Large Multimers Research Articles

Cardiac implications of thrombotic thrombocytopenic purpura.

Thrombotic thrombocytopenic purpura (TTP) is a multisystem disorder that essentially can affect any organ in the human body. The hallmark of the pathogenesis in TTP is the large von Willebrand factor multimers on platelet-mediated micro-thrombi formation, leading to microvascular thrombosis. Autopsy studies showed that cardiac arrest and myocardial infarction are the most common immediate causes of death in these patients. Clinical manifestations of cardiac involvement in TTP vary dramatically, from asymptomatic elevation of cardiac biomarkers, to heart failure, MI and sudden cardiac death. There is limited knowledge about optimal cardiac evaluation and management in patients with TTP. The absence of typical cardiac symptoms, combined with complicated multi-organ involvement in TTP, may contribute to the under-utilization of cardiac evaluation and treatment. Prompt diagnosis and timely initiation of effective therapy could be critically important in selected cases. Based on our experience and this review of the literature, we developed several recommendations for focused cardiac evaluation for patients with acute TTP: (1) patients with suspected or confirmed TTP should be screened for the potential presence of cardiac involvement with detailed history and physical, electrocardiogram and cardiac enzymes; (2) clinical deterioration of TTP patients warrants immediate cardiac reevaluation; (3) TTP patients with clinical evidence of cardiac involvement should be monitored for telemetry, cardiac biomarkers and evaluated with transthoracic echocardiography. These patients require urgent targeted TTP treatment as well as cardiac-specific treatment. Aspirin therapy is indicated for all TTP patients. Since epicardial coronary artery involvement is rare, cardiac catheterization is usually not required, given the high risk for hemorrhage and kidney injury; (4) we recommend evidence-based medical therapy for ischemic symptoms and heart failure. TTP patients with evidence of cardiac involvement would also benefit from routine cardiology follow up during remission.

Active and Ultra-Large Von Willebrand Factor Is Significantly Elevated in Patients with Immune Thrombotic Thrombocytopenic Purpura

▪Background: Immune thrombotic thrombocytopenic purpura (iTTP), a potentially fatal hematological emergency, is primarily caused by acquired deficiency of ADAMTS13 activity due to autoantibodies. Immunoglobulin G (IgG)-type autoantibodies bind ADAMTS13 and inhibit its ability to cleave endothelium-derived ultra large von Willebrand factor (ULVWF). However, it remains poorly understood whether plasma VWF status can be used as a disease marker for diagnosis and monitoring therapy in patients with acute iTTP.Objective: To address this question, we determined plasma levels of VWF antigen (VWF:Ag), collagen-binding activity (VWF:CB), active forms of VWF (VWF:Ac), and VWF multimers in iTTP patients during acute episode and in early remission.Patients and Methods: From the Alabama registry, we identified 69 unique patients with a confirmed diagnosis of iTTP in whom plasma ADAMTS13 activity was <10 U/dL with positive inhibitors and elevated anti-ADAMTS13 IgGs. Of 69 patients, 21 had longitudinal plasma samples collected. Plasma samples from 56 healthy individuals, who did not have a hematological disease, cancer, and infection, were recruited as controls. Plasma levels of VWF:Ag, VWF:CB, and VWF:Ac were determined by an ELISA-based assay. Plasma VWF multimer distribution was assessed by an in-gel Western blotting assay following electrophoresis on a 1% SDS-agarose gel.Results: The mean age for our cohort iTTP patients was 43.9 ± 13.4 years. Twenty-six patients were male and 43 were female with male to female ratio of 1 to 1.7. Fifty-three patients were African American descents, 14 Caucasians, 1 Hispanic, and 1 unknown race. Plasma levels of VWF:Ag in acute iTTP patients were 289.4 ± 17.7%, significantly increased compared with those in the healthy controls (144.9 ± 7.6%) (p<0.0001); plasma levels of VWF:CB in these patients were 241 ± 17.9%, also significantly elevated compared with those in the healthy controls (149.9 ± 12.01%) (p=0.0001); additionally, plasma levels of VWF:Ac (304.6 ± 23.2%), assessed by its ability to bind anti-VWF-A1 nanobody, were more dramatically elevated compared with those in the controls (101.6 ± 5.9%) (p<0.0001). More interestingly, while the ratios of VWF:CB to VWF:Ag in patients with acute iTTP (0.8 ± 0.04) were lower than those in the healthy controls (1.0 ± 0.05) (p=0.0036), the ratios of VWF:Ac to VWF:Ag were significantly higher in patients with acute episode (1.2 ± 0.1) than those in the controls (0.8 ± 0.05) (p=0.0003). Furthermore, there was no statistically significant difference in the patient plasma levels of VWF:Ag (p=0.69) and VWF:CB (p=0.08) during acute episode and during early remission. However, the plasma levels of VWF:Ac in patients with acute disease were significantly higher than those in the early remission (p=0.002). Surprisingly, 90% (36/40) of out iTTP patients during acute episode showed the presence of ULVWF in their plasma using in-gel Western blotting, which allows the ULVWF to be detected without the transfer step to avoid any potential loss of larger VWF multimers during protein transfer. These ULVWF multimers disappeared in 3/4 iTTP patients in remission when ADAMTS13 activity recovered. In 28 healthy control samples, only one showed ULVWF.Conclusion: Our results demonstrate, for the first time in a large cohort, that active forms of VWF and ultra large VWF multimers are present in iTTP patient's plasma during the acute period, which is reduced or disappears during the early remission. Therefore, measuring active forms of VWF and ultra large VWF multimers may aid in diagnosis of iTTP and help monitoring of disease processes following therapy. Our ongoing study is to determine whether these biomarkers can be used to predict responses to treatment and long-term outcome. DisclosuresZheng:Alexion: Research Funding, Speakers Bureau.

