Serum PTH Levels Research Articles

ODP128 Unusually High Serum Calcium in a Patient with Familial Hypocalciuric Hypercalcemia

Abstract Background Familial hypocalciuric hypercalcemia (FHH) causes hypercalcemia via inactivating genetic mutations in the calcium-sensing receptors of parathyroid cells. FHH generally presents as a chronic, mild, asymptomatic hypercalcemia (<12mg/dL) with normal to moderately-elevated serum PTH levels. Low renal calcium/creatinine clearance ratio (CCCR) is the primary biochemical method of distinguishing FHH from primary hyperparathyroidism (PHPT). Most patients do not require treatment. Surgery is generally inappropriate as hypercalcemia persists after subtotal parathyroidectomy. Clinical Cases A 19-year-old male was admitted to the psychiatry service due to suicidal ideation. He denied taking any medications or supplements. Initial labs noted a corrected calcium of 11.6 mg/dL (ref. 8.6-10.2 mg/dL) and repeat labs verified hypercalcemia. Intact PTH level was 118.8 pg/mL (ref. 15-65 pg/mL). He denied muscle weakness, fatigue, joint pain, constipation, kidney stones, or increased thirst. After IV-fluid repletion, his calcium remained elevated. Serum calcium was measured as high as 13.1mg/dL, corrected calcium was as high as 12.5 mg/dL, and ionized calcium was 6.9 mg/dL (ref. 4.5-5.6 mg/dL). 24-hour urine calcium was 93.6 mg/24-hr and CCCR was 0.29%. A presumptive diagnosis of FHH was made, based on the elevated calcium and PTH, with CCCR < 1%. His mood improved and he was discharged by psychiatry without starting any medications. Initiation of cinacalcet was discussed, but the patient preferred not to start medication. During outpatient follow-up, he did not endorse depression or suicidal ideation. He was referred for genetic analysis to confirm FHH. Due to his significant hypercalcemia, PHPT remained in consideration. Evaluation for MEN syndromes was also performed, since these are associated with early onset PHPT. He knew limited family history. His mother had hypercalcemia and hyperparathyroidism, requiring surgery. He was uncertain of her age at diagnosis or whether she had genetic testing. He also reported a maternal half-brother with hypercalcemia and renal disease, requiring dialysis in his 30s. Repeat labs a few months after his admission showed corrected calcium of 12. 0 mg/dL, ionized calcium of 6.8 mg/dL, and CCCR of 0.30%. Thyroid ultrasound and Tc-99m Sestamibi scan did not show evidence of parathyroid adenoma(s). Genetic analysis showed a known heterozygous pathogenic variant in the CASR gene, consistent with FHH, type 1. The patient continued to deny any symptoms, including psychiatric, and did not start cinacalcet. Conclusion FHH can occasionally present with corrected calcium > 12 mg/dL and PTH >100. CCCR is essential to distinguish FHH from PHPT. Genetic analysis should be pursued in patients with a questionable diagnosis. PHPT is primarily managed with surgery, while FHH is generally not managed with surgery, so correct diagnosis is essential. Rarely, FHH patients may present with pancreatitis, chondrocalcinosis, muscle cramps, poor memory and psychosis. Calcimimetic therapy may be considered in select, symptomatic patients. Presentation: No date and time listed

Measurement of Parathyroid Hormone Level after Total Thyroidectomy in Prediction of Hypocalcaemia

Background: Parathyroid dysfunction leading to symptomatic hypocalcemia is not uncommon following a total or completion thyroidectomy and is often associated with significant patient morbidity and a prolonged hospital stay. Objectives: To investigate whether postoperative parathyroid hormone level is a parameter to identify hypocalcaemia after total thyroidectomy. Methods: This prospective longitudinal study was carried out with variety of thyroid disorders with indication of total thyroidectomy at BSMMU. Total 103 patient were selected following the inclusion and exclusion criteria. The routine clinical assessment and the preoperative laboratory investigations of the study population were performed before operation. Preoperative and postoperative levels of serum PTH and serum calcium level were measured. Results: Immediate post-operative period 17(16.50%) patients PTH level were low (<14 pg/ ml). The mean PTH in immediate post-operative was 36.79±21.71 pg/ml. Regarding the distribution of the study patients by serum calcium, it was observed that 20.39% patients belonged to low (<8 mg/dl) serum calcium. The mean serum calcium level was 8.47±1.19 (mg/dl) with ranged from 2.1 to 10.6 (mg/dl). Among the study population 11 patient developed symptomatic hypocalcemia. Most 72.7% the patient, symptomatic hypocalcemia developed after 48 hours of operation. Conclusion: Hypocalcaemia after total or completion thyroidectomy is not uncommon in our population. If we measure a single parathyroid hormone level in postoperative period that can reflect early result and help to take necessary measure to avoid hypocalcaemic effect. Low intraoperative PTH levels during thyroid surgery are therefore a feasible predictor of postoperative hypocalcemia. Sir Salimullah Med Coll J 2022; 30: 103-107

