

Privet leaf blotch-associated virus (PLBaV) is an Idaeovirus discovered by high-throughput sequencing (HTS) in privet (Ligustrum japonicum L) in southern Italy in 2017 (Navarro et al., 2017). In privet, it causes a leaf blotch disease with yellowish or whitish chlorotic blotches or ringspots. Since this initial discovery, there have been no further reports of PLBaV and a single genomic sequence is available in GenBank (LT221868-9). A GenBank entry (HM153080) suggests that PLBaV might also infect ash (Fraxinus excelsior L.). In June 2024, a lilac (Syringa vulgaris L.) showing poor growth and leaf symptoms of light green chlorotic rings and lines was observed near Bordeaux, France. Total RNAs were extracted (Khalili et al., 2022) from symptomatic leaf tissue and analyzed by HTS (2x150 nucleotides (nt) paired reads, Illumina NovaSeq) following ribodepletion (Ribo-off rRNA Depletion Kit(Plant) and VAHTS Universal V6 RNA-seq Library Prep Kit for Illumina, Nanjing Vazyme Biotech Co, Nanjing, China). The obtained reads were trimmed, de novo assembled or mapped against references using CLC Genomics Workbench 24.0 with default settings (Candresse et al., 2018) and contigs annotated by blastx against GenBank. Two contigs were identified with very high homology with the genomic RNAs of the PLBaV reference isolate from privet. No other virus or viroid contig was identified from the lilac dataset. The RNA1 contig (5354 nt) misses only 17 nt at the 5' end and 6 nt at the 3' end and is 97.9% identical to the RNA1 of the reference isolate (LT221868). It involves 67,742 reads (0.25% of the total of 24.9 million reads of an average length of 148.6 nt), for an average coverage of 1741x. The RNA2 contig (2335 nt) misses 14 nt at the 5' end and is complete at the 3' end. It is 98.2% identical to the reference isolate (LT221869) and involves 75,140 reads (0.3% of total reads) for a 4769x average coverage. The sequences of these two contigs, representing the second near complete PLBaV genome have been deposited in GenBank (PQ786942-43). To confirm PLBaV presence in the original lilac sample, specific primers were designed for both genomic RNAs. RNA1 was amplified using primer pair PLBaV-RNA1-R1 5' TCGATTCTCAGCAATGAGATG 3' and PLBaV-RNA1-F1 5' CTGTGTGCGTTGGTCTGAGT 3' while RNA2 was amplified using the pair PLBaV-RNA2-R1 5' TGGTTGAGGTCGAGAGGTG 3' and PLBaV-RNA2-F1 5' ACTCAAGCGTAAGATGGCGTC 3'. Using the RNA purification and RT-PCR protocols of Khalili et al. (2022), both primer pairs were used at a 57°C annealing temperature, yielding amplicons of the expected size (respectively 392 and 301 nt) showing 100% identity with the HTS contigs. To the best of our knowledge, this is the first report of PLBaV in lilac in France and the second report of PLBaV ever, representing the identification of a new natural host and an extension of the known geographical distribution. Lilac, similar to privet and ash is a member of the Oleaceae family, further strengthening the association between PLBaV and this family. Since no other viral agent was identified in the HTS analysis, the chlorotic ringspot symptoms that prompted this investigation were most likely caused by PLBaV. The affected plant has since died but whether the initial poor growth and later death were caused by PLBaV is not known as these symptoms might have had another cause. Raspberry bushy dwarf virus (RBDV) the best known Idaeovirus is transmitted by pollen and seed (Isogai et al., 2014), raising the question of whether PLBaV might be similarly transmitted in its various hosts. The rarity of PLBaV reports since its discovery in 2017 suggest it should be of low concern but data is needed to better evaluate its presence in and pathogenicity to lilac.

Beyond genomics: using RNA-seq from dried blood spots to unlock the clinical relevance of splicing variation in a diagnostic setting.