Effect of Intravenous and Oral N-Acetylcysteine Treatment in a Patient with Sickle Cell Disease at Disease Baseline

Background: We previously showed that patients with sickle cell disease (SCD) have elevated levels of von Willebrand factor (VWF) with high adhesive activity and the level of total active VWF correlated with hemolysis at disease baseline. These findings suggest that VWF plays a role in the pathophysiology of SCD [Chen et al, Blood. 2011; 117:3680‐3]. We also showed that N-acetylcysteine (NAC), a mucolytic and antioxidant drug, can reduce the level of large VWF multimers and platelet adhesion in human plasma in vitro and in mice in vivo [Chen et al, JCI, 2011, 121:522]. Based on these findings, we hypothesized that administration of NAC in SCD patients might reduce VWF multimers in vivo and reduce oxidative stress by scavenging reactive oxygen species (ROS). We started a pilot study to evaluate the effects of intravenous (IV) and oral NAC administration in SCD patients at disease baseline (NCT01800526). In this report, we administered NAC to one patient by IV and orally and compared the effect on biomarkers by the two routes of NAC administration.Patient and protocol: The subject is a 51-year-old male with SS genotype, a history of leg ulcers and acute chest syndrome, and who was not taking hydroxyurea at the time of the study. NAC was infused at a low dose (150 mg/kg over 8 hours) and infusion was repeated at high dose (300 mg/kg over 8 hrs) after 4 weeks. Blood samples were collected before (0), during (4 hr) and after the NAC infusions (8, 24 and 72 hr). Five months after the high dose IV infusion, during which parameters returned to baseline levels, oral NAC was administered for 4 weeks at 2.4g/day. Weekly blood samples were collected four weeks before the start of oral NAC, during oral NAC, and one week after oral NAC administration. We measured RBC parameters and RBC fragments, dense cells and percentage of platelet-monocyte complexes (PMC) by flow cytometry. We also analyzed VWF antigen, VWF multimers, ADAMTS13 antigen and activity levels in plasma. We also measured total, oxidized and reduced forms of NAC, cysteine and glutathione levels in plasma and whole blood by mass spectrometry.Results: 1) The subject did not experience adverse side effect during and after the treatment period. 2) RBC, hemoglobin and hematocrit levels did not significantly change with either IV or oral NAC treatment. Oral and IV NAC decreased dense cell and RBC fragments. NAC reduced the number of dense cells 13% during low dose IV, 79% during high dose IV and 73% with the oral administration. Compared to baseline, RBC fragments decreased 40% during low dose IV, 28% during high dose IV, and 27% with the oral NAC treatment. 3) NAC reduced formation of PMC from 71% to 24% (low dose IV), from 72% to 35% (high dose IV), and from 62% to 27% (oral). 4) VWF multimer size significantly decreased during low and high dose NAC infusions but did not change with oral NAC administration. VWF antigen and ADAMTS13 activity levels did not change with either routes of NAC administration. 5) The concentration of NAC in whole blood increased during treatments: elevated to 0.5 mM and 1 mM at the end of low- and high-dose IV infusions, respectively. At the conclusion of oral administration, the NAC concentration was 4 µM. Total glutathione concentrations in whole blood did not change significantly during and after NAC treatment at either dose or by either route. Free Cys concentrations in plasma increased compared to respective baseline levels 10-fold for low dose infusion (from 10 µM to 101 µM), 20-fold for high dose infusion (from 9 µM to 200 µM), but the level did not change significantly for oral administration (from 5 µM to 7 µM). Protein-bound Cys levels in plasma as markers of oxidative stress were significantly decreased with low- and high-dose IV infusion. However, the level did not change significantly with oral NAC administration.Summary: Both IV and oral administration of NAC were safe and well tolerated in the patient with SCD. Both IV and oral administration reduced the number of dense cells, RBC fragmentation, and formation of PMCs. IV, but not oral NAC, reduced VWF multimer size. These finding suggest that IV administration resulted in higher concentration and had more biologic effects; however both approaches may have a role in treatment of patients with SCD. DisclosuresKonkle:Sangamo: Research Funding; Gilead: Consultancy; Shire: Research Funding; Genentech: Consultancy; CSL Behring: Consultancy; Bioverativ: Research Funding; BioMarin: Consultancy; Spark: Consultancy, Research Funding; Pfizer: Research Funding.

