Large Subunit rDNA Research Articles

Kgaria (Boletaceae, Boletoideae) gen. nov. in Australia: Neither a Tylopilus nor a Porphyrellus.

Kgaria is described as a new porphyrellus-like genus of Boletaceae to accommodate Tylopilus cyanogranulifer, a dark brown to dull lilac/violet, or rarely, nearly black bolete with a series of oxidation reactions progressing from blue to red then nearly black and a dark brown spore deposit. Idiosyncratic blue-green pigment encrustations (cyanogranules) and a similarly colored reaction of the hyphae located on pileus and stipe surfaces are also diagnostic. Phylogenetic analyses of nuclear large-subunit rDNA (nrLSU), translation elongation factor 1-alpha (tef-1), and the second largest subunit of RNA polymerase II (rpb2) infer Kgaria as a unique generic lineage with two species, one of which is newly described (K. similis). Tylopilus olivaceoporus, originally described at the same time and as distinct from T. cyanogranulifer, appears to be conspecific with the latter. Some darkly pigmented taxa with similar oxidation reactions that were recently described from Brazil, Guyana, and China are further supported by morphology and molecular data as discrete lineages in separate genera in subfamily Boletoideae. Citation: Halling RE, Fechner NA, Holmes G, Davoodian N (2023). Kgaria (Boletaceae, Boletoideae) gen. nov. in Australia: Neither a Tylopilus nor a Porphyrellus. Fungal Systematics and Evolution 12: 31-45. doi: 10.3114/fuse.2023.12.02.

First Report of the guava root-knot nematode (Meloidogyne enterolobii) on Selenicereus costaricensis in Guangxi, China.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Additions to the Xylariomycetidae (Sordariomycetes) Fungal Flora from Northern Thailand: Amphisphaeria chiangmaiensis sp. nov. and A. hydei sp. nov.

ABSTRACT During the continuous investigation into inconspicuous xylarialean species in northern Thailand, two amphisphaeria-like taxa were found in samples collected between July and October 2022. Both taxa have solitary, immersed ascomata with a two-layered peridium and unitunicate asci that are morphologically similar to Amphisphaeria species. Macro–micro morphological comparisons with related taxa and multigene phylogenetic analyses based on combined internal transcribed spacer (ITS), partial 28S large subunit rDNA (LSU), partial RNA polymerase II second largest subunit (rpb2), and partial β-tubulin (tub2) sequences revealed that the two taxa are novel to science. Amphisphaeria chiangmaiensis sp. nov. is distinguished from known taxa by having larger ascomata, a J- apical ring in Melzer’s reagent, and hyaline ascospores. Amphisphaeria hydei sp. nov. differs from its sister taxa in having larger ascomata, a longer ostiolar canal, and longer asci. Morphological descriptions, illustrations, and phylogenetic analyses of two novel taxa are provided herein.

Occurrence of Leaf Rust on Hypericum przewalskii caused by Melampsora kusanoi in China.

