LB Medium Research Articles

Role of Pseudomonas fluorescens FSYZ01 on the corrosion behavior of Q235B carbon steel in oilfield produced water.

The corrosion behavior of Q235B carbon steel is investigated in water, LB medium, and oilfield produced water adding Pseudomonas fluorescens FSYZ01. After immersion at 30°C for 13days, the weight loss of carbon steel with this strain decreased by 32.23%, 54.07%, and 78.34%, respectively. X-ray diffraction (XRD) results show that P. fluorescens FSYZ01 inhibited conversion of iron oxides by hindering oxygen from approaching metal surface. Fourier transform infrared (FT-IR) and X-ray photoelectron spectrometer (XPS) results show that specific functional groups and bonds reacted with Fe(II/III) to form a dense and stable chelate-oxide protective layer, thereby inhibiting corrosion. Pyrolysis gas chromatography-mass spectrometer (Py-GCMS) results demonstrate the bacteria degraded C12 to C20 alkanes in oil. The inhibitory mechanism of crude oil-degrading bacteria P. fluorescens FSYZ01 on the carbon steel corrosion was proposed, so as to slow corrosion of oilfield produced water system pipeline and prolong its service life, helping to comprehend the microbial corrosion in the actual environment.

Graphene oxide affects bacteriophage infection of bacteria by promoting the formation of biofilms

Graphene oxide (GO) is increasingly used in a range of fields, such as electronics, biosensors, drug delivery, and water treatment, and the likelihood of its release into the environment is increasing correspondingly. GO is involved in the formation of biofilms and leads bacteria to over proliferate, but the effects of GO on bacteriophage infection remain unexplored. We noted bacterial overgrowth in experiments when GO was used to treat the bacterial culture medium, leading us to question whether bacterial proliferation caused by GO affects phage infection of target bacteria. Treating Pseudomonas aeruginosa with GO at a low dosage (0.02 mg/mL) led to biofilm expansion in LB medium. Biofilm formation in the presence of GO affected the ability of bacteriophages to kill bacteria and reproduce. Similarly, the presence of GO deposits increased the ratio of bacteria to phage, providing a favorable environment for bacterial growth. Additionally, increasing the positive electrical charge in the culture environment inhibited the rejection of bacteriophages by negatively charged GO, improving phage reproduction. Finally, adding GO to sewage in imitation field experiments significantly increased the bacterial diversity and richness in the sewage, stimulating a significant increase in the variety and number of bacteria. Collectively, these results indicate that GO hinders phage infection by providing a bacterial refuge. The results of this study provide valuable insights into how GO interacts with bacteriophages to explore the effects on bacterial growth.

Genome Sequencing and Genetic Engineering Reveal the Contribution of Bacitracin Produced by Bacillus paralicheniformis CPL618 to Anti-Staphylococcus aureus Activity.

Staphylococcus aureus is one of the important pathogens causing human diseases, especially its treatment has great challenges due to its resistance to methicillin and vancomycin. The Bacillus strains are known to be major sources of second metabolites that can function as drugs. Therefore, it is of great value to excavate metabolites with good inhibitory activity against S. aureus from Bacillus strains. In this study, a strain Bacillus paralicheniformis CPL618 with good antagonistic activity against S. aureus was isolated and genome analysis showed that the size was 4,447,938bp and contained four gene clusters fen, bac, dhb, and lch which are potentially responsible for four cyclic peptides fengycin, bacitracin, bacillibactin, and lichenysin biosynthesis, respectively. These gene clusters were knockout by homologous recombination. The bacteriostatic experiment results showed that the antibacterial activity of ∆bac decreased 72.3% while Δfen, Δdhb, and ΔlchA did not significantly changed as that of wild type. Interestingly, the maximum bacitracin yield was up to 92 U/mL in the LB medium, which was extremely unusual in wild type strains. To further improve the production of bacitracin, transcription regulators abrB and lrp were knocked out, the bacitracin produced by ΔabrB, Δlrp, and ΔabrB + lrp was 124 U/mL, 112 U/mL, and 160 U/ml, respectively. Although no new anti-S. aureus compounds was found by using genome mining in this study, the molecular mechanisms of high yield of bacitracin and anti-S. aureus in B. paralicheniformis CPL618 were clarified. Moreover, B. paralicheniformis CPL618 was further genetically engineered for industrial production of bacitracin.