We aimed to assess the impact of splicing variants reported in our laboratory to gain insight into their clinical relevance. A total of 108 consecutive individuals, for whom 113 splicing variants had been reported, were selected for RNA-sequencing (RNA-seq), considering the gene expression in blood. A protocol was developed to perform RNA extraction and sequencing using the same sample (dried blood spots, DBS) provided for the DNA analysis, including library preparation and bioinformatic pipeline analysis. Splicing in genes of interest was inspected using IGV, with at least three unaffected individuals as controls. From the 113 variants, we confirmed an abnormal splicing in 64 variants (57%). In 15 variants (13%), we did not observe a splicing alteration. In the remaining 34 variants, no decision could be made on the splicing effect due to insufficient sample quality (21%) or a low number of reads (9%). The most common event leading to aberrant splicing was exon skipping, identified in 31 variants (48%). Other events included cryptic donor/acceptor site usage (n = 25; 39%), intron retention (n = 4; 6%), and other complex events (n = 4; 6%). In three patients, pathologically reduced enzymatic activity (measured using the same DBS) served as additional confirmation of the abnormal splicing caused by variants in HEXA, GAA, and GLA. We implemented an RNA-seq pipeline using the same sample provided for genomic testing. This multiomic approach, as implemented in our routine diagnostic processes, clarifies the clinical relevance of most of the analyzed variants and delivers more comprehensive genetic testing.

Adipose tissue transcriptome in patients switching efavirenz or a protease inhibitor to raltegravir compared to people without HIV.

To study the subcutaneous adipose tissue (SAT) transcriptome in people with HIV (PWH) switching efavirenz (EFV) or a protease inhibitor (PI) to raltegravir and to compare the transcriptome of PWH to those of people without HIV (PWoH). PWH (n = 36) on EFV (n = 22) or a PI (n = 14) based ART regimen were randomized to switch to RAL (n = 15) or to continue unchanged medication (n = 17). PWoH (n = 10), comparable in age and body mass index, were included for comparison. SAT gene expression was analyzed via RNA sequencing (Illumina Stranded mRNA library prep). At baseline, only 51 out of 19930 genes showed differential expression (FDR <0.05) between PWH and PWoH. Differentially expressed genes in PWH were identified as being HIV host factors or were associated with immune response, lipid metabolism, adipogenesis, apoptosis regulation, DNA/RNA metabolism, and cell structures. Mitochondria-encoded genes were consistently downregulated in PWH. Intergroup variations among PWH using different ART (EFV, PI, RAL) were not significant, and switching EFV or a PI to RAL did not induce substantial changes in the SAT transcriptome. While some specific genes linked to HIV are differentially expressed in PWH compared to PWoH, the overall SAT transcriptome remains relatively stable across various antiretroviral treatments and upon switching from EFV/PI to RAL. These findings enhance our understanding of the molecular landscape on SAT in the context of HIV and ART.

Improved Inhibitors Targeting the Thymidylate Kinase of Multidrug-Resistant Mycobacterium tuberculosis with Favorable Pharmacokinetics