Hypericum przewalskii (Hypericum) is a resurgent herb. Hypericin extracted from the same genus, exhibits significant clinical effects and high medicinal value. It has been used in treating AIDS and other medical fields (Song et al., 2005). The plant possesses high ornamental value, strong ecological adaptability, and is a wildflower resource worthy of promotion (Guan et al., 2002; Tan and Zhou, 2014). In August 2022, rust disease caused by a Melampsora species was observed on the leaves of H. przewalskii near the Xianmi Forest Farm in Menyuan, Qinghai Province. Roughly 12% of observed plants were infected. Specimens were examined under a microscope and compared with type specimen descriptions in published literature. Uredinia were found on the undersides of leaves,, scattered, pulverulent, and elliptical, measuring 0.21-0.45mm in length, orange when fresh, yellowing with age, surrounded by the ruptured epidermis mixed with numerous capitate paraphyses. Urediniospores were globose to ellipsoid, containing yellowish, 15.37-20.01×12.73-18.77 µm (mean 17.7-15.8 µm), echinulate, cell walls around 3.6µm. Telial hypophyllous, scattered or aggregated in small irregular groups, subepidermal, 0.3-0.5 mm diam., chestnut-brown when fresh, black with age, teliospores were cylindrical or rod-shaped, colorless to pale yellow, and measured 20.4-31.45×5.76-12.31 μm (mean 25.9-9.1 μm), cell walls around 3.3µm, thick and ranged in color from deep yellow-brown to light brown. A voucher specimen (accession No. QHU194) was deposited in the Department of Agriculture and Animal Husbandry at Qinghai University. DNA was extracted using the CTAB method. PCR amplifications were performed for the internal transcribed spacer (ITS) and large subunit (LSU) rDNA, using specific primer pairs ITS4/ITS5 (Chen 2007) rust and universal primers NL1/NL4 (Liu et al. 2011), respectively. The resulting sequences were assembled and deposited in GenBank (accession nos. OQ676524, OQ678007). Phylogenetic relationships also indicated a high homology between the obtained ITS and LSU sequence was highly homologous to Melampsora sp. (KU641030) and M. gelmii (GU058014). These results further confirmed that the rust fungus collected in Qinghai belongs to Melampsora genus. Based on the morphological characteristics and sequences data, these isolates were identified as M. kusanoi, previously reported on H. gramineum in New Zealand (Dietel P. 1905). Pathogenicity was demonstrated by spraying 5 ml of a suspension of urediniospores (1×104 spores/ml) recovered from infected leaves onto leaves of 10 healthy H. przewalskii, and 10 noninoculated plants served as controls. All plants were maintained in darkness at temperatures of 20 to 25℃ for 2 days and then transferred to a greenhouse at 23℃ and 80% relative humidity, receiving 16 hours of light each day. All the inoculated plants developed characteristic disease symptoms within 8-10 days, the control plants remained symptomless. In this study, the urediospores wall of M. kusanoi was found to be thicker than that reported by Dietel, and we suspect that this may be due to the Qinghai-Tibet Plateau's unique geographical environment. To our knowledge, this is the first report of rust disease on H. przewalskii caused by M. kusanoi in China. Although the severity of disease caused by M. kusanoi in Qinghai is currently minimal, delving into its epidemiology and management in the future is imperative.

Two New Nematode Species, Desmolaimus magnus sp. nov. (Monhysterida, Linhomoeidae) and Metadesmolaimus robustus sp. nov. (Monhysterida, Xyalidae), from the Yellow Sea, China with Phylogenetic Analyses within Linhomoeidae and Xyalidae

Two new species are described from the Rizhao coast along the Yellow Sea. Desmolaimus magnus sp. nov. is characterized by its relatively large body size, faintly striated cuticle, four long cephalic setae, a wide buccal cavity with cuticularized transverse rings, an amphidial fovea at the junction of the buccal cavity and pharynx, a pharynx without a bulb, curved spicules, a gubernaculum with a dorso–caudal apophysis, and an elongated conical tail. Metadesmolaimus robustus sp. nov. is characterized by its relatively large body size, coarsely striated cuticle, spacious buccal cavity with cuticularized rings, six inner labial sensilla setiform, six outer labial setae, and four long cephalic setae. The pharynx is notably muscularized, and the spicules are straight and jointed with a slightly swollen proximal end and a hooked distal end. The gubernaculum is brownish and comma–shaped, and the tail is conico–cylindrical with terminal setae. Phylogenetic analyses using maximum–likelihood and Bayesin inference, based on small subunit and D2–D3 fragment of large subunit rDNA sequences, place Desmolaimus magnus sp. nov. within the framework of the family Linhomoeidae and Metadesmolaimus robustus sp. nov. within Xyalidae. Topology trees at the family level show genera Desmolaimus and Metadesmolaimus as paraphyletic groups, the genus Terschellingia as a monophylectic group, the genus Theristus as a monophylectic group based on SSU sequence, the genus Daptonema as a monophylectic group based on LSU sequence.