Oxidative Stress Contributes to Bacterial Airborne Loss of Viability.

While the airborne decay of bacterial viability has been observed for decades, an understanding of the mechanisms driving the decay has remained elusive. The airborne transport of bacteria is often a key step in their life cycle and as such, characterizing the mechanisms driving the airborne decay of bacteria is an essential step toward a more complete understanding of microbial ecology. Using the Controlled Electrodynamic Levitation and Extraction of Bioaerosols onto a Substrate (CELEBS), it was possible to systematically evaluate the impact of different physicochemical and environmental parameters on the survival of Escherichia coli in airborne droplets of Luria Bertani broth. Rather than osmotic stress driving the viability loss, as was initially considered, oxidative stress was found to play a key role. As the droplets evaporate and equilibrate with the surrounding environment, the surface-to-volume ratio increases, which in turn increased the formation of reactive oxygen species in the droplet. These reactive oxygen species appear to play a key role in driving the airborne loss of viability of E. coli. IMPORTANCE The airborne transport of bacteria has a wide range of impacts, from disease transmission to cloud formation. By understanding the factors that influence the airborne stability of bacteria, we can better understand these processes. However, while we have known for several decades that airborne bacteria undergo a gradual loss of viability, we have not previously identified the mechanisms driving this process. In this work, we discovered that oxygen surrounding an airborne droplet facilitates the formation of reactive oxygen species within the droplet, which then gradually damage and kill bacteria within the droplet. This discovery indicates that adaptations to help bacteria deal with oxidative stress may also aid their airborne survival and be essential adaptations for bacterial airborne pathogens. Understanding the adaptations bacteria need to survive in airborne droplets could eventually lead to the development of novel antimicrobials designed to inhibit their airborne survival, helping to prevent the transmission of disease.

Study of antibacterial and antioxidant activities of silver nanoparticles synthesized from Tradescantia pallida (purpurea) leaves extract

This study defined a facile, inexpensive, and benign method to fabricate silver nanoparticles (AgNPs) using Tradescantia pallidum var. purpurea aqueous leaves extract for the first time. A UV–vis spectrum showed that the evaluated extract was promising for green synthesis of the SNP, with the highest peak of absorption between 450 and 550 nm. The phytochemicals present in the plant extract acts as capping and stabilization agent were confirmed by FTIR analysis. EDX proved the presence of Ag while SEM confirmed the AgNPs with the spherical shape. TEM revealed the average particle size was 23 nm. Additionally, AgNPs exhibited significant antibacterial activity and turbidimetry analysis showed MIC and MBC was in range of 25–100 µg/mL against both Gram positive and Gram-negative bacteria in Luria Bertani broth cultures. The AgNPs exhibited potent antibacterial activity against gram-positive bacteria, with a ZOI of 12 ± 0.25 mm produced against BacillusB subtilis showed the largest zones of inhibition, which were greater than the positive control (cefotaxime). The MIC values were 50 µg/mL for Pseudomonas aeruginosa, 25 µg/mL for Staphylococcus aureus and Escherichia coli, and 100 µg/mL for B. subtilis, confirming their significant antibacterial action. AgNPs inhibited the DDPH free radical scavenging activity with an IC50 = 91.87 µg/mL. It is believed that these AgNPs play a crucial role in determining the therapeutic potential of T. pallida due to their biological efficacy.

Isolation and Identification of Mercury-Tolerant Bacteria LBA119 from Molybdenum-Lead Mining Soils and Their Removal of Hg2.

