Cucumber Leaf Spot Research Articles

In‐vitro and in‐vivo assessment of biological control potential of nematode symbiont Xenorhabdus nematophila against Pseudomonas syringae, the causative agent of angular leaf spot of cucumber

AbstractBacterial diseases cause colossal losses in vegetable crops and are considered major limiting factors for the commercial production of vegetables around the globe. Among bacterial diseases, angular leaf spot of cucumber caused by Pseudomonas syringae is one of the most economically important diseases that cause substantial economic loss to the cucumber crop. In this study, the in‐vitro and in‐vivo effects of different strains (X1–X15) of the nematode symbiotic bacterium Xenorhabdus nematophila was determined on the growth of P. syringae in different selected media (TB, SB, SOB, SOC, YT and LB) and at different pH levels (6.5, 7.5 and 8.5) and on the incidence of angular leaf spot disease on potted cucumber plants. According to the results, maximum growth inhibition of P. syringe (25 mm) was observed in the case of strain X12, followed by strains X10 (23 mm), X8 (21 mm) and X6 (20 mm), while maximum colony growth was observed in the control. Moreover, this P. syringae growth inhibition by the X12 strain of X. nematophila was significantly maximum in SB medium and at pH 7.5. Results of the in‐vivo experiment with potted plants showed a maximum incidence (90%) of angular leaf spot disease in control plants, while a minimum disease incidence (15%) was observed for the plants treated with two times dilution of X. nematophila culture, followed by ten times (23%) and fifty times (35%). The overall results of this study demonstrate the inhibitory effect of X. nematophila on the growth and incidence of P. syringae and underscore its putative role in the biological management of plant pathogenic bacteria.

Leaf spot on cucumber caused by Stemphylium vesicarium newly reported in China

Leaf spot is one of the common diseases of Cucurbitaceae crops, including cucumber, muskmelon, and pumpkin. Between August and October 2021, cucumber leaves exhibiting disease symptoms were observed in farmland around Qingdao city, Shandong province. The corresponding diseased leaves were collected to isolate and characterize the causal agent of cucumber leaf spot. Multilocus phylogenetic analysis (internal transcribed spacer regions 1 and 2 and intervening 5.8S nrDNA, calmodulin, and glyceraldehyde-3-phosphate dehydrogenase) and morphological characteristics revealed that the fungal isolates belonged to Stemphylium vesicarium. The symptoms of brown to black lesions appeared on all artificially inoculated cucumber leaves, which were highly similar to those observed in the field. The pathogen was re-isolated from the corresponding diseased leaves to fulfill Koch's postulates. Therefore, S. vesicarium was confirmed as the pathogen of cucumber leaf spot in this study. To our knowledge, this is the first report of S. vesicarium causing leaf spot on cucumber in China.

A Rapid Molecular Detection System for Sdh Mutations Conferring Differential Succinate Dehydrogenase Inhibitor Resistance in Corynespora cassiicola.

Cucumber leaf spot, caused by Corynespora cassiicola, is a serious disease of cucumbers in greenhouses. Due to the frequent application of SDHIs, resistance caused by point mutations in the SDHB/C/D gene has been reported. Different mutations lead to different resistance levels, and mutations vary over time and regions. This means that it is necessary to know the type of mutation in the field to select the appropriate SDHIs. Here, the sensitivity of mutations to SDHIs was determined, and 8 resistance patterns were obtained: pattern I (BosVHR, FluoMR, PenHR, CarR); pattern II (BosMR, FluoSS, PenS, CarS); pattern Ⅲ (BosVHR, FluoSS, PenLR, CarS); pattern Ⅳ (BosLR, FluoLR, PenS, CarR); pattern Ⅴ (BosMR, FluoLR, PenS, CarS); pattern Ⅵ (BosMR, FluoLR, PenLR, CarS); pattern Ⅶ (BosVHR, FluoHR, PenHR, CarS); and pattern Ⅷ (BosLR, FluoLR, PenLR, CarS). We successfully established 9 AS-PCR assays that can detect mutation types. The sensitivity and specificity of AS-PCR were also determined. The sensitivity results showed that most of the detection thresholds of the AS-PCR assays were 100 pg/µL, while the AS-PCR assay of the B-H278R and D-G109V mutations exhibited high sensitivity, with 10 pg/µL. To validate the use of the developed AS-PCR assay, DNA from leaves inoculated with known mutations was extracted, detected by AS-PCR and sequenced. The results showed good similarity between the two methods. Additionally, to rapidly detect mutations in the CcSdhD gene, we developed a single-tube multiplex allele-specific PCR assay. In conclusion, AS-PCR and MAS-PCR were established for mutation detection and targeted control of CLS.