Addition of Five Novel Fungal Flora to the Xylariomycetidae (Sordariomycetes, Ascomycota) in Northern Thailand.

The deviation of conventional fungal niches is an important factor in the implications of hidden fungal diversity and global fungal numbers. The Xylariomycetidae (Sordariomycetes, Ascomycota), which is also referred to as xylarialean taxa, has a wide range of species that demonstrate a high degree of variation in their stromatic characteristics, showing either conspicuous or inconspicuous forms. In this study, samples were collected while focusing on temporal and spatial parameters and substrate characteristics. Based on internal transcribed spacer (ITS), 28S large subunit rDNA (LSU), RNA polymerase II second largest subunit (RPB2), and β-tubulin (TUB2) multigene phylogeny and morphology, five new species are introduced as Muscodor brunneascosporus, M. lamphunensis (Xylariaceae), Nigropunctata hydei, N. saccata (Incertae sedis), and Xenoanthostomella parvispora (Gyrotrichaceae). Plant substrates in the early stages of decay and attached to the host were feasible sample niches, with an emphasis on the collection of inconspicuous, hidden xylarialean species. The appearance of inconspicuous saprobic xylarialean forms during the rainy season may be linked to the change in nutritional mode, from endophytic mode during the dry season to saprobic in the wet. Therefore, it would be fascinating to concentrate future research on how seasonal fluctuations affect nutritional mode shifts, especially in northern Thailand, which would provide the optimal spatial characteristics. In order to establish a comprehensive linkage between endophytic and saprobic modes, it is imperative to have a substantial representation of endophytic isolate sequences resembling inconspicuous xylariaceous fungi within publicly accessible databases.

First report of Melampsora ferrinii (pucciniales) on Babylon willow (Salix babylonica) in Iran

As an agroforestry resource willow species (Salix spp.) becoming increasingly important in the protection of riverbanks, recovery of floodable lands, soil bioremediation, biomass production, and wicker furniture manufacture, Babylon willow (Salix babylonica) is widely planted all over the world and is found throughout Iran as part of the rural landscape and is mostly planted for ornamental or bioremediation purposes. Rust fungi in the genus Melampsora usually cause disease on Salix species. Identification of Melampsora species is often complicated because there are few differences in spore morphology and little publicly available comparative sequence data. Willow trees in Iran have been reported to be infected by 15 Melampsora species; however, most of these records are based on morphological characterization. During surveillance activities carried out in June 2007, a rust species was detected on isolated Babylon willow trees in an area in Northern Iran. Both the rust fungus and the host plant were identified on the basis of morphological features and DNA sequencing. Based on a combination of morphology, large subunit (LSU) rDNA sequencing and phylogenetic analyses, our rust specimen was identified as Melampsora ferrinii, which is newly reported from Iran on Salix babylonica. Melampsora ferrinii was originally described from the Americas and this is the first time this rust has been observed on its telial host, Babylon willow, in Asia. The documentation of the rust fungus was performed using both scanning electron microscopy (SEM) and light microscopy. Additionally, an identification key for Melampsora species reported on Salix spp. in Iran is included.

Identification and Pathogenicity of Neophysopella vitis Causing Rust Disease on Meliosma myriantha in Korea

Rust symptoms on <i>Meliosma myriantha</i> trees have been noticed during disease surveys in Korea since 2010, with a high disease incidence frequently surpassing 90%. The causal fungus of the rust disease was identified as <i>Neophysopella vitis</i> based on the morphological investigation and molecular sequence analysis of the internal transcribed spacer (ITS) and large subunit (LSU) rDNA regions. This is the first report of rust disease caused by <i>N. vitis</i> on <i>M. myriantha</i> in Korea. A pathogenicity assay proved that <i>M. myriantha</i> serves as the aecial host of <i>N. vitis</i> as spermogonia and aeciospores were produced, which can infect the two uredinial hosts, Boston ivy (<i>Parthenocissus tricuspidata</i>) and Virginia creeper (<i>Parthenocissus quinquefolia</i>).