Variable Clinical Presentation of Congenital Thrombotic Thrombocytopenic Purpura in a Large Cohort of Patients Carrying a New Mutation in the CUB1 Domain of ADAMTS13 Gene

Introduction:Congenital TTP (Thrombotic Thrombocytopenic Purpura) is a rare life-threatening inherited disorder, resulted from mutations in ADAMTS13 gene. Such mutations interfere with ADAMTS13 enzyme production or function, subsequently resulting in microangiopathic hemolytic anemia (MAHA) and microvascular thrombosis. The investigation of congenital TTP is challenging because of its rarity with an estimated prevalence ranging from 0.4 to 16.7 cases per million and about 150 identified mutations. Recently, we identified a cohort of patients with congenital TTP from three consanguineous families of Arab Bedouin origin in southern Israel. All patients have the same, previously unidentified mutation c.3772 delA in the ADAMTS13 gene. In this single center prospective cohort study, we present patients' genetic, clinical and laboratory data and results of the abnormal ADAMTS13 protein Western blot analysis.Methods:Patients with episodes of MAHA and thrombocytopenia were diagnosed with congenital TTP by abnormally low ADAMTS13 activity and absence of inhibitory autoantibodies (Table 1). Subsequently, patients were referred for genetic testing. Patients' DNA served for PCR amplification of the exons of ADAMTS13 (NM_139026) followed by direct sequencing of the PCR products. The mutation was found in exon 28, the primers used for PCR were forward: atgtccctatgtcccacctg and reverse: ctgtccagaatcacagcacaa (annealing temperature 61°C).Western blot analysis of the abnormal ADAMTS13 protein was performed according to the method previously described by Zheng et al, using antihuman ADAMTS13 rabbit polyclonal antibody (ab28274; Abcam, Cambridge, UK).Patients' clinical and laboratory parameters were collected at diagnosis and during follow-up.The study was approved by the institutional research ethics board.Results:We identified a novel mutation on chromosome 9:136323172del A (GRCh37/hg19) in coding exon 28, c.3772 del A (NM_139026), causing p.N1258T fs Ter 15 of ADAMTS13 gene close to the C-terminus of the 1427-amino acid long protein (Fig.1). We validated that all patients in our cohort are homozygous for the mutation. The mutation is found within the CUB1 domain and the frameshift is predicted to result in the loss of the next 169 highly conserved amino acids of the full-length protein that contains the CUB2 domain, normally responsible for cleavage of large VWF multimers under flow conditions.Our Western blot analysis of the abnormal protein (Fig. 2) demonstrates that a 170-190 Kd band is missing in plasma of five patients, compared to four controls. These results suggest that the mutation may interfere with the entire enzyme production.The cohort consists of 17 homozygotic patients (3 males and 14 females), all belong to three closely related families of Arab Bedouin descent with high rate of consanguinity. All 17 patients in this cohort have blood group A. This finding may represent genetic linkage disequilibrium between the ADAMTS13 gene and the transferase gene, both found on chromosome 9 in close proximity.Despite the fact that all the patients are homozygous for the same mutation and belong to three closely related families, their presenting symptoms and disease severity were markedly heterogenous (Table 1): eight of 14 female patients initially presented with complications of pregnancy, two presented with laboratory abnormalities, two presented with stroke and two asymptomatic female patients were recognized on family screening. Of three male patients, one presented with Budd-Chiari syndrome, one had laboratory abnormalities alone and one developed a stroke.Conclusion:To the best of our knowledge, this is one of the largest congenital TTP cohorts described in the literature. This cohort is unique due to the fact that all members carry the same, previously unreported, ADAMTS13 gene mutation in the CUB1 domain of the gene. Our findings support an assumption that environmental and hereditary modifiers may influence disease course. Further research of the involved families may enable us to expand the understanding of the pathophysiology and develop better treatment options for this understudied rare condition. [Display omitted] DisclosuresNo relevant conflicts of interest to declare.