To screen heavy metal-tolerant strains from heavy metal-contaminated soil in mining areas and determine the tolerance of the strains to different heavy metals and their removal rates through experiments. Mercury-resistant strain LBA119 was isolated from mercury-contaminated soil samples in Luanchuan County, Henan Province, China. The strain was identified by Gram staining, physiological and biochemical tests, and 16S rDNA sequences. The LBA119 strain showed good resistance and removal rates to heavy metals such as Pb2+, Hg2+, Mn2+, Zn2+, and Cd2+ using tolerance tests under optimal growth conditions. The mercury-resistant strain LBA119 was applied to mercury-contaminated soil to determine the ability of the strain to remove mercury from the soil compared to mercury-contaminated soil without bacterial biomass. Mercury-resistant strain LBA119 is a Gram-positive bacterium that appears as a short rod under scanning electron microscopy, with a single bacterium measuring approximately 0.8 × 1.3 μm. The strain was identified as a Bacillus by Gram staining, physiological and biochemical tests, and 16S rDNA sequence analysis. The strain was highly resistant to mercury, with a minimum inhibitory concentration (MIC) of 32 mg/L for mercury. Under a 10 mg/L mercury environment, the optimal inoculation amount, pH, temperature, and salt concentration of the LBA119 strain were 2%, 7, 30 °C, and 20 g/L, respectively. In the 10 mg/L Hg2+ LB medium, the total removal rate, volatilization rate, and adsorption rate at 36 h were 97.32%, 89.08%, and 8.24%, respectively. According to tolerance tests, the strain showed good resistance to Pb2+, Mn2+, Zn2+, Cd2+, and other heavy metals. When the initial mercury concentration was 50 mg/L and 100 mg/L, compared with the mercury-contaminated soil that contained an LB medium without bacterial biomass, LBA119 inoculation increased 15.54-37.67% after 30 days of culture. This strain shows high bioremediation potential for mercury-contaminated soil.

CYP broth: a tool for Yersinia pestis isolation in ancient culture collections and field samples.

We developed a simple new selective LB-based medium, named CYP broth, suitable for recovering long-term stored Y. pestis subcultures and for isolation of Y. pestis strains from field-caught samples for the Plague surveillance. It aimed to inhibit the growth contaminating microorganisms and enrich Y. pestis growth through iron supplementation. The performance of CYP broth on microbial growth from different gram-negative and gram-positive strains from American Type Culture Collection (ATCC®) and other clinical isolates, field-caught rodent samples, and more importantly, on several vials of ancient Y. pestis subcultures was evaluated. Additionally, other pathogenic Yersinia species such as Y. pseudotuberculosis and Y. enterocolitica were also successfully isolated with CYP broth. Selectivity tests and bacterial growth performance on CYP broth (LB broth supplemented with Cefsulodine, Irgasan, Novobiocin, nystatin and ferrioxamine E) were evaluated in comparison with LB broth without additive; LB broth/CIN, LB broth/nystatin and with traditional agar media including LB agar without additive, and LB agar and Cefsulodin-Irgasan-Novobiocin Agar (CIN agar) supplemented with 50µg/mL of nystatin. Of note, the CYP broth had a recovery twofold higher than those of the CIN supplemented media or other regular media. Additionally, selectivity tests and bacterial growth performance were also evaluated on CYP broth in the absence of ferrioxamine E. The cultures were incubated at 28°C and visually inspected for microbiological growth analysis and O.D.625nm measurement between 0 and 120h. The presence and purity of Y. pestis growth were confirmed by bacteriophage and multiplex PCR tests. Altogether, CYP broth provides an enhanced growth of Y. pestis at 28°C, while inhibiting contaminant microorganisms. The media is a simple, but powerful tool to improve the reactivation and decontamination of ancient Y. pestis culture collections and for the isolation of Y. pestis strains for the Plague surveillance from various backgrounds. KEY POINTS: • The newly described CYP broth improves the recuperation of ancient/contaminated Yersinia pestis culture collections • CYP broth was also efficient in reducing environmental contamination in field-capture samples, improving Y. pestis isolation • CYP broth can also be used for the isolation of Y. enterocolitica and Y. pseudotuberculosis.

Induction of Antimicrobial Resistance of Stenotrophomonas maltophilia by Exposure to Nonlethal Levels of Antibiotics.