Identification, pathogenicity, and fungicide sensitivity of Eutiarosporella dactylidis associated with leaf blight on maize in China

Maize (Zea mays L.) is an economically vital grain crop that is cultivated worldwide. In 2011, a maize foliar disease was detected in Lingtai and Lintao counties in Gansu Province, China. The characteristic signs and symptoms of this disease include irregular chlorotic lesions on the tips and edges of infected leaves and black punctate fruiting bodies in dead leaf tissues. Given favourable environmental conditions, this disease spread to areas surrounding Gansu. In this study, infected leaves were collected from Gansu and Ningxia Hui Autonomous Region between 2018 and 2020 to identify the disease-causing pathogen. Based on morphological features, pathogenicity tests, and multi-locus phylogenetic analysis involving internal transcribed spacer (ITS), 18S small subunit rDNA (SSU), 28S large subunit rDNA (LSU), translation elongation factor 1-alpha (TEF), and β-tubulin (TUB) sequences, Eutiarosporella dactylidis was identified as the causative pathogen of this newly discovered leaf blight. Furthermore, an in vitro bioassay was conducted on representative strains using six fungicides, and both fludioxonil and carbendazim were found to significantly inhibit the mycelial growth of E. dactylidis. The results of this study provide a reference for the detection and management of Eutiarosporella leaf blight.

First report of Neoscytalidium dimidiatum as the causal agent of leaf blight on Clivia miniata

In this survey, the symptomatic leaves of Clivia miniata were collected from a greenhouse in Karaj city of Iran. The isolation and morphological investigation showed Scytalidium-like fungus associated with leaf blight symptom. The phylogenetic analysis of the internal transcribed spacer along with partial sequences of rDNA large subunit and translation elongation factor 1-α (tef-1α) genomic regions confirmed the identification of the recovered isolate as Neoscytalidium dimidiatum. The pycnidial morph of the fungus didn’t observe both in vitro and in vivo. The pathogenicity test on C. miniata and C. nobilis was also conducted to fulfill the Koch’s postulates. To our Knowledges, this is the first report of N. dimidiatum causing leaf blight disease on C. miniata and C. nobilis worldwide, as well as these host plants are new for N. dimidiatum in the world.

Studies on the complex Warnowiaceae (Dinophyceae) I. Lohmann’s Pouchetia parva refound and renamed Nematodinium parvum comb. nov. (= Warnowia parva)

ABSTRACT The dinoflagellate family Warnowiaceae has often been considered to include some of the most complex cells among the protists. The number of described species is around 40, but both the species and generic concepts are in need of revision. Warnowiaceans are often fragile and readily change morphology under the light microscope, and they are usually regarded to be rare. They are particularly famous for the eye-like structures, termed ocelloids. Studies on warnowiaceans are hampered by lack of cultures, and our studies are therefore based on cells obtained directly from field samples. We provide a description of Nematodinium parvum comb. nov. (syn. Pouchetia parva, Warnowia parva), based on light, scanning and transmission electron microscopy, combined with phylogenetic analyses of ribosomal genes. It was described in 1908 by Lohmann from Kieler Bay, but is often common in Danish waters, allowing observations on distribution and behaviour. Crucial conditions for finding high cell abundances were periods of warm temperatures and a calm sea. Cells were yellowish, photosynthetic, and contained a net-like chloroplast, in addition to an ocelloid, trichocysts and harpoon-like nematocysts. They divided asexually but planozygotes were also seen. Following the demonstration of nematocysts, the species, which has been known as Warnowia parva since 1928, is transferred to Nematodinium. The finding of a peduncle indicates mixotrophy but all feeding experiments failed to identify a suitable prey. The phylogenetic analyses based on single-cell PCR and sequence determinations of small and large subunit rDNA confirmed that the systematics of Nematodinium and Warnowia is in a state of flux.