Adamts-13 Inhibitor Testing Is Often Negative on Initial Testing

Background:Thrombotic thrombocytopenic purpura (TTP) presents with microangiopathic hemolytic anemia and thrombocytopenia and is caused by severe ADAMTS13 deficiency. TTP can be the result of autoantibodies to ADAMTS13 or genetic defect in the ADAMTS13 gene. ADAMTS-13 is an enzyme that specifically cleaves unusually large von Willebrand Factor (VWF) multimers which mediate platelet thrombus formation under high shear. When ADAMTS13 is deficient, unusually large VWF multimers accumulate causing excessive platelet aggregation and thrombosis in the microvasculature.Methods:St. Michael's Hospital, Toronto is home to a large reference laboratory for special coagulation. We use a commercial ELISA Technoclone Technozym ADAMTS-13 activity assay for the determination of ADAMTS-13 activity and Technoclone Technozym ADAMTS-13 inhibitor assay to identify anti-ADAMTS-13 antibodies. We send samples to another Canadian laboratory for validation of our results as they use an in-house ELISA assay for ADAMTS13 activity and anti-ADAMTS13 antibody.Results:We performed a retrospective review of all ADAMTS13 activity tests performed by our laboratory between January 1, 2013 and June 30, 2018. The total number of tests was 466 from 203 unique patients. 24% had an ADAMTS-13 activity under 10% (N = 144) which is consistent with the diagnosis of TTP.When specimens with severe ADAMTS-13 deficiency were tested for presence of anti-ADAMTS13 antibody, 46% were negative. Four of these specimens were sent to the other laboratory and all had detectable, albeit very low titre, inhibitors. Furthermore, on repeated testing over the study period, the vast majority of patients who presented with low ADAMTS13 activity and no detectable antibody subsequently became antibody positive. Fifty-two patients remained antibody negative by our internal and send-out testing. Five of them were known to have or were subsequently diagnosed with hereditary TTP (hTTP). Only one patient continues to have negative antibody but whose clinical course is not consistent with hTTP.Conclusions:We found that a commercial ADAMTS13 (Technoclone Technozym) antibody assay is falsely negative in a substantial proportion of patients with autoimmune TTP, the majority of which likely had a low titer inhibitor, below the threshold of test detection. More sensitive assays and/or repeated testing, presumably as inhibitor titre increases during the course of the disease, may detect antibody presence in the majority of samples of patients with autoimmune TTP. This is an important finding as this could impact the types of therapies offered to patients with negative antibody screens and may also avoid unnecessary, expensive genetic testing . DisclosuresNo relevant conflicts of interest to declare.