First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States.

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

First Report of leaf spot on Cucumber Caused by Pantoea ananatis in Hainan of China.

Cucumber (Cucumis sativus L.) is one of the most important vegetables cultivated in the world. It is widely cultivated and mostly grown under greenhouse conditions (Sallam et al. 2021). Cucumber has a long growth cycle and is particularly susceptible to bacterial diseases. In May 2021, bacterial leaf spot was found on cucumbers of the variety Lyuyou NO.3 in Hainan Province, China. In the early stage of the disease, the leaves showed small yellow-brown spots in the shape of water stains. When exposed to light, a yellow halo around the disease spots could be seen. In later stages, the lesions gradually become larger and more yellow. The leaf veins around the disease site also gradually turned yellow (Figure 2a). In serious cases, the whole leaf turned yellow, resulting in leaf death. We collected plants with the same symptoms from 25 different farms in Hainan Province. Five plants were selected from each farm by the classic five-point sampling method and three leaves were selected from each plant, for a total of 15 leaves collected from each farm. Then three leaves were randomly selected from the 15 leaves on each farm for isolation of the pathogen, and a total of 75 leaves were isolated. We found that the incidence of the disease was from 20% to 30% based on a diagnostic test, which conducted on 75 cucumber leaves samples suspected of same symptom of cucumber, collected from Hainan Province. Using microscopy, bacterial streaming was observed to tentatively identify the causal agent as a bacteria. Tissue isolation was used to isolate the responsible pathogens. A 5 mm × 5 mm sample of tissue at the junction of diseased and healthy sections was collected. First, the surface of the tissue was disinfected in a 75% ethanol solution for 30 sec; then it was soaked in 2% NaOCl for 5-7 min, and finally, it was washed thrice in sterile distilled water. The tissues were inoculated onto lysogen broth culture media (LB) and cultured in a 28℃ incubator for 2 days. Bacterial colonies that emerged from the tissues were cultured in LB. Four isolated colonies were selected for verification. The colonies of isolated from the diseased leaves of cucumber are round, egg yellow and slightly sticky (Figure 2c). The isolate named PA-1 was identified by PCR amplification and sequencing of the partial 16S rRNA gene with the primer 27F/1492R (Lane 1991) and gyrB gene (Li et al. 2019). Sequences were stored in GenBank with the accession numbers OK576932.1 (16S rRNA, PA-1) and OL978577 (gyrB); BLASTn was used to compare these with other GenBank sequences. Sequencing of the 16S rRNA gene showed that PA-1 had a sequence length of 1403bp, with 99.78% genetic similarity to Pantoea ananatis strain MZ007857.1. Sequencing of the gyrB gene showed that the sequence length of PA-1 was 1136bp, with 99.29% genetic similarity to P. ananatis strain MW981331.1. Then, a pathogenicity text was conducted to verify Koch's postulates, which was done by first inoculating P. ananatis into LB liquid medium (shake culture at 28°C, 180 r/min). The log phase cell was collected by centrifugation (5,000 r/min for 2 min at 4°C), and inoculated strains were resuspended in sterile water at OD600 = 0.5. The bacterial suspension was inoculated on healthy cucumber leaves with a syringe. The control was sterile water, which was injected onto healthy cucumber leaves using the same methodology. The plants were placed in a greenhouse with a diurnal temperature difference of 21- 27°C and were observed daily. After two weeks, all bacterial inoculated plants developed symptoms of shriveling and necrosis (Figure 2b), while the control group showed no symptoms. From the symptomatic plants, the pathogen was isolated again and identified by morphological and molecular characterization. The sequences of the isolates recovered from the inoculated experiment matched 100% the sequences of the isolate PA-1. Koch's postulates were completed by following the previously described method. To our knowledge, this is the first report of P. ananatis causing leaf spot of cucumber.