Effect of phosphate binder therapy on FGF-23 levels in dialysis patients

Introduction. Fibroblast growth factor type 23 (FGF-23) inhibits phosphate reabsorption and vitamin D hormone synthesis in the kidneys. There is a known relationship between FGF-23 levels and serum phosphate, as well as a direct correlation between hyperphosphatemia and the risk of cardiovascular events.Aim. To evaluate associations between serum FGF-23 levels and bone and mineral metabolism in patients on renal replacement therapy (RRT) with hemo- and peritoneal dialysis, receiving and not receiving phosphate binders.Materials and methods. The study included 65 patients, of which 43 received maintenance hemodialysis tratment (HD), and 22 – peritoneal dialysis (PD). The control group consisted of 28 healthy volunteers.Results. The increase in the concentration of FGF-23 in the blood serum in patients on maintenance HD correlated with the vintage of dialysis treatment (rs = 0,765; p = 0,04). The positive correlation was found between the serum concentrations of FGF-23 and inorganic phosphorus (rs = 0,54; p = 0,03). The serum level of FGF-23 positively correlated with the serum PTH level (rs = 0,5; p = 0,01). In patients receiving sevelamer carbonate levels of FGF-23 was lower, than in control group (12.4 ± 5.9, and 23 ± 7.3, respectively; p = 0.003), as well as PTH (110 ± 27 ng/mL, and 340 ± 15, respectively; p = 0.01).Conclusions. The level of FGF-23 in dialysis patients directly correlated with the serum level of PTH and “dialysis vintage”. The use of phosphate binders, in particular sevelamer carbonate, positively affects the expression of FGF-23 and PTH in dialysis patients.

PTH Serum Levels and Mortality Risk among Incident Hemodialysis Patients

Introduction: Chronic kidney disease (CKD)-mineral and bone disorder (MBD) is a major complication in hemodialysis (HD) patients. Serum intact parathyroid hormone (iPTH) has been associated with prognosis in these patients, however, the optimal range to reduce mortality remains unknown. Methods: We conducted a retrospective study of incident HD patients, who were categorized into 4 groups according to iPTH serum level: <150 pg/mL, 150-300 pg/mL, 301-600 pg/mL and >600 pg/mL. All-cause and cardiovascular mortality over a mean follow-up of 3 years was assessed using standard survival methods. Results: One hundred and forty-nine patients were included. Patients with low iPTH presented low serum albumin, phosphorus, and bonespecific alkaline phosphatase (BAP), increased c-reactive protein (CRP) and higher serum bicarbonate (p<0.05). Those with iPTH <150 pg/mL had an increased risk of all-cause and cardiovascular mortality, when compared to those with iPTH 301-600 pg/mL (HR: 0.59; 95% CI: 0.36-0.96; p=0.035) and iPTH >600 pg/mL (HR: 0.39; 95% CI: 0.20-0.78; p=0.008), even after adjusting for potential confounding factors as age, albumin, and comorbidities (diabetes, congestive heart failure (CHF), and hypertension). Discussion: PTH levels were associated with all-cause and cardiovascular mortality risk in our cohort of incident HD patients. Our results suggest that patients with low iPTH at HD initiation had an increased mortality risk, which may reflect a frail group of patients with anorexia, sarcopenia, malnutrition, and inflammation.

Efficacy and Safety of Etelcalcetide in Hemodialysis Patients with Moderate to Severe Secondary Hyperparathyroidism

Background. Secondary hyperparathyroidism (SHPT) is a major risk factor for cardiovascular events and all-cause mortality in hemodialysis (HD) patients. The purpose of our study was to evaluate the effects and tolerability of etelcalcetide in HD patients with SHPT. Methods. An observational study was conducted on 16 hemodialysis patients with SHPT treated with etelcalcetide. All patients were followed up for a duration of 6 months. The primary endpoints were the reduction in mean PTH ≥ 30% and ≥40% from baseline after 6 months of etelcalcetide. All patients were divided into two groups (group A versus group B) based on baseline serum PTH level prior to etelcalcetide: above and below the median serum PTH (1300 pg/mL), respectively. Results. After 6 months, a significant decrease in PTH levels was achieved by all patients receiving etelcalcetide (p = 0.015). Both primary endpoint of reduction in PTH ≥ 40% at 6 months (p = 0.01), and the secondary endpoint of reduction in median PTH values (p = 0.0001) and median percentage reduction in PTH values (p = 0.009) were significantly achieved in group A. In contrast, a greater decline of calcium (p = 0.028) and phosphorus was reached in group B than group A. Dialysis vintage ≥ 36 months, arteriovenous fistula (AVF)-based hemodialysis, post-diluition hemodiafiltration (HDF) method, and baseline values of PTH < 1300 pg/mL can positively influence the achievement of the endpoints. Furthermore, the baseline PTH < 1300 pg/mL, among these variables, was the only one showing statistically significant relevance (OR 2.28, 95% CI 1.32–3.96, p = 0.015). The history of cinacalcet use negatively correlated with the possibility to reach therapeutic targets with etelcalcetide (OR 0.47, 95% CI 0.26–0.85, p = 0.031). Treatment with etelcalcetide was well tolerated and no adverse effects were observed. Conclusions. In our study, patients with low baseline PTH levels showed a better response to etelcalcetide than patients with higher PTH levels. Consequently, the possibility to reach desirable therapeutic targets could depend on SHPT severity at the time of initiation of therapy.