Diversity of hyperparasitic fungi on Meliolales (Sordariomycetes, Ascomycota): new species, records, and molecular data from Benin and Panama

Meliolales (black mildews) is an order of plant parasitic ascomycetous fungi in the tropics and subtropics. They are frequently overgrown and parasitized by other fungi, known as hyperparasites. During the last few years, species of hyperparasitic fungi on Meliolales have been collected in Benin and Panama. A new species of Paranectria and seven new reports of hyperparasites of different systematic groups are presented here with detailed descriptions and illustrations, together with new data concerning fungal hosts and host plants. The new species is called Paranectria longiappendiculata, characterized by exceptionally long appendages carried by the ascospores. New records for Benin and Panama are Calloriopsis herpotricha, Dimerosporiella cephalosporii, Isthmospora glabra, Isthmospora trichophila, Malacaria meliolicola, Paranectriella hemileiae, and Paranectriella minuta. Calloriopsis herpotricha is recorded for Africa and D. cephalosporii and P. hemileiae for America for the first time, suggesting an apparently pantropical distribution. Findings show a blatant lack of investigation on hyperparasitic fungi in the tropics. The phylogenetic positions of three of these newly reported species, C. herpotricha, D. cephalosporii, and P. minuta, are shown based on the analysis of internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) rDNA sequences. These sequences were generated in the context of the present study for the first time.

New Resinogalea species from Araucaria araucana resin in Chile and reclassification of the genus in the Cryptocaliciomycetidae.

Araucaria araucana is an ancient conifer, native to the mountain ranges in Chile and Argentina. These trees host a large number of organisms, mainly insects, strongly or even exclusively associated with them. The recent emergence of a novel canker disease on A. araucana has emphasised the importance of fungi associated with these iconic trees and has resulted in the discovery of various new species. In this study, we considered the identity of an unknown calicioid fungus consistently found on resin on the branches of A. araucana. Preliminary phylogenetic analyses placed isolates in the recently described sub-class Cryptocaliciomycetidae, closest to Cryptocalicium blascoi. However, the morphology of the ascomata and its occurrence in a unique niche suggested that the closest relative could be Resinogalea humboldtensis (Bruceomycetaceae, incertae sedis), a fungus with similar sporing structures found on resin of Araucaria humboldtensis in New Caledonia. There are no living cultures or sequence data available for either R. humboldtensis or its supposed closest relative, Bruceomyces castoris, precluding sequence-based comparisons. Morphological comparisons of the sporing structures on A. araucana confirmed that the ascomatal morphology of our unknown calicioid fungus and R. humboldtensis are almost identical and resemble each other more so than B. castoris or Cr. blascoi. A phylogenetic analysis based on the small subunit (SSU), internal transcribed spacer (ITS) and large subunit (LSU) rDNA regions resolved our strains into two clades with Cr. blascoi as its closest relative. Further analyses applying the Genealogical Concordance Phylogenetic Species Recognition (GCPSR) based on ITS, mini chromosome maintenance protein complex (MCM7), RNA polymerase II second largest subunit (RPB2) and translation elongation factor 1-alpha (TEF) gene regions, confirmed that strains represent two new species. Based on our morphological observations and phylogenetic analyses, we introduce two new Resinogalea species, R. araucana and R. tapulicola, and reclassify the genus in the subclass Cryptocaliciomycetidae.

Molecular and morphological studies reveal a new species of Panaeolus (Agaricales, Basidiomycota) from Punjab, Pakistan

Panaeolus punjabensis M. Asif, Q. Firdous, A. Izhar, Niazi & Khalid sp. nov. was collected from three different localities (Bahawalnagar, Kasur, and Lahore) in Punjab, Pakistan. Morphological observations and phylogenetic analyses based on nuclear encoded internal transcribed spacers (ITS1-5.8S-ITS2 = ITS) and D1/D2 domain of large subunit (28S) rDNA confirmed the taxonomic distinctness of this species. The new species is potentially hallucinogenic and characterized by a parabolic pileus with a light brown center, broadly fusiform basidiospores, presence of cheilocystidia, pileocystidia, and caulocystidia, and absence of pleurocystidia and clamp connections. The DNA sequences of the species clustered together in a well-supported distinct clade. We present a detailed description, photographs, and line drawings, and elucidate and discuss the phylogenetic position of the new species. Morphological comparisons with phylogenetically and morphologically allied species are discussed.