Von Willebrand Factor-GP1bα Interactions in Venoarterial Extracorporeal Membrane Oxygenation Patients

Evaluate extracorporeal membrane oxygenation (ECMO) patients' platelet adhesion and aggregation under shear stress and determine whether addition of von Willebrand factor (VWF) concentrate improves platelet function. Also, explore whether reduced platelet adhesion and aggregation is associated with clinical bleeding during ECMO. Prospective observational cohort study with translational component. Academic medical center. Consecutive venoarterial (VA) ECMO patients were screened and 20 patients enrolled. VWF multimers, VWF antigen, ristocetin cofactor activity, and plasma glycocalicin levels were measured and values were compared at study points: ECMO day 1 or 2, day 3, and day 5. Platelet adhesion and aggregation were measured in vitro using the total thrombus analysis system. Platelet function was expressed as area under the flow-pressure curve (AUC). VWF concentrate was added in vitro and the AUC after VWF supplementation (VWF AUC) was compared with baseline AUC. Further, baseline AUCs and VWF AUCs were compared between patients who experienced bleeding during ECMO and those who did not. ECMO patients had high VWF antigen levels, high ristocetin cofactor activity, and large VWF multimer loss. Platelet counts fell over the first 5 days on ECMO, and plasma glycocalicin levels were elevated mildly. ECMO patients had severely low platelet adhesion and aggregation in vitro: median AUC = 5.8 (3.5-9.7) ECMO day 1 or 2, median AUC = 6.3 (5.3-11.1) day 3, and median AUC = 5.5 (4.1-8.1) day 5. There was no significant change in AUC over time (p = 0.47). Addition of VWF concentrate increased the AUC compared to baseline at each point (all p < 0.05), but VWF AUC values remained low. Patients with bleeding during ECMO had a low VWF AUC at all points, whereas those without bleeding had a higher VWF AUC on ECMO day 3. VA ECMO patients have severely impaired platelet function, which improved but did not normalize with VWF concentrate. The data suggest that GP1bα receptor loss of dysfunction also contributes to impaired platelet adhesion and aggregation during ECMO. Based on these findings, clinical bleeding in ECMO patients is unlikely to be correctable with VWF supplementation alone.

Hemostasis based on a novel 'two-path unifying theory' and classification of hemostatic disorders.

: Hemostasis is the most important protective mechanism for human survival following harmful vascular damage caused by internal disease or external injury. Physiological mechanism of hemostasis is partially understood. Hemostasis can be initiated by either intravascular injury or external bodily injury involving two different levels of damage [i.e., limited to the endothelium or combined with extravascular tissue (EVT)]. In intravascular injury, traumatic damage limited to local endothelium typically is of no consequence, but disease-induced endothelial damage associated with systemic endothelial injury seen in sepsis and other critical illnesses could cause generalized 'endotheliopathy'. It triggers no bleeding but promotes serious endothelial molecular response. If intravascular local trauma extends beyond the endothelium and into EVT, it causes intravascular 'bleeding' and initiate 'clotting' via normal hemostasis. In external bodily injury, local traumatic damage always extends to the endothelium and EVT, and triggers 'bleeding' and 'clotting'. Systemic endotheliopathy activates only unusually large von Willebrand factor multimers (ULVWF) path and mediates 'microthrombogenesis', producing 'microthrombi' strings. This partial activation of hemostasis with ULVWF path leads to vascular microthrombotic disease. But localized traumatic injury extending to the endothelium and EVT activates both ULVWF and tissue factor paths. Combined activation of ULVWF and tissue factor paths provides normal hemostasis in external bodily injury, but causes 'macrothrombus' formation in intravascular injury. This 'two-path unifying theory' concept succinctly elucidates simplified nature of hemostasis in intravascular and external bodily injuries. It also clarifies different pathogenesis of every hemorrhagic disease and thrombotic disorder related to internal vascular disease and external vascular injury.

The elusive and heterogeneous pattern of type 2M von Willebrand disease: A diagnostic challenge.