412.7: Pre-transplant Hyperparathyroidism and Adverse Posttransplant Outcomes in Kidney Transplant Recipients

Introduction: Whether correction of severe hyperparathyroidism (HPT) is required before kidney transplantation is subject of debate, as previous studies investigating the impact of pretransplant HPT on graft and patient outcomes showed conflicting results. We aimed to assess whether pretransplant serum PTH levels are associated with the risk of delayed graft function (DGF), death censored graft failure (DCGF), or mortality. Additionally, we focused on a subgroup of patients with very high pre-transplant PTH levels (≥81 pmol/L; ≥764 pg/mL). Methods: We performed a single-center cohort study including patients who underwent kidney transplantation between 1986 and 2020. Donor and recipient demographic data, medical information and routine laboratory measurements were extracted from the local transplant registry. We performed multivariable logistic regression and Cox regression analyses to study associations between PTH and DGF (persisting dialysis requirement for up to 7 days post-transplant), DCGF (return to dialysis or re-transplantation), or all-cause mortality, respectively. We also compared these outcomes for patients in the highest vs. lowest PTH decile for each endpoint. Results: A total of 1576 kidney transplant recipients (KTRs) (51.6 ± 14.0 years-old, 42.7% male) were included. Donor age was 51.2 ± 13.5 years, 785 (49.8%) patients received a graft from a living donor, and 535 (33.9%) patients underwent a pre-emptive transplantation. Median (IQR) pretransplant serum PTH concentration was 24.3 (12.8 – 44.6) pmol/L. Corrected calcium increased while PTH and corrected phosphate decreased within the first 3 months post-transplant, even in patients with pre-transplant PTH >81 pmol/L (Figure 1A-C). Pre-transplant PTH was not associated with DGF (Table 1). During median follow-up of 5.0 (2.2 – 8.4) years, 201 (12.8%) patients developed DCGF. In fully adjusted Cox regression analyses, PTH was not associated with DCGF (Table 1). Additionally, patients with PTH >81 pmol/L (N=121) did not have an increased risk of DGF (HR 1.67 [95% CI 0.62 – 4.55], P=0.65) or DCGF (HR 0.86 [95% CI 0.47 – 1.61], P=0.65), compared with those in the lowest PTH decile. During median follow-up of 5.2 (2.9 – 9.0) years, 474 (30.1%) patients deceased. In age- and sex-adjusted analyses, a higher serum PTH was associated with an increased risk of all-cause mortality, but this association lost significance upon multivariable adjustment (Table 1). When comparing KTRs with PTH levels in the highest vs. lowest decile, there was also no association with mortality (HR 0.96 [95% CI 0.62 – 1.48], P=0.65). Conclusion: In this cohort study, pre-transplant serum PTH was not associated with an increased risk of DGF, DCGF or mortality after transplantation. Subgroup analyses in patients with severe HPT yielded similar results. Our data do not support the requirement of pre-transplant parathyroidectomy in patients with (severe) hyperparathyroidism to improve graft or patient survival.

Sonographic evaluation of subclinical entheseal involvement in patients with hypoparathyroidism: a case control study.

Hypoparathyroidism is a disease characterized by low serum calcium, increased serum phosphorus and low PTH levels. Although patients are treated with active vitamin D and calcium, a proper serum calcium phosphorus balance cannot always be achieved. Ectopic calcifications that develop in organs during treatment are the most common complications. To date, there is not any published study on enthesopathy in patients with hypoparathyroidism. The aim of this study was to evaluate subclinical enthesopathy in patients with hypoparathyroidism with ultrasound and to compare the results with those of the control group. The study included patients aged 18-65years with postoperative hypoparathyroidism and hypothyroidism (group hypoP + hypoT), patients with postoperative hypothyroidism (group hypoT), and healthy age and sex-matched volunteers (group C). Ultrasonographic findings of enthesopathy in both extremities were documented according to the Glasgow Ultrasound Enthesitis Scoring System (GUESS). GUESS scores in group hypoP + hypoT, were significantly higher when compared to the other groups. There was a statistically significant correlation between the total GUESS scores and total enthesophyte scores and the duration of hypoparathyroidism (p < 0.05, r = 0.43) (p < 0.05, r = 0.39) respectively. In the correlation analysis of all groups, a significant negative correlation was found between serum Ca and PTH levels and the total GUESS scores (p < 0.01, r = -0.37; p < 0.01, r = -0.54, respectively). This study showed that GUESS scores were significantly higher in patients with hypoparathyroidism compared to those with hypothyroidism and control subjects. GUESS scores were positively correlated with disease duration. Patients with hypoparathyroidism need to be evaluated for subclinical enthesopathy during follow-up.

Osteoporosis and Related Health Status Among the Elderly Urban Residents in Elderly-Care Inns in Beijing, a Multicenter DXA Survey.