Root rot Caused by Setophoma terrestris on Illicium verum in Yunnan Province, China.

Star anise (Illicium verum Hook. f.), a genus of star anise in the family Magnoliaceae, is an important cash crop of "medicinal and food" origin, mainly from China. In August 2021, root rot of I. verum was first observed on more than 80% of the plants grown within a 500 hectares area in Wenshan city, Yunnan Province. At the early stage of the disease, the phloem of the root was dark yellow-brown, and the leaves turn yellow. With further disease development, the whole root became black (Fig. 1a, 1b), and the leaves gradually fall off, affecting the growth, yield and eventually caused death of the whole plant. A total of 20 root samples were collected from typical symptomatic plant roots with 20 years old in Wenshan City (23°18'12″N, 103°56'98″E) and were cut into 2 × 2 mm pieces at the junction of infected and healthy tissue. Each sample was surface-sterilized with 3% NaClO and 75% alcohol for 60 s before rinsing three times with distilled water. The sterile filter paper (5×5 cm) was used to dry the tissue, and samples were cultured on potato dextrose agar (PDA) amended with streptomycin sulfate (50 μg/ml). Plates were incubated at 25°C in the dark in the incubator. From 9 isolates obtained in culture, 7 exhibited the morphology described by Boerema et al. (Boerema et al. 2004) for Setophoma sp. The hyphae were hyaline and septate (Fig.1c). After 14 days of culture on V8 juice agar, white round colonies are formed, but there is no groove in the middle of the colonies (Fig.1d), and transparent, oval, or cylindrical conidia were produced, 6.0-8.0 x 2.5 to 4.0 um (Fig.1e). DNA was extracted from a representative isolate BJGF-04 for molecular identification using a fungal genomic DNA extraction kit (Solarbio, Beijing, China). Polymerase chain reactions (PCRs) were performed with primers ITS1/ITS4 for the internal transcribed spacer (ITS) region (White et al. 1990) and primers T1/β-Sandy-R for the β-tubulin gene (TUB) region (Yang et al. 2017) and primers NL3/ LR5 for 28S large subunit rDNA (LSU) region (Hu et al. 2021) and NS1/ NS4 for 5.8S large subunit rDNA (SSU) region (Mahesha et al. 2021). Newly generated representative sequences were deposited in GenBank: ITS sequence (ON645256), TUB sequence (ON854484), and LSU sequence (ON644445), SSU sequence (ON644451). were sequenced and blasted, showing 99 to 100% sequence homology with known S. terrestris. Pathogenicity was performed using one-year asymptomatic plants of I. verum. A conidial suspension (1 x 106 conidia/ml) collected from V8 juice cultures with 0.05% Tween buffer was poured at a volume of 10 ml/plant. Three individual seedlings were used as replicates for each treatment, and sterile water was used as the negative control. All plants were placed in an artificial climate incubator at 25°C under 90% relative humidity. After 20 days, all inoculated plants showed symptoms identical to those described above, whereas controls remained healthy. Setophoma terrestris was reisolated from the infected roots, which was confirmed by morphological and molecular identification, which completed Koch's postulates. To our knowledge, this is the first report of S. terrestris as a causal agent of root rot on I. verum in China.

Morphological and molecular characterization, including parasitic and pathogenic studies of a new spherical cyst nematode species, Globodera vulgaris n. sp. (Nematoda: Heteroderidae), associated with potatoes in China.