First report of Cucurbit aphid-borne yellows virus causing yellowing disease on pumpkin (Cucurbita pepo) and cucumber (Cucumis sativus) in Bulgaria.

Cucurbit aphid-borne yellows virus (CABYV) was first reported in France in 1992 but has since been observed worldwide (Lecoq et al. 1992; Choi and Choi 2016; Buzkan et al. 2017; Zindovic et al. 2017; Vidal et al. 2018; Khanal and Ali, 2018). This virus has caused severe losses to different crops especially to the members of Cucurbitaceae and yield losses can reach up to 40-50% if infection occurs at early stages (Lecoq et al. 1992). In July 2017, leaf samples showing virus-like symptoms were collected from five pumpkin (Cucurbita pepo L. var. Clypeata Alefield) and two cucumber (Cucumis sativus L. cv. Azuma matsunari) plants, growing in а field near Sadovo, Bulgaria. Nearly all plants in the field were affected and displayed green or yellow mosaic, interveinal yellowing, blisters, and leaf deformation (Fig. 1). The collected samples were all symptomatic and were subjected to double antibody sandwich (DAS) or triple antibody sandwich (TAS) enzyme-linked immunosorbent assay (ELISA) to determine the viral agent(s). Specific monoclonal antibodies (Leibniz institute DSMZ, Germany) raised against Cucumber leaf spot virus, Cucurbit chlorotic yellows virus, Cucurbit yellow stunting disorder virus, Cucumber mosaic virus (CMV), Melon necrotic spot virus, Beet western yellows virus (BWYV), CABYV, Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), and Cucumber green mottle mosaic virus, were used. The total number of tested samples was seven (n=5 from pumpkin and n=2 from cucumber). All of them displayed positive signals for CABYV and BWYV, both belonging to genus Polerovirus, family Luteoviridae. In addition, ZYMV and/or WMV were detected in pumpkins while CMV and/or WMV were detected in cucumber samples, respectively. To confirm the presence of CABYV and/or BWYV, total RNA was isolated from all seven samples by TRI Reagent® (Sigma, St. Louis, USA) and converted to cDNA with First Strand cDNA Synthesis Kit, Thermo Scientific™. Reverse transcription (RT)-polyemerase chain reaction (PCR) was performed using two pairs of primers (CABYV1FW: 5'-TTATCAGGGGACTATGTTTA-3' and CABYV14REV: 5'-GAGGGGATTTTAACTGACTG-3', and BWYV1FW: 5'-AGTAAGTCCTCCCCAACTGA-3' and BWYV2REV: 5'-CTACCCACGACCGTATTCAT-3'), specifically designed to detect CABYV and BWYV, respectively. Amplicons with expected sizes of 1,930 bp were obtained only with CABYV primers for all samples while no fragments were amplified with BWYV primers. The obtained products from two samples (pumpkin and cucumber) were purified and sent to Macrogen Inc., South Korea, for direct sequencing in both directions. High quality nucleotide sequences were submitted to GenBank We have evaluated the quality of the sequencing and trimmed those parts that did not comply the needed quality. The obtained smaller fragments Nucleotide sequences were submitted to GenBank with accession numbers MK671010 (656 bp) and MK671014 (712bp). These sequences contained ORFs encoding CABYV P1-P2 fusion proteins as determined by Blastp analysis (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins). A phylogenetic tree constructed by the Neighbor-joining method using 18 CABYV accessions and Potato leafroll virus as an outlier (Fig. 2) showed that the closest accessions to MK671010 and MK671014 were NC003688 (France) and EU636992 (China) with respective nucleotide identity of 98% and 99%. In 2019, another outbreak was observed in the same field near Sadovo and in a field near Plovdiv planted with pumpkins. Nearly 30% of the plants showed leaf yellowing typical for Polerovirus infection. Screening of collected samples (n=17) by RT-PCR confirmed CABYV presence in 15 samples. Based on available reports and according to our knowledge this is the first report of CABYV in Bulgaria.