BackgroundIdentification of the high risk population for osteoporosis and timely prevention are the best strategies at present. Detailed epidemiological investigation in a well-defined population is necessary to explore the population-based characteristics and risk factors of osteoporosis, thus to facilitate better prevention programs.MethodIn this prospective cross-sectional study, 1423 questionnaires were given out to the urban residents (female ≥ 40 years of age, male ≥50 years) who lived in the 27 Elderly-Care Inns interspersed among the seven central urban areas of Beijing. All participants were voluntary and underwent routine physical examination and spine and hip BMD measurements using the DXA instrument. The study protocols were approved by the Medical Ethics Committee of Dongzhimen Hospital, Beijing University of Chinese Medicine (JDZX2015079).ResultsAltogether 1407 participants fulfilled the survey. Among 359 men, the prevalence of osteoporosis, osteopenia, and normal BMD were 18.1%, 56.6%, and 25.3%, respectively; among 1048 women, the corresponding figures were 40.3%, 42.8%, and 16.9%, respectively. After adjustment of age and BMI, both hands grip strength, height loss over 3 cm, serum levels of β-CTx, PINP, and OST were the independent risk factors for osteoporosis in both men and women; besides, familial Alzheimer’s disease history in men; and history of steatohepatitis and fracture, serum levels of PTH and ALT, age of menarche, age of menopause, and duration of menstruation in women were also risk factors of osteoporosis. In both genders, the cost-effective method, which adopted both hands grip strength, height loss over 3 cm, and medical history, indicated a good predictive ability to evaluate the risk of osteoporosis (in men AUC=0.730, 95%CI=0.642~0.817; in women AUC=0.769, 95%CI=0.724~0.813).ConclusionsIn the population of elderly Beijing urban residents in Elderly-Care Inns, the prevalence of osteoporosis in women is higher than that in men and increases with aging more rapidly; the prevalence of osteopenia in men is higher than in women. The cost-effective method, including both hands grip strength, height loss over 3 cm, and familial Alzheimer’s disease history in men; fracture and steatohepatitis history as well as menstrual history in women is recommended in identifying the high-risk subjects for osteoporosis.

Effects of Calcium Lactate-Enriched Pumpkin on Calcium Status in Ovariectomized Rats.

This study aimed to evaluate the effects of enriched pumpkin on calcium status in ovariectomized rats. The study was conducted in sixty female Wistar rats, which were divided into six groups: a group fed a standard diet (C) and five ovariectomized groups fed a standard diet (OVX_C) or a diet with calcium lactate (CaL), with calcium lactate-enriched pumpkin (P_CaL), with calcium lactate and alendronate (CaL_B), or with calcium lactate-enriched pumpkin with alendronate (P_CaL_B). After 12 weeks of the intervention, the rats were sacrificed, and their blood and tissues were collected. The calcium concentrations in serum and in tissues were measured using flame atomic absorption spectrometry (AAS). Serum concentrations of procollagen type-1 amino-terminal propeptide (PINP), parathyroid hormone PTH, estrogen (ES), and osteocalcin (OC) were determined with enzyme-linked immunosorbent assay (ELISA). It was found that enriched pumpkin increased the calcium level in the kidneys (194.13 ± 41.01 mg) compared to the C (87.88 ± 12.42 mg) and OVX_C (79.29 ± 7.66 mg) groups. The addition of alendronate increased the calcium level in the femurs (267.63 ± 23.63 mg) and more than six times in the kidneys (541.33 ± 62.91 mg) compared to the OVX_C group (234.53 ± 21.67 mg and 87.88 ± 12.42 mg, respectively). We found that the CaL, P_CaL, and CaL_B groups had significantly lower PINP serum concentrations (4.45 ± 0.82 ng/mL, 4.14 ± 0.69 ng/mL, and 3.77 ± 0.33 ng/mL) and higher PTH serum levels (3.39 ± 0.54 ng/dL, 3.38 ± 0.57 ng/dL, and 3.47 ± 0.28 ng/dL) than the OVX_C group (4.69 ± 0.82 ng/mL and 2.59 ± 0.45 ng/dL, respectively). In conclusion, pumpkin enriched with calcium lactate affects calcium status and normalizes PINP and PTH serum levels in ovariectomized rats. Diet with enriched pumpkin and alendronate increase calcium concentration in the femur. Enriched pumpkin causes calcium to accumulate in the kidneys of ovariectomized rats; alendronate significantly exacerbates this effect.

Serum Endocan Levels and Subclinical Atherosclerosis in Patients with Chronic Kidney and End-Stage Renal Diseases.

Background and AimChronic kidney disease (CKD) and its final stage: end-stage renal disease (ESRD), are common clinical conditions. Endocan is a human endothelial cell-specific molecule produced by endothelial cells. Its production is related to activation of endothelium and angiogenesis. In this study, we assessed the relation between serum endocan levels and subclinical atherosclerosis (SCA) in CKD and hemodialysis (HD) patients.Subjects and MethodsThe present case control study enrolled 30 patients on regular HD for at least 6 months, 30 patients with CKD, and 30 age and sex-matched healthy controls. All participants were subjected to careful history taking and thorough clinical examination. Laboratory investigations included complete blood count, kidney functions, and serum cholesterol, triglycerides, calcium, phosphorus, albumin, PTH, hsCRP, and endocan levels.Results HD and CKD groups had significantly higher endocan levels when compared with control group (median (IQR): 519.0 (202.3–742.0) versus 409.0 (245.3–505.3) and 273.0 (168.0–395.5) ng/L, respectively). Also, HD patients had significantly higher endocan levels when compared with CKD levels. HD patients had significantly higher carotid intima-media thickness (CIMT) when compared with CKD patients (median (IQR): 0.80 (0.80–0.90) versus 0.75 (0.73–0.75) mm, p < 0.001). HD patients had significantly higher frequency of SCA when compared with CKD patients (46.7% versus 13.3%, p=0.005). Patients with SCA had significantly higher hsCRP (median (IQR): 36.5 (26.8–43.5) versus 24.0 (15.8–29.0) mg/dl) and endocan levels (697.0 (528.3–974.8) versus 222.5 (158.8–565.8) ng/L) when compared with patients without SCA. ROC curve analysis of endocan for identification of SCA in HD patients showed that at a cutoff of 380.5 ng/L, endocan has an AUC of 0.862 with a sensitivity and specificity of 92.9% and 68.7%, respectively. Conclusions Serum endocan levels are related to SCA in HD patients. In addition, it is associated with the hyperinflammatory state in those patients.