The effects of the sequential subculture in the presence of a driving force on antimicrobial resistance of Stenotrophomonas maltophilia K279a were investigated. Stationary-phase cells were inoculated into the lysogeny broth medium, with and without antibiotic supplementation, and grown until the stationary phase before being subcultured into the same antibiotic-supplemented medium for six consecutive cycles. Thirty colonies from each cycle and treatment condition were selected and their antibiotic susceptibility profiles were determined. The sequential subculture of K279a for a number of cycles reduced susceptibility to diverse classes of antibiotics, including ciprofloxacin, amikacin, gentamicin, ceftazidime, co-trimoxazole, and chloramphenicol, regardless of the antibiotic used. Supplementation with antibiotics that is, ampicillin, kanamycin, ciprofloxacin, and ceftazidime, at sublethal concentrations significantly accelerated the development rate of strains that reduced susceptibility to other antibiotics. The patterns of reduced susceptibility were different depending on the antibiotic used for supplementation. Thus, without gene transfer, antibiotic-resistant strains of S. maltophilia can readily develop, especially after antibiotic treatments. Whole-genome sequence analysis of the selected antibiotic-resistant mutants identified gene mutations that might be responsible for antimicrobial resistance of S. maltophilia.

Levofloxacin impregnation and extended release: Concentration model for insulin catheters

Increasing the lifetime of percutaneous insulin delivery catheters to minimize painful needle sticks increases the risk of infection. To combat surface-adherent bacteria and potential biofilm formation, we developed a method to impregnate levofloxacin antibiotic into the outer polymer of the catheter so that it can leach into the external medium. Complementarily, we developed a method to quantify the concentration of antibiotic to ensure the minimum inhibitory concentration (MIC) is maintained throughout the duration of catheter use. Additionally, we have investigated the extent of antibiotic resistance after a zwitterionic nonfouling coating treatment to ensure suitable release after further surface modification. Levofloxacin was incorporated into the catheter through the swelling of the outer polyurethane of the bilayer catheter and subsequent solvent evaporation. The zone of inhibition was measured over time with S. epidermidis on LB agar plates. The release of levofloxacin was measured using optical absorbance spectroscopy in water and quantified against a linear standard curve at 292 nm. We developed a model using Fick's second law of diffusion to calculate the concentration around the catheter. Visible inhibition of bacterial growth and biofilm formation was shown for up to 38 days. A total of 8–45 µg of antibiotic was released over 26 days and a concentration of 820,000 µg/mL in the 0.17 µL control volume was reached at day 26 for the minimally-loaded samples, an amount many orders of magnitude greater than the MIC. After the nonfouling treatment, the lowest concentration reached was 16 µg/mL after 26 days. In conclusion, we have demonstrated a suitable method to induce antibacterial activity for insulin catheters, maintain the MIC, and sustain antibacterial character following further surface coatings.

Neolamarckia cadamba (Roxb.) Bosser (Rubiaceae) extracts: promising prospects for anticancer and antibacterial potential through in vitro and in silico studies

Neolamarckia cadamba is an Indian traditional medicinal plant having various therapeutic potentials. In the present study, we did solvent-based extraction of Neolamarckia cadamba leaves. The extracted samples were screened against liver cancer cell line (HepG2) and bacteria (Escherichia coli). MTT cytotoxic assay was performed for in vitro analysis of extracted samples against the HepG2 cell lines and the normal human prostate PNT2 cell line. Chloroform extract of Neolamarckia cadamba leaves showed better activity with IC50 value 69μg/ml. DH5α strain of Escherichia coli (E. coli) was cultured in Luria Bertani (LB) broth media and minimum inhibitory concentration (MIC) and Minimum bactericidal concentration (MBC) were calculated. Solvent extract chloroform showed better activity in MTT analysis and antibacterial screening and it was taken for characterization of phytocomposition by Fourier transform infrared (FTIR) and gas chromatography mass spectrometry (GC-MS). The identified phytoconstituents were docked with potential targets of liver cancer and E. coli. The phytochemical 1-(5-Hydroxy-6-hydroxymethyl-tetrahydropyran-2-yl)-5-methyl-1H-pyrimidine-2,4-dione shows highest docking score against the targets PDGFRA (PDB ID: 6JOL) and Beta-ketoacyl synthase 1(PDB ID: 1FJ4) and their stability was further confirmed by molecular dynamics simulation studies.