This study aims to design improved inhibitors targeting the thymidylate kinase (TMK) of Mycobacterium tuberculosis (Mtb), the causative agent of infectious disease tuberculosis that is associated with high morbidity and mortality in developing countries. TMK is an essential enzyme for the synthesis of bacterial DNA. We have performed computer-aided molecular design of MtbTMK inhibitors by modification of the reference crystal structures of the lead micromolar inhibitor TKI1 1-(1-((4-(3-Chlorophenoxy)quinolin-2-yl)methyl)piperidin-4-yl)-5-methylpyrimidine-2,4(1H,3H)-dione bound to TMK of Mtb strain H37Rv (PDB entries: 5NRN and 5NR7) using the computational approach MM-PBSA. A QSAR model was prepared for a training set of 31 MtbTMK inhibitors with published inhibitory potencies () and showed a significant correlation between the calculated relative Gibbs free energies of the MtbTMK–TKIx complex formation and the observed potencies. This model was able to explain approximately 95% of the variation in the in vitro inhibition data and validated our molecular model of MtbTMK inhibition for the subsequent design of new TKI analogs. Furthermore, we have confirmed the predictive capacity of this complexation QSAR model by generating a 3D QSAR PH4 pharmacophore-based model. A satisfactory correlation was also obtained for the validation PH4 model of MtbTMK inhibition (R2 = 0.84). We have extended the hydrophobic m-chloro-phenoxyquinolin-2-yl group of TKI1 that can occupy the entry into the thymidine binding cleft of MtbTMK by alternative larger hydrophobic groups. Analysis of residue interactions at the enzyme binding site made it possible to select suitable building blocks to be used in the preparation of a virtual combinatorial library of 28,900 analogs of TKI1. Structural information derived from the complexation model and the PH4 pharmacophore guided the in silico screening of the library of analogs and led to the identification of new potential MtbTMK inhibitors that were predicted to be effective in the low nanomolar concentration range. The QSAR complexation model predicted an inhibitory concentration of 9.5 nM for the best new virtual inhibitor candidate TKI 13_1, which represents a significant improvement in estimated inhibitory potency compared to TKI1. Finally, the stability of the MtbTMK–inhibitor complexes and the flexibility of the active conformation of the inhibitors were assessed by molecular dynamics for five top-ranking analogs. This computational study resulted in the discovery of new MtbTMK inhibitors with predicted enhanced inhibitory potencies, which also showed favorable predicted pharmacokinetic profiles.

Identification of an enzyme with strong single-stranded DNA ligation activity and its application for sequencing.

An enzyme with strong single-stranded DNA (ssDNA) ligation activity would be advantageous for many molecular biology applications. However, currently available enzymes exhibit only limited activity. Here, we identified an enzyme with strong ssDNA ligation activity upon searching the databases for proteins homologous to TS2126 RNA ligase, the known enzyme with the highest yet limited ssDNA ligation activity. A ligase from Thermus phage phiLo (GenBank: AYJ73970) or Tph ssDNA ligase (SDL) depicted higher ssDNA ligation activity than TS2126 RNA ligase. This study suggests that SDL could be useful for various applications including sequencing for library preparation.

Single-cell RNA sequencing highlights the role of distinct natural killer subsets in sporadic amyotrophic lateral sclerosis

BackgroundNeuroinflammation plays a major role in amyotrophic lateral sclerosis (ALS), and cumulative evidence suggests that systemic inflammation and the infiltration of immune cells into the brain contribute to this process. However, no study has investigated the role of peripheral blood immune cells in ALS pathophysiology using single-cell RNA sequencing (scRNAseq).MethodsWe aimed to characterize immune cells from blood and identify ALS-related immune alterations at single-cell resolution. For this purpose, peripheral blood mononuclear cells (PBMC) were isolated from 14 ALS patients and 14 cognitively unimpaired healthy individuals (HC), matched by age and gender, and cryopreserved until library preparation and scRNAseq. We analyzed differences in the proportions of PBMC, gene expression, and cell-cell communication patterns between ALS patients and HC, as well as their association with plasma neurofilament light (NfL) concentrations, a surrogate biomarker for neurodegeneration. Flow cytometry was used to validate alterations in cell type proportions.ResultsWe identified the expansion of CD56dim natural killer (NK) cells in ALS (fold change = 2; adj. p-value = 0.0051), mainly driven by a specific subpopulation, NK_2 cells (fold change = 3.12; adj. p-value = 0.0001), which represent a mature and cytotoxic CD56dim NK subset. Our results revealed extensive gene expression alterations in NK_2 cells, pointing towards the activation of immune response (adj. p-value = 9.2 × 10− 11) and the regulation of lymphocyte proliferation (adj. p-value = 6.46 × 10− 6). We also identified gene expression changes in other immune cells, such as classical monocytes, and distinct CD8 + effector memory T cells which suggested enhanced antigen presentation via major histocompatibility class-II (adj. p-value = 1.23 × 10− 8) in ALS. The inference of cell-cell communication patterns demonstrated that the interaction between HLA-E and CD94:NKG2C from different lymphocytes to NK_2 cells is unique to ALS blood compared to HC. Finally, regression analysis revealed that the proportion of CD56bright NK cells along with the ALSFRS-r, disease duration, and gender, explained up to 76.4% of the variance in plasma NfL levels.ConclusionOur results reveal a signature of relevant changes occurring in peripheral blood immune cells in ALS and underscore alterations in the proportion, gene expression, and signaling patterns of a cytotoxic and terminally differentiated CD56dim NK subpopulation (NK_2), as well as a possible role of CD56bright NK cells in neurodegeneration.