Factors associated with occurrence of target leaf spot of cucumber

Factors associated with occurrence of target leaf spot of cucumber

Whole-genome analysis of bacillus velezensis ZF2, a biocontrol agent that protects cucumis sativus against corynespora leaf spot diseases.

Bacillus spp. have been widely described for their potentials to protect plants against pathogens. Here, we reported the whole genome sequence of Bacillus velezensis ZF2, which was isolated from the stem of a healthy cucumber plant. Strain ZF2 showed a broad spectrum of antagonistic activities against many plant bacterial and fungal pathogens, including the cucumber leaf spot fungus Corynespora cassiicola. The complete genome of B. velezensis ZF2 contained a 3,931,418-bp circular chromosome, with an average G + C content of 46.50%. Genome comparison revealed closest similarity between ZF2 and other B. velezensis strains. Genes homologous to 14 gene clusters for biosynthesis of secondary metabolites were identified in the ZF2 genome. Also identified were a number of genes involved in bacterial colonization, including the genes for motility, biofilm formation, flagella biosynthesis, and capsular biosynthesis. Numerous genes associated with plant-bacteria interactions, including cellulase or protease biosynthesis, and plant growth promotion were also identified in the ZF2 genome. Overall, our data will aid future studies of the biocontrol mechanisms of B. velezensis ZF2 and promote its application in vegetable disease control.

Near-Atomic-Resolution Cryo-Electron Microscopy Structures of Cucumber Leaf Spot Virus and Red Clover Necrotic Mosaic Virus: Evolutionary Divergence at the Icosahedral Three-Fold Axes.

Members of the Tombusviridae family have highly similar structures, and yet there are important differences among them in host, transmission, and capsid stabilities. Viruses in the Tombusviridae family have single-stranded RNA (ssRNA) genomes with T=3 icosahedral protein shells with a maximum diameter of ∼340 Å. Each capsid protein is comprised of three domains: R (RNA binding), S (shell), and P (protruding). Between the R domain and S domain is the "arm" region that studies have shown to play a critical role in assembly. To better understand how the details of structural differences and similarities influence the Tombusviridae viral life cycles, the structures of cucumber leaf spot virus (CLSV; genus Aureusvirus) and red clover necrotic mosaic virus (RCNMV; genus Dianthovirus) were determined to resolutions of 3.2 Å and 2.9 Å, respectively, with cryo-electron microscopy and image reconstruction methods. While the shell domains had homologous structures, the stabilizing interactions at the icosahedral 3-fold axes and the R domains differed greatly. The heterogeneity in the R domains among the members of the Tombusviridae family is likely correlated with differences in the sizes and characteristics of the corresponding genomes. We propose that the changes in the R domain/RNA interactions evolved different arm domain interactions at the β-annuli. For example, RCNMV has the largest genome and it appears to have created the necessary space in the capsid by evolving the shortest R domain. The resulting loss in RNA/R domain interactions may have been compensated for by increased intersubunit β-strand interactions at the icosahedral 3-fold axes. Therefore, the R and arm domains may have coevolved to package different genomes within the conserved and rigid shell.IMPORTANCE Members of the Tombusviridae family have nearly identical shells, and yet they package genomes that range from 4.6 kb (monopartite) to 5.3 kb (bipartite) in size. To understand how this genome flexibility occurs within a rigidly conserved shell, we determined the high-resolution cryo-electron microscopy (cryo-EM) structures of cucumber leaf spot virus and red clover necrotic mosaic virus. In response to genomic size differences, it appears that the ssRNA binding (R) domain of the capsid diverged evolutionarily in order to recognize the different genomes. The next region, the "arm," seems to have also coevolved with the R domain to allow particle assembly via interactions at the icosahedral 3-fold axes. In addition, there are differences at the icosahedral 3-fold axes with regard to metal binding that are likely important for transmission and the viral life cycle.