Critical Role of Monooxygenase in Biodegradation of 2,4,6-Trinitrotoluene by Buttiauxella sp. S19-1

2,4,6-Trinitrotoluene (TNT) is an aromatic pollutant that is difficult to be degraded in the natural environment. The screening of efficient degrading bacteria for bioremediation of TNT has received much attention from scholars. In this paper, transcriptome analysis of the efficient degrading bacterium Buttiauxella sp. S19-1 revealed that the monooxygenase gene (BuMO) was significantly up-regulated during TNT degradation. S-ΔMO (absence of BuMO gene in S19-1 mutant) degraded TNT 1.66-fold less efficiently than strain S19-1 (from 71.2% to 42.9%), and E-MO mutant (Escherichia coli BuMO-expressing strain) increased the efficiency of TNT degradation 1.33-fold (from 52.1% to 69.5%) for 9 h at 180 rpm at 27 °C in LB medium with 1.4 µg·mL-1 TNT. We predicted the structure of BuMO and purified recombinant BuMO (rBuMO). Its specific activity was 1.81 µmol·min-1·mg-1 protein at pH 7.5 and 35 °C. The results of gas chromatography mass spectrometry (GC-MS) analysis indicated that 4-amino-2,6-dinitrotoluene (ADNT) is a metabolite of TNT biodegradation. We speculate that MO is involved in catalysis in the bacterial degradation pathway of TNT in TNT-polluted environment.

Production and characterization of bioemulsifier by Parapedobacter indicus.

The current study evaluated Parapedobacter indicus MCC 2546 for its potential to produce a bioemulsifier (BE). Screening methods performed for BE production by P. indicus MCC 2546 showed good lipase activity, positive drop collapse test, and oil-spreading activity. Furthermore, it showed maximum emulsification activity (225 EU/ml) and emulsification index (E24 50%) at 37°C in Luria Bertani broth at 72 h with olive oil as a substrate. The optimal pH and NaCl concentration for maximum emulsification activity were 7 and 1%, respectively. P. indicus MCC 2546 lowered the surface tension of the culture medium from 59.65 to 50.42 ± 0.78 mN/m. BE produced was composed of 70% protein and 30% carbohydrate, which showed the protein-polysaccharide nature of the BE. Furthermore, Fourier transform infrared spectroscopy analysis confirmed the same. P. indicus MCC 2546 showed a catecholate type of siderophore production. This is the first report on BE and siderophore production by the genus Parapedobacter.

Cloning and Expression of 3 Chymotrypsin-like Protease of SARS-CoV-2 in E. coli using pET28a Vector

The 3 chymotrypsin-like protease (3CLpro) of the severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) is one of the primary targets for the development of antiviral drug therapies as it plays a critical role in viral replication. In this study, the gene encoding for SARS-CoV-2 3CLpro (918 bp) was amplified from the cDNA of the virus by polymerase chain reaction (PCR) and cloned into the pGEM-T vector. 3CLpro was then inserted into the expression vector pET28a at the end of the 6 histidine residue encoding sequence to form a fusion protein (6xHis-3CLpro). The 6xHis-3Clpro construct was successfully expressed in E. coli. The expression of 3CLpro was highest when E. coli BL21(DE3) RIL harboring pET28a-3CLpro vector was cultured in LB medium at 20 oC, induced by 1.0 mM Isopropyl thiogalactopyranosie (IPTG) when cell density measured by optical density at 600 nm (OD600) reached 0.7-0.8 and harvested after 24 hours of induction. The recombinant 3CLpro was purified by Ni-sepharose affinity chromatography under denaturation conditions. The purified 3CLpro showed to have a 41 kDa band on sodium dodesyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using polyclonal anti-3CLpro antibody and hydrolyzed a fluorescent specific substrate of 3CLpro after renaturation.

<i>In Vitro</i> Evaluation of Antibacterial Properties of Biogenically Synthesized Zinc Oxide Nanoparticles on Pathogenic Paddy Bacteria