In this study, a new spherical cyst nematode belonging to the genus Globodera, herein described as Globodera vulgaris n. sp., was extracted from the roots and rhizosphere soil of potato and circumjacent weeds belonging to different families in three provinces in southwest China. The new species was characterized by 8-24 ridges between the anus and fenestra and an average Granek's ratio of 2.8-3.8 in cysts, a head with 3-4 annules and dorsal knob anteriorly projected and ventral knobs round or anteriorly projected in second stage juveniles, and a head with 3-5 annules, spicule short and average length less than 30.0 μm, with a developed velum in males. Pathogenicity tests showed that G. vulgaris n. sp. infected potato but did not damage or affect the potato yield compared to control, and it parasitized tomato with a low reproduction rate (RF < 1) while did not parasitize tobacco (RF = 0). The new species was close to G. rostochiensis based on molecular diagnostic marker sequences and constructed phylogenetic analysis, that is internal transcribed spacers of ribosomal DNA (ITS), large-subunit rDNA (LSU) and small-subunit rDNA (SSU). However, the new species exhibited differences from G. rostochiensis in terms of morphological characteristics, a wide host preference, lack of damage to hosts, and egg hatching rate induced by hatching factors.

First report of Didymella glomerata causing leaf spot on Lonicera caerulea L. in Heilongjiang province, China.

China has the largest blue honeysuckle (Lonicera caerulea L.) cultivation area globally. In June 2022, leaf spots were observed on approximately 10% of blue honeysuckle (cv. 'Lanjingling') leaves in a 0.03-ha field in Harbin (127.66°E, 45.61°N), Heilongjiang Province, China. The leaves of the affected plants displayed chlorotic to tan dieback with a darker brown margin along the leaftip and leave margins. Cross-sectional segments of approximately 3 mm were cut from 50 typical infected plant leaves. Their surfaces were sterilized with 75% ethanol for 30 s followed by 3 min in 5% sodium hypochlorite (NaOCl), rinsed three times with sterile water, and transferred to 9-cm Petri dishes containing 15 ml of sterile PDA growth medium. Five purified cultures with similar culture characteristics were finally obtained and their colonies were dark brown on the PDA plates. The pycnidia were subglobular and deep black and measured avg. 215.48 (135.30-331.20) μm × avg. 170.28 (99.90-282.90) μm (n = 50) (Chen et al., 2015; Huang et al., 2018). Conidia were single-celled, hyaline, and ellipsoidal and measured avg. 6.22 (5.40-7.20) µm × avg. 3.42 (2.70-3.90) µm (n = 50). For molecular verification, genomic DNA was extracted from a representative isolate, LD-75. The internal transcribed spacer region (ITS), the second-largest subunit of RNA polymerase II (rpb2), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and actin (ACT) genes were amplified with the primers ITS1/ITS4, RPB2f/RPB2r, LROR/LR7, TUB2Fd/TUB4Rd, and ACT512f/ACT783R, respectively (White et al. 1990; Carbone and Kohn, 1999; Staats et al., 2005; de Gruyter et al., 2009; Chen et al., 2015). BLAST results indicated that the genes of LD-75 (GenBank OP218870, OP264863, OQ561448, OQ597233, and OQ597232) shared 99%-100% identity with those of Didymella glomerata (OK485138, GU371781, EU754185, MZ073910, and MW963190, respectively). Therefore, based on morphological characteristics and molecular phylogeny, LD-75 was identified as D. glomerata. Six two-year-old healthy plants from the 'Lanjingling' cultivar were selected for a pathogenicity test. The leaves were surface disinfested with 75% ethanol and then wiped with sterilized water three times. All plants were cultured in a greenhouse at 28℃ under a 12-h light/dark cycle. Whole plants sprayed with conidial suspension of isolate LD-75 (106 spores/mL) (n = 3) displayed leaf spot symptoms after 14 d, while no symptoms were detected on whole plants sprayed with sterile water (n = 3). The same isolate, reisolated from infected leaves and with the same morphological and molecular traits, was also identified as D. glomerata, confirming Koch's postulate. The fungus was previously reported in Cornus officinalis in Nanyang City, China (Huang et al., 2018). To our knowledge, this is the first report of blue honeysuckle leaf spot caused by D. glomerata in China. Reducing blue honeysuckle production losses caused by leaf spots is crucial for growers, and we hope that researchers will develop efficient control strategies for managing this emerging plant disease.