Early Detection of the Pathogenetic Variants of Homologous Recombination Repair Genes in Prostate Cancer: Critical Analysis and Experimental Design

It has been shown that the pathogenic variants (PVs) of the DNA Damage Response (DDR) genes, whether of a germinal or somatic nature, represent a predictive biomarker of high sensitivity to treatment with inhibitors of the enzyme poly-ADP-ribose polymerase (PARP) in patients with hormone-resistant metastatic prostate cancer (HRPCa). Moreover, the detection of PVs of the Homologous Recombination Repair (HRR) genes in PCa patients can help to define the patient’s prognosis and the choice of the therapeutic procedure. Among men with metastatic PCa, the frequency of PVs in HRR genes ranges from 11% to 33%, which is a significantly higher rate compared to non-metastatic PCa, where the incidence is between 5% and 10%. Next-Generation Sequencing (NGS) results were more commonly obtained from newly acquired somatic samples compared to archived samples (prostate biopsy or prostatectomy). We developed an experimental multidisciplinary prospective study in patients with a new diagnosis of high-risk PCa at biopsy. The aim was to evaluate the presence of PVs of different HRR genes in patients with the first diagnosis of PCa in relation to a metastatic or non-metastatic stage, tumor aggressiveness, and early risk of progression. Among 43 initial tumor samples from 22 patients, 25 samples from 12 patients were selected for library preparation based on their DNA concentration and quality. After the NGS, 14 different DNA variants were prioritized. Oncogenetic and likely oncogenetic variants were found in the ATM, BRCA1, PTEN, KMT2D, and CDH1 genes. Moreover, variants of uncertain significance were found in ATM, DDR2, FANCA, FOXA1, PLCB4, PTCH1, and RB1.

Charting the epitranscriptomic landscape across RNA biotypes using native RNA nanopore sequencing.

RNA modifications are conserved chemical features found in all domains of life and across diverse RNA biotypes, shaping gene expression profiles and enabling rapid responses to environmental changes. Their broad chemical diversity and dynamic nature pose significant challenges for studying them comprehensively. These limitations can now be addressed through direct RNA nanopore sequencing (DRS), which allows simultaneous identification of diverse RNA modification types at single-molecule and single-nucleotide resolution. Here, we review recent efforts pioneering the use of DRS to better understand the epitranscriptomic landscape. We highlight how DRS can be applied to investigate different RNA biotypes, emphasizing the use of specialized library preparation protocols and downstream bioinformatic workflows to detect both natural and synthetic RNA modifications. Finally, we provide a perspective on the future role of DRS in epitranscriptomic research, highlighting remaining challenges and emerging opportunities from improved sequencing yields and accuracy enabled by the latest DRS chemistry.

A comparative template-switching cDNA approach for HTS-based multiplex detection of three viruses and one viroid commonly found in apple trees

Exclusion is a keystone of integrated pest management to prevent the introduction of pathogens. U.S. plant quarantine programs employ PCR and high-throughput sequencing (HTS) to test imported plants for viruses and viroids of concern. Achieving a low limit of detection in any HTS protocol could be challenging. Following a template-switching cDNA amplification protocol, seven cDNA synthesis treatments were used to test simultaneously the relative abundance and coverage of the three most commonly latent RNA viruses found in apples: apple chlorotic leaf spot virus, apple stem grooving virus, and apple stem pitting virus, as well as the viroid apple hammerhead viroid. Amplified double-stranded cDNAs were subjected to library preparation using Nanopore SQK-DCS109 and Illumina Nextera XT, and sequenced with MinION and NextSeq2000, respectively. Treatments with oligo d(T)23-VN or its combination with random hexamers yielded the highest relative reads for viruses, while treatments containing the reverse primer pool produced more relative reads for AHVd. These treatments and random hexamers also generated the highest genome coverages, which were typically similar in both HTS workflows. However, relative abundances of viruses determined with SQK-DCS109 were up to 2.22-fold higher compared to Nextera XT. In contrast, Nextera XT yielded viroid reads 3.30-fold higher than SQK-DCS109. A framework of considerations for expanding this sensitive approach to other targets and crops is discussed.