Zinc oxide nanoparticles (ZnO-NP) were successfully synthesized from aloe vera extract and zinc sulphate as zinc precursor. Characterizations of the ZnO-NP were performed using UV–Vis spectrophotometer, XRD, FESEM and TEM analysis. The absorption peak from UV–Vis was at 380 nm while the XRD diagram displays high purity ZnO-NP. FESEM and TEM analysis showed agglomerated particles with a wide size distribution range. Polymerase chain reaction (PCR) analysis of Xanthomonas oryzae pv. oryzae (Xoo) pathotype 0.0 generated a product with the size of 230 bp similar to in silico PCR results, verifying the pathotype on molecular level. Subsequently, the antimicrobial activities of the ZnO-NP against Xoo pathotype 0.0 were assessed. Xoo (108 cfu/ml) were grown in LB broth supplemented with various concentrations of ZnO-NP. Collection of samples were done at 24 hours, 48 hours and 72 hours of incubation, grown on LB agar and observed for bacterial growth. Colony forming unit (cfu/ml) values revealed the number of viable cells decreased with high concentrations of ZnO-NP whereas minimal inhibition was observed at lower ZnO-NP concentrations. At lower bacteria cfu/ml (103 cfu/ml), it was found that at 24 hours incubation, ZnO-NP gave comparable antibacterial effects to commercial ZnO-NP and commercial non-nanoZnO after exposure for 1 hour. However, the antimicrobial effects decreased after 48 hours. It was also noted that the ZnO-NP provide better suppression of bacterial growth at lower bacterial concentration.

Effect of Priestia endophytica on the metabolites accumulation in chicory and lettuce plants cultivated in vitro

The influence of the culture medium without bacterial cells, obtained after the cultivation of endophytic bacteria Priestia endophytica UCM B-5715, on the growth and synthesis of some metabolites in lettuce and chicory seedlings under in vitro conditions was studied. Bacteria were cultivated in liquid LB medium at 37 ºC for 24 h with periodic stirring. The culture fluid was separated from the cell biomass. For preparing the test solution, the supernatant was sterilized by filtration through a filter with a pore diameter of 0.2 µm (Sartorius, Minisart) and diluted with sterile distilled water. The 20% culture fluid (30 µl/plant) was applied to 3-day-old seedlings. In 28 days root and shoot weights of treated chicory plants were 54.3 ± 6.9 and 260.0 ± 20.2 mg, respectively (8.0 ± 0.7 and 91.4 ± 7.0 mg for the control plants). Total flavonoid content and antioxidant activity increased only in chicory plants after the addition of the test solution. Significant changes in the metabolism of treated plants were detected. In the treated lettuce plants asparagine content increased compared to the control (90 vs 22 µg/g, p < 0.1). The median content of fructose was also higher in treated lettuce and chicory plants (1469 vs 73 µg/g and 2278 vs 1051 µg/g). Therefore, the use of culture fluid obtained after the cultivation of P. endophytica UСM B-5715 stimulated the growth of lettuce and chicory plants, affecting the synthesis of some compounds in single-treated plants. These results indicate the potential of compounds excreted during bacterial growth to create natural growth stimulators.

Analysis of Some Putative Novel Peptides from Iranian Scorpion Venom Glands, Hemiscorpius lepturus, Using cDNA Library Construction

Background: To date, more than 300,000 distinct peptides have been identified in scorpion venom. However, only a limited number of these peptides have been described. Objectives: We characterized some putative peptides from the venom gland cDNA library of the Iranian yellow scorpion Hemiscorpius lepturus. Methods: Total RNA was extracted from yellow Iranian scorpion glands. Single-stranded cDNA (sscDNA) and double-stranded cDNA (dscDNA) were synthesized by polymerase chain reaction (PCR). A cDNA library was achieved by inserting dscDNA into a special vector and subsequently transformed to chemically competent Escherichia coli as a host. The library was screened by culturing the liquid library on Lysogeny broth (LB)-agar plates. Analysis of positive clones was performed by plasmid extraction and the sequencing of the inserts. Finally, all cDNA sequences were analyzed and characterized by bioinformatics software. Results: One hundred colonies were randomly analyzed. Eighty-nine cDNA sequences had acceptable quality for bioinformatics analysis. Five sequences were selected for further analysis. The peptides related to these sequences were divided into two groups, non-disulfide bridge peptides (NDBP) and disulfide bridge peptides (DBP), the application of which in health and medical issues has been suggested. Conclusions: The data obtained in this study may be an important resource for further in vivo and in vitro functional assays to identify valuable therapeutic peptides.

First report of Pseudomonas mosselii causing white blotch disease in Pleurotus pulmonarius in China.

Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.