Variations in phyllosphere microbial community along with the development of angular leaf-spot of cucumber

The phyllosphere is colonized by a wide variety of microorganisms including epiphytes, plant-pathogenic fungus, bacteria, as well as human or animal pathogens. However, little is known about how microbial community composition changes with the development of angular leaf-spot of cucumber. Here, 18 mixed samples were collected based on the lesion coverage rate (LCR) of angular leaf-spot of cucumber from three disease severity groups (DM1: symptomatic-mild, DM2: symptomatic-moderate, DM3: symptomatic-severe). In our study, the microbial community structure and diversity were examined by Illumina MiSeq sequencing. A significant differences was observed in α diversity and community structure among three disease severity groups. The phyllosphere microbiota was observed to be dominated by bacterial populations from Proteobacteria, Actinobacteria, and Firmicutes, as well as fungal species from Ascomycota and Basidiomycota. In addition, some plant-specific microbe such as Sphingomonas, Methylobacterium, Pseudomonas, and Alternaria showed significant changes in their relative abundance of population. The LCR was correlated negatively with Sphingomonas, Methylobacterium, Quadrisphaera, and Lactobacillus, whereas correlated positively with Pseudomonas and Kineococcus (p < 0.05). The LCR was negatively correlated with Alternaria and Arthrinium of the fungal communities (p < 0.05). Molecular ecological networks of the microbial communities were constructed to show the interactions among the OTUs. Our current results indicated that the competitive relationships among species were broken with the development of angular leaf-spot of cucumber. The microbial community composition changed over the development of angular leaf-spot of cucumber. The result of molecular ecological networks indicated that the overall bacterial community tends toward mutualism from the competition. The development of angular leaf-spot of cucumber affected the ecosystem functioning by disrupting the stability of the microbial community network. This work will help us to understand the host plant-specific microbial community structures and shows how these communities change throughout the development of angular leaf-spot of cucumber.

First Report of Bacterial Leaf Spot of Cucumber Caused by Pseudomonas cichorii in China

Cucumber (Cucumis sativus L.) is a globally important vegetable. From September to May every year, more than 600 groups from 29 provinces of China conduct experiments in crop breeding and seed reproduction in Hainan Province. A new cucumber bacterial leaf spot disease was discovered in 2015, during a survey in a cucumber breeding facility in Sanya, Hainan province. The disease incidence reached 90% in severely infected fields since 2015. Initial symptoms on cucumber leaves are water soaking and light green lesions. Leaves are thinner. Lesion margins gradually turn yellow, and the lesion centers turn brown. The range of irregular lesions is 1.5 to 2.0 cm long and 1 to 1.5 cm wide. Severely affected leaves show chlorotic lesions, which coalesce to produce broad necrotic areas. More than 120 bacterial isolates with consistent appearance were isolated from symptomatic cucumber leaf samples using nutrient agar (NA), and three isolates were selected for further characterization. Physiological and morphological characteristics of the isolated bacteria were determined using standard microbiological techniques (Schaad et al. 2001). Colonies are round, pale yellow, smooth, with undulate margins. Bacterial cells were gram negative, with multiple polar flagella, positive for catalase and oxidase, produced fluorescent blue color under ultraviolet light on King’s medium B agar, and metabolized glucose and fructose. Negative results were produced for growth at 41°C, gelatin hydrolysis, fructosan production, arginine dihydrolase presence, Tween 80 hydrolysis, use of trehalose, and sorbitol. Based on these morphological and biochemical characteristics, the pathogen was identified as Pseudomonas cichorii Stapp (Bergey et al. 1994). The bacterial identity was further confirmed by amplifying the 16S rRNA gene using primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′) and the rpoB gene using primers LAPS/LAPS27 (Ait Tayeb et al. 2005). The sequences were deposited in GenBank (accession nos. MF979525.1 [16S rRNA] and MF979524.1 [rpoB]) and exhibited a 99% identity with P. cichorii (accession nos. KU923374.1 and JQ994485.1). A pathogenicity assay was carried out using potted, greenhouse-grown cucumber plants. The inoculum was grown in NA for 24 h at 28°C and then was suspended in distilled water. Leaves (three replications, cv. Yansi) were sanitized in 0.1% mercuric chloride for 30 s, washed and rinsed with sterile distilled water, and then sprayed with a bacterial suspension (5.0 × 10⁸ CFU/ml). Distilled water was used as negative control. Inoculated and control plants were incubated at 90 to 100% relative humidity at 25°C. Water-soaked, thin, and light-green lesions appeared after 24 h, and enlarged lesions with yellow halos were observed after 48 h. The lesion margins gradually turned yellow, and the lesion centers turned brown after 5 days. These symptoms were not observed on control plants. The pathogenicity test was repeated three times. The same bacteria were consistently reisolated. Thus, the Koch’s postulates were fulfilled. To our knowledge, this is the first isolation of cucumber leaf spot caused by P. cichorii in China.