Comparison between MIBI-based radiopharmaceuticals for parathyroid scintigraphy: quantitative evaluation and correlation with clinical-laboratory parameters.

Parathyroid scintigraphy is mandatory for the identification of hyperfunctioning parathyroid glands in hyperparathyroidism (HPT). The use of 99mTc-methoxy-isobutyl-isonitrile (MIBI) as radiopharmaceutical for parathyroid scintigraphy is considered the most valid and useful considering its uptake mechanism. Several MIBI-based radiopharmaceuticals are commercially available (i.e., MediMIBI, TechneMIBI, Stamicis). They seem to have similar physico-chemical characteristics and the choice between them is based on commercial criteria, even though some differences in qualitative scintigraphic results have been appreciated. Aims of the study were: first, to compare the scintigraphic quantitative data of MediMIBI, TechneMIBI, and Stamicis, particularly in the view of a personalized medicine approach; second, to investigate the potential effect of clinical-laboratory data on image quality using one of these radiopharmaceuticals. Patients with diagnosis of HPT, who underwent a parathyroid scintigraphy using one of the three MIBI-based radiopharmaceuticals between December 2018 and October 2020, have been retrospectively identified. Parameters derived from regions of interest (ROIs) drawn on three different sites were obtained: a reasonable parathyroid lesion detected, an area in the lateral neck considered as the background, and the hepatic dome as the site of MIBI physiological uptake. Laboratory and clinical data, such as serum calcium, PTH, vitamin D, and creatinine levels, as well as possible drug-mediated interferences were considered. Among 250 patients included, 83 (33.2%) had the parathyroid scintigraphy using MediMIBI, 84 (33.6%) using TechneMIBI and 83 (33.2%) using Stamicis. The ROIs on the parathyroid uptake at early images, on the background, and on the hepatic dome were statistically different among the three groups (p < 0.05). No significant differences were found in the remaining semi-quantitative parameters among the three groups, not even considering clinical-laboratory data. Some differences in semi-quantitative parameters emerged among MIBI-based radiopharmaceuticals for parathyroid scintigraphy. This might justify the different qualitative scintigraphic results obtained using one or another of the cited radiopharmaceuticals.

Semptomatik veya asemptomatik primer hiperparatiroidisi olan hastaların biyokimyasal parametreleri ile CDKN1B mutasyon analizi tayini

Amaç: Bu çalışmada semptomatik ve asemptomatik primer hiperparatiroidi (PHPT) olgularını karşılaştırmayı amaçladık, beraberinde sporadik saptanan paratiroid adenomlarında etyopatogenezde CDKN1B mutasyonu varlılığını saptamaya çalıştık. &#x0D; Gereç ve Yöntem: Çalışmamıza kliniğimize başvuran 80 PHPT (66 K ve 14 E, ortalama yaş 50.8 ± 12.01 yıl) tanısı almış hasta dahil edilmiştir. Hastaların yaş, cinsiyet, biyokimyasal parametreleri, görüntüleme yöntemleri (nükleer sintigrafi, ultrasonografi, kemik dansitometre ölçümü) kayıt edilmiştir. CDKN1B gen sekanslaması için GeneMATRIX Quick Blood DNA Purification kiti kullanılarak DNA izole edilmiştir. CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) ve CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) primerleri seçilerek mutasyon analizi yapılmıştır.&#x0D; Bulgular: Çalışma sonucunda 22 hasta asemptomatik PHPT olarak tanımlanmış olup semptomatik PHPT (n=68) serum kalsiyum parametreleri ve 24 saatlik idrar Ca+ atılımı daha yüksek olarak saptanmıştır. Serum Parathormon (PTH) değerleri her iki grupta da benzerdi. Her iki grupta da CDKN1B mutasyonu açısından patolojik bir bulgu saptanmamıştır.&#x0D; Sonuç: Parathormon seviyeleri semptomatik veya asemptomatik PHPT olgularında belirleyici bir parametre olmamakla birlikte semptomatik PHPT da serum kalsiyum değerleri ve 24 saatlik idrar Ca+ atılımı daha belirgindir.

High phosphate intake induces bone loss in nephrectomized thalassemic mice.

Although patients with either β-thalassemia or chronic kidney disease (CKD) clinically correlate with severe osteoporosis, the mechanism by which CKD exposed to high phosphate affects bone turnover has not been characterized in β-thalassemia. We aimed to determine the effects of renal insufficiency on high phosphate intake induced changes in bone metabolism after 5/6th nephrectomy in hemizygous β-globin knockout (BKO) mice. Male BKO mice manifested severe anemia and osteopenia. Nephrectomy induced renal fibrosis and reduced renal function as assessed by increased serum urea nitrogen levels. Moreover, nephrectomy increased bone turnover leading to bone loss in wild type (WT) but not BKO mice. In nephrectomized BKO, PBS in drinking water induced hyperphosphatemia, and hypercalcemia along with osteopenia in both cancellous and cortical bone. Histomorphometric analysis confirmed reduced cancellous bone volume due to decreased bone formation rate, osteoblast number and osteoclast number. The mRNA levels for Alpl, Sp7, Kl, Tnfsf11, and Tnfsf11/Tnfrsf11b were decreased in nephrectomized BKO mice drinking PBS. Interestingly, Fgf23, a bone-derived hormone produced by osteocytes and osteoblasts in response to hyperphosphatemia, were remarkably increased in nephrectomized BKO mice following PBS intake. Serum FGF23 and erythropoietin levels were markedly elevated in BKO mice. Nephrectomy decreased serum erythropoietin but not FGF23 levels. Hyperphosphatemia in BKO mice increased serum erythropoietin, FGF23, and PTH levels, nominating these factors as candidate mediators of bone loss in thalassemic mice with CKD during phosphate retention.