Orthogonal-Group-Controlled Site-Selective I-Branching of Poly-N-acetyllactosamine Chains Reveals Unique Binding Specificities of Proteins towards I-Antigens.

Poly-N-acetyllactosamine (poly-LacNAc) is ubiquitously expressed on cell surface glycoconjugates, serving as the backbone of complex glycans and an extended scaffold that presents diverse glycan epitopes. The branching of poly-LacNAc, where internal galactose (Gal) residues have β1-6 linked N-acetylglucosamine (GlcNAc) attached, forms the blood group I-antigen, which is closely associated with various physiological and pathological processes including cancer progression. However, the underlying mechanisms remain unclear as many of the I-antigen sequences are undefined and inaccessible. In this study, we developed a highly efficient orthogonal-group-controlled approach to access site-selectively I-branched poly-LacNAc chains. The approach relies on three orthogonal protecting groups, each of them "caps" one internal Gal residue of poly-LacNAc. These groups can be readily "decapped" by specific enzymes or chemical reduction to expose desired sites for GCNT2-catalyzed I-branching. This approach enabled the rapid preparation of a diverse library of 41 linear and branched poly-LacNAc glycans from a single precursor. Glycan microarray analysis using these complex glycans revealed unique recognitions of I-branches by lectins, anti-I mAbs, and galectins. Surprisingly, oxidized forms of linear poly-LacNAc strongly bound to several glycan-binding proteins (GBPs). These findings help to bridge the gap in recognition of I-branching and open new avenues for therapeutic development by targeting galectins.

Aptamer selection via versatile microfluidic platforms and their diverse applications.

Aptamers are synthetic oligonucleotides that bind with high affinity and specificity to various targets, making them invaluable for diagnostics, therapeutics, and biosensing. Microfluidic platforms can improve the efficiency and scalability of aptamer selection, especially through advancements in systematic evolution of ligands by exponential enrichment (SELEX) methods. Microfluidic SELEX methods are less time-consuming and labor-intensive and include critical steps like library preparation, binding, partitioning, and amplification. This review examines the contributions of microfluidic technology to SELEX-based aptamer identification, with alternative methods like conditional SELEX, in vivo-like SELEX and Non-SELEX for selecting aptamers and also discusses critical SELEX steps over the past decade. This work also examined the integrated microfluidic systems for SELEX, highlighting innovations such as conditional SELEX and in vivo-like SELEX. These advancements provide potential solutions to existing challenges in aptamer selection using conventional SELEX, especially concerning biological samples. A trend toward non-SELEX methods was also reviewed and discussed, wherein nucleic acid amplification was eliminated to improve aptamer selection. Microfluidic platforms have demonstrated versatility not only in aptamer selection but also in various detection applications; they allow for precise control of liquid flow and have been essential in the advancement of therapeutic aptamers, facilitating accurate screening, enhancing drug delivery systems, and enabling targeted therapeutic interventions. Although advances in microfluidic technology are expected to enhance aptamer-based diagnostics, therapeutics, and biosensing, challenges still persist, especially in up-scaling microfluidic systems for various clinical applications. The advantages and limitations of integrating microfluidic platforms with aptamer development are further addressed, emphasizing areas for future research. We also present a perspective on the future of microfluidic systems and aptamer technologies, highlighting their increasing significance in healthcare and diagnostics.

Protocol for investigating intracellular microbial diversity using single-cell RNA-seq in immune cells of SARS-CoV-2-positive and recovered patients.