English

Different studies were done in order to investigate the occurrence of bacterial diseases on different crops grown in Jordan during different growing seasons. Surveys were made and different bacterial diseases have been recorded based on symptoms and pathogenic nature. Morphological characters, biochemical tests and PCR detections were employed in order to detect and identify the causal agents of different inspected plant bacterial diseases. In addition, the distribution of the identified bacterial diseases, throughout the country was recorded. The results of our study revealed the occurrence of different bacterial diseases attacking different crops; grown in many growing regions throughout the country. Some of them were found to have a wide host range such as crown gall and soft rot, while others had a restricted host range as in the case of bacterial speck of tomato which was found to be restricted to tomato and black leg of potato. As a result of this study, the following diseases; angular leaf spot of cucumber, tomato speck, common blight, crown gall, soft rot, black rot, black leg and bacterial cankers resulted in high economic losses in yield. The spread of these diseases in the different areas in Jordan with different environmental conditions may result in the development of new races of the causal agents without developing typical symptoms making their diagnoses under field conditions difficult. Whereas the bacterial diseases needs deep and ideal studies in order to diagnose diseases, the diagnoses of these diseases act as the base for researchers to challenge and withdraw researches into the improvement of novel, more effective and sustainable bacterial disease control strategies. Key words: Bacterial diseases, survey, Jordan.

Evidence for a Novel Phylotype of Pseudomonas syringae Causing Bacterial Leaf Blight of Cantaloupe in China.

Bacterial leaf blight (BLB) has caused severe yield losses in cantaloupe (Cucumis melo L.) in the major melon-growing regions of China since the beginning of the twentieth century. Historically, Pseudomonas syringae pv. lachrymans was considered to be the causal agent of BLB of cantaloupe and angular leaf spot of cucumber. In the process of characterizing bacteria isolated from cantaloupe, we observed that putative P. syringae pv. lachrymans yielded negative results in P. syringae pv. lachrymans-specific PCR assays. This suggested that the P. syringae pv. lachrymans-like strains from cantaloupe were distinct from those recovered from cucumber. To investigate the differences between P. syringae pv. lachrymans-like strains isolated from cantaloupe and cucumber, 13 P. syringae strains isolated from cantaloupe [12 from China and 1 from Zimbabwe (NCPPB2916)] and 7 additional P. syringae reference strains were analyzed by catabolic profiling, phylogenetic analysis by multilocus sequence analysis (MLSA) and pathogenicity tests on cantaloupe leaflets. Catabolic profiling and MLSA based on 10 housekeeping genes and 2 hypersensitive response and pathogenicity (hrp) genes allowed us to differentiate strains isolated from cantaloupe and cucumber. Pseudomonas syringae pv. lachrymans strains isolated from cucumber clustered with genomospecies 2, and 13 P. syringae strains isolated from cantaloupe belonged to genomospecies 1. While all cantaloupe strains were closely related to P. syringae pv. aptata, they could be differentiated from this pathovar based on metabolic tests and MLSA. Pathogenicity tests showed that all strains isolated from cantaloupe and cucumber were only pathogenic on their original hosts. Based on these observations we conclude that P. syringae pv. lachrymans strains recovered from cantaloupe in China represent a novel phylotype.