First Report of Epicoccum latusicollum Causing Leaf Spot Disease on Banana in China.

Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (∼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 μl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 μm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 μm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and β-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

First Report of Stagonosporopsis caricae Causing Chayote Leaf Spot in Guizhou Province, China.

At present, chayote (Sechium edule (Jacq.) Swartz) have been widely planted in Guizhou Province, southwestern China, and the cultivation area in Huishui county ranks first among all the counties or cities in Guizhou Province. Chayote leaf spot was firstly observed in Huishui County (25.99°N, 106.64°E) from April to June in 2019. The disease incidence ranged from 52% to 58%, and the severity of leaf symptoms ranged from 34 to 41% across nine chayote plantations. Such levels disease development lead to considerable enocomic losses. Leaf lesions initially occurred at the leaf margins, and the lesions expanded gradually, becoming dark brown and irregularly shaped. To identify the leaf spot-associated pathogen, the samples were cut from lesion margins, sterilized with 75% ethanol followed by 0.5% sodium hypochlorite for 30 s, rinsed with sterile water three times, and transferred onto potato dextrose agar (PDA). They were then incubated at 25°C in darkness for 5 days. The hyphal tips from the margins of growing colonies were successively transferred to fresh PDA plates for obtaining isolates. All strains grew with a similar morphology on PDA, malt extract agar (MEA), and oatmeal agar (OA) plates, and the colonies presented smooth margins and abundant mycelia on all three media. The colonies were gray to light green on PDA and gray on MEA and OA at 5 days post-inoculation. At 11 days post-inoculation on 10% V8 medium at 25oC with a cycle of 14 h/ultraviolet light and 10 h/night, sexual morph was observed, ascomata pseudothecioid, subglobose, 121 × 142 μm, ostiolate, walls of brown textura angularis, and smooth. Asci were bitunicate, cylindrical to clavate, 7 × 90 μm, 8-spored, ascospores elliptical, straight to slightly curved, 5 × 17 μm, 1-septate, constricted at the septum, sub-hyaline, and smooth. Conidiomata were pycnidial, subglobose, 166 × 258 μm, ostiolate, wall of dark brown to black textura angularis, smooth. Conidia were short, cylindrical or slightly reniform, 6.18 ± 0.67 × 3.51 ± 0.33 μm (n = 50), 0-1 septate, hyaline, smooth. Chlamydospores were subhyaline to dark brown, verruculose or incidentally tuberculate, and solitary or in chains, and 14.16 ± 1.23 × 5.92 ± 0.49 μm (n = 50). The morphological characteristics of the strains were identical to those of Stagonosporopsis caricae (Aveskamp et al. 2010; Sivanesan 1990). The genes or DNA sequences of the partial 28S large subunit rDNA, the internal transcribed spacer, RNA polymerase II second largest subunit, and beta-tubulin were amplified (Liu et al. 1999; Rehner and Samuels 1994; Sung et al. 2007; Vilgalys and Hester, 1990; White et al. 1990; Woudenberg et al. 2009). The sequences were further deposited in GenBank (ITS: MZ619042-MZ619044, LSU: MZ620651-MZ620653, RPB2: MZ673652-MZ673654, and TUB: MZ673649-MZ673651). A phylogenetic analysis confirmed these strains to be identical to S. caricae reference strains CBS 248.90, CBS 282.76, and PD 06/03082531. Pathogenicity tests were performed on potted chayote and five-year-old chayote in the field. Mycelial plugs (6 mm diameter) were applied on wounded chayote leaves. Brown spots appeared on the wounded sites of chayote leaves after inoculation with mycelial plugs. No symptoms were observed on the leaves inoculated with PDA plugs lacking mycelia. The re-isolated pathogen from diseased plants was identical to the representative strains used for inoculation. To our knowledge, this is the first report of S. caricae causing leaf spot on chayote in China, and our findings will be useful for its management and further research.