FGF23 levels as a marker of physical performance and falls in community-dwelling very old individuals.

The fibroblast growth factor 23 (FGF23) has been related to biological aging, but data in elderly individuals are scant. We determined the profile of serum FGF23 levels in a population of very-old individuals and studied their correlations with parameters of bone metabolism and health markers, as functional performance. This cross-sectional study was performed on 182 community dwellers aged ≥ 80 years. Serum levels of FGF23, PTH, calcium, albumin, phosphorus, creatinine, bone markers, and bone mineral density data were analyzed. Physical performance was evaluated with the stationary march (Step), Flamingo, and functional reach tests, along with questionnaires to assess falls and fractures in the previous year, energy expenditure (MET), and the Charlson index (CI). Physical activity was evaluated with the International Physical Activity Questionnaire (IPAQ). Most participants (75%) had FGF23 levels between 30-120 RU/mL (range: 6.0-3,170.0 RU/mL). FGF23 levels correlated with estimated glomerular filtration rate (eGFR; r = -0.335; p = 0.001) and PTH (r = 0.318; p < 0.0001). Individuals with FGF23 in the highest tertile had more falls in the previous year (p = 0.032), worse performance in the Flamingo (p = 0.009) and Step (p < 0.001) tests, worse CI (p = 0.009) and a trend toward sedentary lifestyle (p = 0.056). On multiple regression, FGF23 tertiles remained significant, independently of eGFR, for falls in the previous year, performance in the Flamingo and stationary march tests, lean mass index, and IPAQ classification. In a population of very elderly individuals, FGF23 levels were inversely associated with neuromuscular and functional performances. Higher concentrations were related to more falls, lower muscle strength and aerobic capacity, and poorer balance, regardless of renal function, suggesting a potentially deleterious role of high FGF23 concentrations in musculoskeletal health.

Is preoperative parathyroid localization necessary for tertiary hyperparathyroidism?

BackgroundThe role of preoperative parathyroid localization for tertiary hyperparathyroidism(tHPT) is unclear. We reviewed our experience regarding the feasibility of parathyroidectomy without preoperative localization. MethodsThis is a retrospective study of renal allograft recipients who underwent parathyroidectomies (2001–2019). Patients with normal preoperative serum calcium and PTH levels or previous cervical operations were excluded. Patient demographics, laboratory results, radiology reports, pathology reports, and clinical notes were reviewed. Wilcoxon signed rank test, Mann-Whitney U test, Fisher's exact and Pearson chi-square analysis were used to compare patients with and without preoperative localization. ResultsOf the 118 patients, 25 patients(21.1%) had preoperative localization. Of the 36 ectopic glands recovered, 31(86.1%) were found without preoperative localization. All 118 patients achieved normocalcemia at the time these data were collected. There were no differences in surgical cure rate, recurrence rate, temporary hoarseness, or postoperative symptomatic hypocalcemia between the two groups. ConclusionsWe observed no differences in surgical cure rate, reoperation rate, or postoperative complications without preoperative localization. Under most circumstances, it is appropriate to perform parathyroidectomy for tHPT without localization.

Serum PTH Associated with Malnutrition Determined by Bioelectrical Impedance Technology in Chronic Kidney Disease Patients.

Purpose Chronic malnutrition and cachexia are common in chronic kidney disease (CKD), and importance should be given to these complications because they affect the patient's quality of life and prognosis. This study analyzed the correlation between the serum PTH level, nutritional status, and body composition of patients with CKD. Methods CKD patients were enrolled in Center for Kidney Disease, Second Affiliated Hospital of Nanjing Medical University, from December 1, 2016, to November 30, 2020. Bioelectrical impedance technology was applied to estimate the body composition. The characteristics of the body composition were compared among different stages of CKD patients, and then the correlation between PTH and body composition was analyzed. Results 205 CKD patients were enrolled. Twenty-five patients were in stage 1 or 2 of CKD, 78 patients were in stage 3 or 4, 31 patients were in stage 5 without dialysis (referred to as CKD stage 5A), and 71 patients were in stage 5 with dialysis (referred to as CKD stage 5B). Body composition analysis showed that the patients had a phase angle (PA) of 5.02 ± 1.07°, a percentage of body fat (PBF) of 27.74 ± 8.8%, and a skeletal muscle mass index (SMI) of 7.4 ± 1.34 kg/m2. PBF peaked in the CKD stage 3/4 group and gradually decreased with the progression of CKD. The PA and SMI differed significantly between the CKD stage 1/2 and stage 5B groups. The proportion of low SMI did not differ significantly between the CKD stage 1/2 and stage 3/4 groups, but it was obviously higher in the CKD stage 5A and 5B groups. PTH was significantly correlated with BMI, hemoglobin, albumin, total cholesterol, triglycerides, and SMI. Binary logistic regression of low SMI showed that the odds ratio for PTH levels was greater than the upper limit of the normal range, which was 11.769 (p=0.043, 95% confidence interval: 1.078–128.536), and the model predictive power was 0.986 after correction for age, sex, height, weight, hemoglobin, serum calcium, serum phosphorus, serum total cholesterol, serum triglyceride, and basal metabolic rate. Conclusions Bioelectrical impedance analysis might be useful in estimating the nutritional status of CKD patients in terms of fat and muscle parameters. High levels of PTH are an independent risk factor for developing low SMI in CKD patients.