A fuzzy clustering segmentation method based on neighborhood grayscale information for defining cucumber leaf spot disease images

Research reported in this paper aims to improve the extraction of cucumber leaf spot disease under complex backgrounds. An improved fuzzy C-means (FCM) algorithm is proposed in this paper. First, three runs of the marked-watershed algorithm, based on HSI space, are applied to isolate the target leaf. Second, the distance between the pixel xj and the cluster center vi is defined as ‖xj2-vi2‖. Third, the pixel's neighborhood mean gray value, which constitutes a two-dimensional vector with grayscale information, is calculated as a sample point, rather than FCM grayscale. Finally, the neighborhood mean gray value and pixel gray value are weighted by matrix w. To evaluate the robustness and accuracy of the proposed segmentation method, tests were conducted for 129 cucumber disease images in vegetable disease database. Results show that average segmentation error was only 0.12%. The proposed method provides an effective and robust segmentation means for sorting and grading apples in cucumber disease diagnosis, and it can be easily adapted for other imaging-based agricultural applications.

The Cucumber leaf spot virus p25 auxiliary replicase protein binds and modifies the endoplasmic reticulum via N-terminal transmembrane domains

Cucumber leaf spot virus (CLSV) is a member of the Aureusvirus genus, family Tombusviridae. The auxiliary replicase of Tombusvirids has been found to localize to endoplasmic reticulum (ER), peroxisomes or mitochondria; however, localization of the auxiliary replicase of aureusviruses has not been determined. We have found that the auxiliary replicase of CLSV (p25) fused to GFP colocalizes with ER and that three predicted transmembrane domains (TMDs) at the N-terminus of p25 are sufficient for targeting, although the second and third TMDs play the most prominent roles. Confocal analysis of CLSV infected 16C plants shows that the ER becomes modified including the formation of punctae at connections between ER tubules and in association with the nucleus. Ultrastructural analysis shows that the cytoplasm contains numerous vesicles which are also found between the perinuclear ER and nuclear membrane. It is proposed that these vesicles correspond to modified ER used as sites for CLSV replication.

Construction and characterization of an aureusvirus defective RNA

Defective RNAs (D RNAs) are small RNA replicons derived from viral RNA genomes. No D RNAs have been found associated with members of the plus-strand RNA virus genus Aureusvirus (family Tombusviridae). Accordingly, we sought to construct a D RNA for the aureusvirus Cucumber leaf spot virus (CLSV) using the known structure of tombusvirus defective interfering RNAs as a guide. An efficiently accumulating CLSV D RNA was generated that contained four non-contiguous regions of the viral genome and this replicon was used as a tool to studying viral cis-acting RNA elements. The results of structural and functional analyses indicated that CLSV contains counterparts for several of the major RNA elements found in tombusviruses. However, although similar, the CLSV D RNA and its components are distinct and provide insights into RNA-based specificity and mechanisms of function.

Molecular and Serological Identification of Cucumber leaf spot virus in Iran

AbstractDuring surveys conducted in 2012–2013, viruslike symptoms of chlorotic spots with, in some cases, a necrotic centre in older leaves were observed in field‐ and greenhouse‐grown cucumber (Cucumis sativus L.), melon (C. melo L.) and squash (Cucurbita sp.) in the major cucurbit cultivation regions in Iran. Leaf samples were collected and tested for the presence of Cucumber leaf spot virus (CLSV, genus Aureusvirus, family Tombusviridae) by a virus specific double‐antibody sandwich enzyme‐linked immunosorbent assay (DAS‐ELISA). CLSV was detected in four of eight surveyed provinces in melon, cucumber and squash. When plant sap of ELISA positive samples was used to mechanically inoculate healthy squash plants, chlorotic spots with, in some cases, necrotic centres were observed on the inoculated leaves 20–25 days postinoculation. The presence of CLSV was confirmed by reverse transcription polymerase chain reactions using specific primers amplifying the entire coat protein gene of CLSV. Sequence comparison with sequences available at GenBank showed 93% nucleotide sequence identity to CLSV isolates from Israel (DQ227315) and Canada (EU127904), the only CLSV coat protein sequences available. To our knowledge, this is the first report of the occurrence of CLSV in Iran.

Viruses of cucurbits in Panama.