To investigate type 2M heterogeneity and to establish the most appropriate diagnostic flowchart. Hemostatic and genetic VWF analyses were performed in 14 type 2M VWD patients carrying the p.G1324S, p.R1374H, p.R1374C, p.A1344_A1350del, or p.F1293L mutations. PFA-100 was always significantly prolonged, and ristocetin-induced platelet aggregation (RIPA) and VWF ristocetin cofactor (VWF:RCo) greatly reduced or absent. Plasma VWF antigen (VWF:Ag) was reduced except in the p.G1324S patient, while platelet VWF:Ag was normal or near normal except in the p.R1374C patients. The ratio of collagen binding (VWF:CB) to VWF:Ag was normal or near normal except in patients carrying the p.R1374H and p.A1344_A1350del mutations, whose large VWF multimers were slightly reduced. Multimer patterns were normal or lacking in large oligomers, or with larger than normal VWF components. Only PFA100, RIPA and VWF:RCo were always abnormal. We thus propose a minimal diagnostic test battery: RIPA (demonstrating the defective VWF-platelet interaction), VWF:Ag (exploring VWF synthesis), and VWF:CB and its ratio (to explore multimer patterns). Other tests would only serve for confirmation, if necessary.

ADAMTS13: origins, applications, and prospects.

ADAMTS13 is an enzyme that acts by cleaving prothrombotic von Willebrand factor (VWF) multimers from the vasculature in a highly regulated manner. In pathologic states such as thrombotic thrombocytopenic purpura (TTP) and other thrombotic microangiopathies (TMAs), VWF can bind to the endothelium and form large multimers. As the anchored VWF chains grow, they provide a greater surface area to bind circulating platelets (PLTs), generating unique thrombi that characterize TTP. This results in microvasculature thrombosis, obstruction of blood flow, and ultimately end-organ damage. Initial presentations of TTP usually occur in an acute manner, typically developing due to an autoimmune response toward, or less commonly a congenital deficiency of, ADAMTS13. Triggers for TMAs that can be associated with ADAMTS13 deficiency, including TTP, have been linked to events that place a burden on hemostatic regulation, such as major trauma and pregnancy. The treatment plan for cases of suspected TTP consists of emergent therapeutic plasma exchange that is continued on a daily basis until normalization of PLT counts. However, a subset of these patients does not respond favorably to standard therapies. These patients necessitate a better understanding of their diseases for the advancement of future therapeutic options. Given ADAMTS13's key role in the cleavage of VWF and the prevention of PLT-rich thrombi within the microvasculature, future treatments may include anti-VWF therapeutics, recombinant ADAMTS13 infusions, and ADAMTS13 expression via gene therapy.

Association between the severity of acquired von Willebrand syndrome and gastrointestinal bleeding after continuous-flow left ventricular assist device implantation.

Acquired von Willebrand syndrome, characterized by the reduction in von Willebrand factor (vWF) large multimers, has recently been considered as one of the causes of gastrointestinal bleeding (GIB). It remains unclear whether its haematological severity is linked with susceptibility to bleeding because the definition of the haematological severity of acquired von Willebrand syndrome has not been precisely determined. This study sought to establish a quantitative methodology to assess the haematological severity of acquired von Willebrand syndrome and to define the threshold for occurrence of GIB in patients implanted with left ventricular assist devices (LVADs). In total, 41 patients treated with continuous-flow LVAD implanted between 2011 and 2017 at Tohoku University Hospital were investigated. vWF large multimers were quantitatively evaluated using the 'vWF large multimer index' defined as the ratio of a large multimer proportion in total vWF derived from a patient to that from a normal control. Using this index, the amount of vWF large multimers was expressed as a percentage of its normal control value obtained with a simultaneous analysis of each time measurement. Twelve (29%) patients developed GIB events during follow-up periods (median 591 days) after an LVAD implantation. The vWF large multimer index in patients with GIB was significantly lower than that in those without GIB (25.0 ± 10.3% vs 37.5 ± 17.8%, P = 0.008). Most importantly, all patients experiencing GIB exhibited a vWF large multimer index below 40%. Patients with GIB exhibited a more severe loss of vWF large multimers. The vWF large multimer index may dictate the risk of GIB after an LVAD implantation. UMIN000018135.

Disseminated intravascular coagulation: is it fact or fancy?