Intracellular microorganisms like viruses and bacteria impact immune cell function. However, detection of these microbes is challenging as the majority exist in a non-culturable state. This protocol presents detailed steps to investigate intracellular microbial diversity using single-cell RNA sequencing (scRNA-seq) in immune-cells of SARS-CoV-2-positive and recovered patients. We present a workflow from sample collection to library preparation, covering peripheral blood mononuclear cell (PBMC) isolation, single-cell labeling, cartridge priming, and cell lysis. We outline the steps for analyzing the scRNA-seq data, from data quality control (QC) to detection of intracellular microbes. For complete details on the use and execution of this protocol, please refer to Yadav etal.1.

Effectiveness of the application of a digitalized repository on the quality of graduate and post-graduate education in the field of physical medicine and rehabilitation.

During last ten years, we have developed a digital library with educational materials in Physical medicine and rehabilitation. The objective of current article is the preparation of an electronic library with educational materials in the area of physical medicine, physical therapy and rehabilitation, and the comparative evaluation of the impact of this repository on the quality of education of students and trainees in the field. The electronic library includes e-books on different topics, elements of the specialty "Physical and rehabilitation medicine (PRM)" or Physiatry - with theoretical data, practical issues and case reports with videos of real patients. From the field of basic physiatry we included: books on kinesiological and pathokinesiological analysis, functional evaluation; physiotherapy (active exercises, soft-tissue techniques), ergotherapy (activities), balneotherapy (mineral baths and peloids, underwater gymnastics), manual therapy (tractions, mobilizations, manipulations), preformed physical factors (electric currents, magnetic field, ultrasound, light, laser, etc). In special physiatry we prepared manuals on: neurological and neurosurgical rehabilitation, orthopedic and traumatologic rehabilitation, rheumatologic rehabilitation, cardiac and cardiosurgical rehabilitation, etc. The digital library has been applied to educate 1,186 learners (graduate and post-graduate studies): students in Bachelor's degree (Physiotherapy, Nursing, Midwifery, Medical assistants) and in Master's degree (Physiotherapy, Medical rehabilitation and balneology), medical doctors-residents in Physical and Rehabilitation medicine (PRM), participants in long-life learning courses (physiatrists, physiotherapists and nurses). At the end of every educational course, we collected data from the practical and theoretical exams (investigation period-from April 2020 to October 2024). Additionally, we evaluated learners' opinion using anonymous questionnaires on the usefulness of the electronic library. Comparative analysis of the results revealed significant improvement in theoretical knowledge and practical skills of students and trainees, as evidenced by online assessments, and face-to-face theoretical and practical exams. The majority of learners consider the electronic repository useful. The authors consider this electronic library (with books, manuals, video-presentations and case studies) a valuable resource in both graduate and post-graduate education within the rehabilitation field. We recommend the application of electronic repositories in the process of education of the students and trainees.

Evaluation of controls, quality control assays, and protocol optimisations for PacBio HiFi sequencing on diverse and challenging samples.

The Darwin Tree of Life (DToL) project aims to generate high-quality reference genomes for all eukaryotic organisms in Britain and Ireland. At the time of writing, PacBio HiFi reads are generated for all samples using the Sequel IIe systems by the Wellcome Sanger Institute's Scientific Operations teams, however we expect lessons from this work to apply directly to the Revio system too, as core principles of SMRT sequencing remain the same. We observed that HiFi yield is highly variable for DToL samples. We have investigated what drives this variation, and potential mitigations. To support these investigations a number of controls were evaluated to ensure that the library and sequencing preparation procedures, reagents, consumables, and Sequel IIe instruments, were performing as expected. Our findings support that a primary factor driving variability in HiFi yield is the quality of the DNA prior to library construction, e.g., purity, size, and damage. We investigated whether quality assessment assays could link measurable DNA damage or purity to sequencing yield. Some correlation could be established, however no assay was predictive of sequencing yield for all samples, indicating that the variability is driven by multiple factors that may interact. We demonstrate that contaminants present in some samples are the cause of very low HiFi yield, and show that these contaminants can negatively affect the PacBio internal sequencing control and samples multiplexed on the same SMRT Cell. We found that consistently high yields could be obtained if an amplification workflow was utilised, namely PacBio's ultra-low input library preparation protocol.