The main areas of field-grown cucurbit production in Panama were surveyed for the occurrence and distribution of viruses in the growing seasons of 2006 and 2008. Notably, in 2006 only Melon necrotic spot virus (MNSV) was detected, while Papaya ringspot virus (PRSV) was the most frequent in 2008 in terms of number of fields and samples analysed, followed by Zucchini yellow mosaic virus (ZYMV), Watermelon mosaic virus (WMV) and MNSV. Cucumber mosaic virus (CMV), Squash mosaic virus (SqMV), Cucumber green mottle mosaic virus (CGMMV), Tomato spotted wilt virus (TSWV), Cucumber leaf spot virus (CLSV), Cucurbit yellow stunting disorder virus (CYSDV), Cucurbit aphid-borne yellows virus (CABYV), Beet pseudoyellows virus (BPYV), Beet yellows virus (BYV), and Cucumber vein yellowing virus (CVYV) were not detected . Single and double (PRSV+WMV; PRSV+ZYMV; ZYMV+MNSV) infections were detected in 60% and 40% of the samples tested, respectively. The occurrence and distribution of each virus varied according to the region and cucurbit species.

First Report of Stemphylium solani as the Causal Agent of a Leaf Spot on Greenhouse Cucumber.

During the 2011 to 2012 crop season, a severe leaf spot disease of cucumber (Cucumis sativus) cv. Cadiz was noticed on crops in some greenhouses in the Goudouras area, Lasithi, Crete, Greece. Symptoms appeared in late winter, mainly on the leaves of the middle and upper part of the plants. Initially, small necrotic pinpoint lesions with white centers, surrounded by chlorotic halos, 1 to 3 mm in diameter, appeared on the upper leaf surfaces, and these progressively enlarged to spots that could coalesce to form nearly circular lesions up to 2 cm or more in diameter. Stemphylium-like fructifications appeared on necrotic tissue of older lesions. Severely affected leaves became chlorotic and died. No other part of the plant was affected. Small tissue pieces from the edges of lesions were surface disinfected in 0.5% NaClO for 5 min, rinsed in sterile distilled water, plated on acidified potato dextrose agar and incubated at 22 ± 0.5°C with a 12-h photoperiod. Stemphylium sp. was consistently isolated from diseased samples. Colonies showed a typical septate mycelium with the young hyphae subhyaline and gradually became greyish green to dark brown with age. Conidiophores were subhyaline to light brown, 3- to 10-septate, up to 200 μm in length, and 4 to 7 μm in width, with apical cell slightly to distinctly swollen, bearing a single spore at the apex. Conidia were muriform, mostly oblong to ovoid, but occasionally nearly globose, subhyline to variant shades of brown, mostly constricted at the median septum, 22.6 ± 6.22 (11.9 to 36.9) μm in length, and 15.1 ± 2.85 (8.3 to 22.6) μm in width, with 1 to 8 transverse and 0 to 5 longitudinal septa. DNA from a representative single-spore isolate was extracted and the internal transcribed spacer region (ITS) of ribosomal DNA (rDNA) was amplified using the universal primers ITS5 and ITS4. The PCR product was sequenced and deposited in GenBank (Accession No. JX481911). On the basis of morphological characteristics (3) and a BLAST search with 100% identity to the published ITS sequence of a S. solani isolate in GenBank (EF0767501), the fungus was identified as S. solani. Pathogenicity tests were performed by spraying a conidial suspension (105 conidia ml-1) on healthy cucumber (cv. Knossos), melon (C. melo, cv. Galia), watermelon (Citrullus lanatus cv. Crimson sweet), pumpkin (Cucurbita pepo, cv. Rigas), and sponge gourd (Luffa aegyptiaca, local variety) plants, at the 5-true-leaf stage. Disease symptoms appeared on cucumber and melon only, which were similar to those observed under natural infection conditions on cucumber. S. solani was consistently reisolated from artificially infected cucumber and melon tissues, thus confirming Koch's postulates. The pathogenicity test was repeated with similar results. In 1918, a report of a Stemphylium leaf spot of cucumber in Indiana and Ohio was attributed to Stemphylium cucurbitacearum Osner (4), but that pathogen has since been reclassified as Leandria momordicae Rangel (2). That disease was later reported from Florida (1) and net spot was suggested as a common name for that disease. For the disease reported here, we suggest the name Stemphylium leaf spot. This is the first report of a disease of cucumber caused by a species of Stemphylium.

Pathological studies on alternaria leaf spot of cucumber under protected cultivation

Pathological studies on alternaria leaf spot of cucumber under protected cultivation