MWCNTs/PVA Hydrogel-Modified Electrochemical Sensors for Ex Vivo and In Vivo Detection of Pyocyanin Biomarker for Pseudomonas aeruginosa Wound Infection

Pseudomonas aeruginosa is the most prevalent cause of diabetic wound infection and amputation. Pyocyanin is one of the popular markers to identify Pseudomonas infections. However, no existing sensors are on the verge of being used as a suitable sensor for detecting pyocyanin in real-world applications. This study employed a physically cross-linked approach to decorate the surface of a working electrode with a multiwalled carbon nanotube (MWCNTs/PVA) nanocomposite, which increases electron transport, sample absorption, and biocompatibility. Under optimal conditions, the electrochemical behavior of a pyocyanin sensor was investigated using cyclic voltammetry and square wave voltammetry. The developed pyocyanin sensor demonstrated an excellent analytical range covering a clinically relevant range of 1–100 μM pyocyanin in various sample matrices including phosphate buffer, Lysogeny broth, simulated wound exudate, and Mueller–Hinton broth, showing a detection limit of 0.48, 0.10, 1.63, and 0.39 μM, respectively, with R2 > 0.99. The sensor’s potential wearability and point-of-care capability were demonstrated by detecting pyocyanin in wounds on ex vivo porcine skin and an in vivo animal model with excellent biocompatible property, achieving cell viability of L-929 > 80%. The detection could be performed directly in various sample matrices without any preparation processes. The sensor demonstrated high selectivity and sensitivity in the presence of common wound interferences. As a result, the proposed method has the potential to be a promising sensor for the early detection of P. aeruginosa infection in wounds in the perspective of wound care technology in the future.

Rose bud extract as a natural antimicrobial agent against Staphylococcus aureus: Mechanisms and application in maintaining pork safety

Pingyin rose bud extract (RBE) may serve as a green antibacterial agent replacing chemically synthesized agents, but its potential antibacterial activity and mechanisms were not well studied. In the present study, RBE component was analyzed through untargeted metabolomics. Then, Staphylococcus aureus was taken as research subject, and the action mechanisms of RBE in Luria–Bertani broth and its elimination efficiency in pork were studied. The results indicated that fatty acids were the most abundant category of antibacterial substances. The minimum inhibitory concentration and minimum bactericidal concentration of RBE against S. aureus were 0.19 and 0.39 mg/mL, respectively. Cell wall and membrane disruptions were observed in S. aureus treated with RBE. 865 differentially expressed genes (DEGs) were identified through transcriptome analysis (≥2-fold change, P < 0.05); DEGs related to two-component systems, DNA replication, and cationic antimicrobial peptide resistance were significantly affected. RBE can control the contamination of S. aureus in cooked pork without adversely impacting odor, pH, and color. Findings from this study revealed that RBE demonstrated good antibacterial efficacy against S. aureus, and can be used as a natural antimicrobial agent in cooked pork for maintaining food safety.

The impact of osmotic stresses on the biofilm formation, immunodetection, and morphology of Aeromonas hydrophila

Aeromonas hydrophila (Ah) is a zoonotic pathogen of great importance to aquaculture and human health. This study systematically evaluated the impact of salinity, sugar, ammonia nitrogen, and nitric nitrogen levels on the fitness of Ah by using Luria-Bertani (LB) broth supplemented with different concentrations of NaCl, sucrose, NH4Cl, urea, NaNO2 or NaNO3. Results showed that the static biofilm formation of Ah was higher at 28 °C compared to 37 °C (P < 0.05). At 28 °C, as the NaCl (>1 %) and sucrose levels increased, the Ah biofilm formation and the binding between Ah cells and monoclonal antibodies (mAbs, for immunodetection) decreased. Elevated ammonia nitrogen and nitric nitrogen levels generated no significant impact on Ah biofilm formation or immunodetection (P > 0.05). The expression of mAbs-targeted Omp remained unchanged under high NaCl or sucrose conditions. Further analysis showed that high sucrose conditions led to the over-expression of the extracellular polysaccharides (PS) and promoted the formation of capsule-like structures. These over-expressed PS and capsule structures might be one reason explaining the inhibited immunodetection efficacy. Results generated from this study provide crucial insights for the design of recovery and detection protocols for Ah present in food or environmental samples.