MO451: The Usefulness of Calcium/Magnesium Ratio in the Risk Stratification of Early Onset of Renal Replacement Therapy

Abstract BACKGROUND AND AIMS Recently, a growing number of studies have reported a close relationship between high serum calcium and low serum magnesium with vascular calcification. Endothelial dysfunction and vascular inflammation seem plausible risk factors for enhanced progression of kidney disease nevertheless, the knowledge remains scarce. The aim of this study is to evaluate the role of the calcium/magnesium ratio as a risk factor in CKD progression. METHOD Observational, prospective study involving 693 patients (f = 371, m = 322) with stage 4 and 5 CKD. Patients were divided into two groups, according to the development of end-stage renal disease (ESRD): G1 (n = 541), who did not undergo renal replacement therapy and G2 (n = 152), who had started renal replacement therapy (RRT). Several laboratory parameters were measured: haemoglobin, eGFR (MDRD), albumin, cholesterol, magnesium and mineral metabolism markers (PTH, calcium and phosphorus). Baseline characteristics were analysed and compared using Student%u2019s T-test for continuous variables and chi-squared test for categorical variables. Multivariate Cox regression analysis was used to identify independent factors associated with RRT initiation. A modified Poisson regression with robust error variance was used to estimate the cumulative relative risk for RRT initiation. RESULTS The mean age and estimated glomerular filtration rate (eGFR) of the study population was 70.09 ± 12.51 years and 19.91 ± 8.11 mL/min, respectively. Comparing the two groups, G2 had a significantly lower serum levels of Hb (11.75 versus 10.95 g/dL, P = 0.000), calcium (9.34 versus 8.95 mg/dL, P = 0.000), magnesium (1.92 versus 1.40 mg/dL, P = 0.0001), albumin (4.00 versus 3.88 g/dL, P = 0.03) and cholesterol (183.17 versus 172.39 mg/dL, P = 0.01) and a higher serum levels of phosphorus (3.88 versus 4.69 mg/dL, P = 0.0001), calcium/magnesium ratio (5.73 versus 7.56, P = 0.0001) and PTH (209.71 versus 338.84 pg/mL, P = 0.0001). In univariate Cox regression analysis, age, haemoglobin, eGFR, calcium, magnesium, phosphorus, calcium-magnesium ratio and PTH correlate with onset of RRT, which were further tested using a multivariate COX regression model. The results showed a clear relationship between high levels of phosphorus (HRa = 1.638, P = 0.001) and calcium-magnesium ratio (HRa = 1.292; P = 0.002), and low levels of magnesium (HRa = 0.761, P = 0.005) and eGFR (HRa = 0.934; P = 0.0001) were independent risk factors to start depurative techniques. Additionally, Poisson regression analysis showed that high calcium-magnesium ratios (aPR = 1.986; 95% CI 1.026–3.051; P = 0.002), high phosphorus levels (aPR = 1.607; 95% CI 1.324–1.950; P &amp;lt; 0.0001) and low levels eGFR (aPR = 0.927; 95% CI 0.891–0.964; P &amp;lt; 0.0001) were associated with a cumulative risk for initiation of RRT. CONCLUSION Our results suggest that the calcium/magnesium ratio is an independent predictive factor for the initiation of renal replacement therapy. Further studies are required to validate the use of this novel marker as a predictor of CKD progression.

MO811: A Closed Loop Audit of CKD-MBD Parameters in Patients Receiving Home Haemodialysis in North West London Centre

Abstract BACKGROUND AND AIMS Hyperphosphatemia is common in end-stage renal disease and increases the risk of fractures, cardiovascular disease and all-cause mortality. Achieving normal phosphate levels is dependent on optimization of dialysis, diet and phosphate medication. Home haemodialysis (HHD) offers exciting opportunities for individualised approaches to management, allowing for a more liberal, lifestyle-centred patient experience. Our aim was to determine, in line with the UK Renal Association 2015 standards for Chronic Kidney Disease—Mineral Bone Disease (CKD-MBD), the percentage of patients in the North West London HHD program with: METHOD We conducted a retrospective review of the six most recent monthly biochemistry results for serum phosphate, corrected calcium and PTH levels of all patients actively receiving HHD under the care of Hammersmith Hospital (n = 33) between January and September 2020. Subsequently, a monthly multidisciplinary review of blood tests (with nephrologists, specialist nurses and dieticians) focusing on CKD-MBD parameters was implemented to facilitate timely prescription changes. Additionally, two questionnaires were conducted: (1) an adapted Basel Assessment of Adherence to Immunosuppressive Medications Scale (BAASIS) questionnaire assessed adherence with phosphate binders and (2) a diet questionnaire assessed dietary phosphate knowledge. At the end of 12 months, a re-audit was conducted in the patients from the original cohort (n = 23; following 4 transplants, 3 in-centre transitions and 3 deaths). RESULTS The initial audit revealed that of the 33 included patients, 14 (42%) recorded all bone parameters within the target range. Examining CKD-MBD parameters individually, 27 (82%) had adjusted calcium within target range [4 (12%) &amp;lt; 2.2 mmol/L and 1 (3%) &amp;gt; 2.6 mmol/L], 22 (66%) had a serum PTH in target range [9 (27%) &amp;gt; 9× ULN and 2 (8%) &amp;lt; 2× ULN, excluding those with parathyroidectomies] and 17 (51%) recorded a median serum phosphate within target [11 (33%) &amp;gt; 1.7 mmol/L and 5 (15%) &amp;lt;1.1 mmol/L]. Table 1 summarizes baseline demographics of the final audit group (n = 23). Re-audit after 12 months revealed 10 (43%) recorded all bone parameters within the target range. Examining CKD-MBD parameters individually, PTH targets had improved (from 66% to 83%). This was associated with increased use of calcimimetics, with 3 (17%) recording PTH &amp;gt; 9× ULN [from 9 (27%) at baseline]. However, there was no significant change in phosphate [12 (54%) within the target range, 7 (29%) above the range] and calcium [18 (78%) within the target range]. Of the 23 patients included for final analysis, 15 (65%) were actively prescribed phosphate binders. The BAASIS questionnaire revealed notable non-adherence, with 8 (53%) admitting to having missed doses in the last month, 5 (33%) consistently missing &amp;gt;4 doses and 6 (40%) not consuming alongside meals. Additionally, the dietary questionnaire revealed a lack of knowledge of hidden sources of dietary phosphate in all surveyed patients (n = 11 responses). CONCLUSION Based on UK Renal Association 2015 standards for CKD-MBD, in patients undergoing HHD:

Evaluation of the Early Results of Percutaneous Ethanol Ablation in Patients with Primary Hyperparathyroidism

Abstract Percutaneous ethanol ablation (PEA) is an alternative non-surgical method for the treatment of patients with primary hyperparathyroidism (PHPT), suitable in cases with comorbidities and high surgical risk. The aim of the present study was to evaluate the results of PEA in patients with PHPT at the early stages of follow-up. Materials and methods: The study included 35 patients (30 women and 5 men, mean age 59.7 ± 12.4 years) with biochemical and hormonal data of PHPT and localized parathyroid adenoma (PTA) by ultrasound, nuclear scan, FNB with cytology and evaluation of PTH in the needle washout. All patients were at high surgical risk or refused surgical treatment. PEA was applied and changes in the PTA volume and calcium-phosphate metabolism were monitored at the third (M3) and sixth (M6) months after the procedure. Results: Normocalcaemia was achieved in 26 patients (74.3%) at M3 and persisted at M6 in 22 of them. A second course of PEA was administered in 11 patients with persistent hypercalcaemia at M3 and M6, respectively. Compared to the baseline, the mean PTA volume decreased significantly by 53% at M3 and 67% at M6 (p &lt; 0.001). Side effects including local pain, edema and dysphonia were observed in 5 patients (14.3%). Conclusion: PEA is an efficient and safe treatment modality for the management of PHPT. A significant reduction in PTA volume and a normalization of serum calcium and PTH levels were observed at the early stages of follow-up.

Regulation of Calcium Homeostasis in Acute Kidney Injury: A Prospective Observational Study.

BackgroundMaintaining homeostasis is an integral part of all physiological processes both in health and disease including critically ill patients and may impact clinical outcomes. The present study was designed to assess prevalence of serum calcium, phosphate, vitamin-D3, FGF-23, and PTH levels abnormalities in AKI.Patients and methodsSingle-center, prospective, observational study in a tertiary care hospital. Patients meeting KDIGO criteria for AKI were included. Paired blood samples were drawn from eligible patients—first sample within 24 hours of AKI diagnosis and second after 5 days or at time of hospital discharge, whichever was earlier for measuring serum calcium (albumin corrected), phosphate, PTH, 25(OH)Vit-D, and FGF-23 levels. Clinical outcomes analyzed included survival status, utilization of RRT, and hospital stay.ResultsOf the 50 patients with AKI, about three-fourths were males. Mean age of the participants was 57.32 ± 11.47 years. Around half of patients had hypocalcemia and four-fifths had low serum phosphate. Nearly 82% had low 25(OH)Vit-D and 52% cases had high PTH level. Patients who underwent RRT had numerically higher but not significant serum calcium and PTH levels. FGF-23 levels (pg/mL) were significantly higher in patients on RRT (81.70 ± 17.30 vs non-RRT, 72.43 ± 20.27, p = 0.049), nonsurvivors (87.96 ± 18.82 vs survivors 57.11 ± 15.19, p = 0.045), and those hospitalized for time of stay above median (109.67 ± 26.97 vs below median 70.27 ± 20.43, p = 0.046). Among all the bone and mineral parameters analyzed high FGF23 levels were consistently linked with poor clinical outcomes in AKI.ConclusionThe present study found high prevalence of calcium and phosphate disorders in AKI with dysregulated phosphate homeostasis as evidenced from elevated FGF-23 levels linked with morbidity and mortality in AKI.How to cite this articleSingh NP, Panwar V, Aggarwal NP, Chhabra SK, Gupta AK, Ganguli A. Regulation of Calcium Homeostasis in Acute Kidney Injury: A Prospective Observational Study. Indian J Crit Care Med 2022;26(3):302–306.