: 'Disseminated intravascular coagulation (DIC)' occurs commonly in critical illnesses such as sepsis, trauma, cancer, and complications of surgery and pregnancy. Mortality is very high. The pathogenesis has been ascribed to tissue factor-initiated coagulation disorder, resulting in disseminated microblood clots that are made of platelets, plasma factors, fibrins, and blood cells. True DIC depletes coagulation factors and consumes platelets, and activates fibrinolysis. 'DIC' is assumed to orchestrate thrombocytopenia, microangiopathic hemolytic anemia and hypoxic multiorgan dysfunction syndrome, and causes hemorrhagic disorder due to depleted coagulation factors. In contrast, disseminated intravascular microthrombosis (DIT) occurs in thrombotic thrombocytopenic purpura (TTP) and TTP-like syndrome due to ADAMTS13 deficiency or insufficiency. The pathogenesis is due to formation of intravascular 'microthrombi' composed of complexes of platelets and unusually large von Willebrand factor multimers. Interestingly, DIT also occurs in the same critically ill patients as 'DIC' does. Following activation of complement system, the terminal complex C5b-9 causes endotheliopathy via channel formation to the endothelial cell membrane. Endotheliopathy activates microthrombotic pathway and initiates microthrombogenesis, leading to endotheliopathy-associated DIT. DIT results in TTP-like syndrome with hematologic phenotype of consumptive thrombocytopenia, microangiopathic hemolytic anemia, and multiorgan dysfunction syndrome. In reinterpretation of 'DIC', the true lesion is 'microthrombi' but not microblood clots. Thus, 'DIC' is endotheliopathy-associated DIT. This concept reconciles all the clinical features of 'DIC', and dramatically changes our understanding of pathophysiological mechanism in hemostasis and thrombosis. This new paradigm should assist the physician with correct diagnostic evaluation and treatment intervention.

Mass spectrometry-assisted identification of ADAMTS13-derived peptides presented on HLA-DR and HLA-DQ

Formation of microthrombi is a hallmark of acquired thrombotic thrombocytopenic purpura. These microthrombi originate from insufficient processing of ultra large von Willebrand factor multimers by ADAMTS13 due to the development of anti-ADAMTS13 autoantibodies. Several studies have identified the major histocompatibility complex class II alleles HLA-DRB1*11, HLA-DQB1*03 and HLA-DQB1*02:02 as risk factors for acquired thrombotic thrombocytopenic purpura development. Previous research in our department indicated that ADAMTS13 CUB2 domain-derived peptides FINVAPHAR and LIRDTHSLR are presented on HLA-DRB1*11 and HLA-DRB1*03, respectively. Here, we describe the repertoire of ADAMTS13 peptides presented on HLA-DQ. In parallel, the repertoire of ADAMTS13-derived peptides presented on HLA-DR was monitored. Using HLA-DR- and HLA-DQ-specific antibodies, we purified HLA/peptide complexes from ADAMTS13-pulsed monocyte-derived dendritic cells. Using this approach, we identified ADAMTS13-derived peptides presented on HLA-DR for all 9 samples analyzed; ADAMTS13-derived peptides presented on HLA-DQ were identified in 4 out of 9 samples. We were able to confirm the presentation of the CUB2 domain-derived peptides FINVAPHAR and LIRDTHSLR on HLA-DR. In total, 12 different core-peptide sequences were identified on HLA-DR and 8 on HLA-DQ. For HLA-DR11, several potential new core-peptides were found; 4 novel core-peptides were exclusively identified on HLA-DQ. Furthermore, an in silico analysis was performed using the EpiMatrix and JanusMatrix tools to evaluate the eluted peptides, in the context of HLA-DR, for putative effector or regulatory T-cell responses at the population level. The results from this study provide a basis for the identification of immuno-dominant epitopes on ADAMTS13 involved in the onset of acquired thrombotic thrombocytopenic purpura.

Thrombotic microangiopathy in a very young infant with mitral valvuloplasty

Thrombotic microangiopathies (TMA) are microvascular occlusive disorders characterized by systemic or intrarenal platelet aggregation, thrombocytopenia, and red cell fragmentation. Post-operative TMA mostly occurs in adult patients with cardiovascular surgery, with the distinct pathophysiology from classical thrombotic thrombocytopenic purpura (TTP) although the exact pathophysiology remains unclear. A one-month-old infant developed TMA after the initial surgery of double outlet right ventricle. ADAM metallopeptidase with thrombospondin type 1 motif 13 (ADAMTS13) activity was sustained (64%) with the undetectable inhibitor. Von Willebrand factor (VWF) multimer analyses showed absent high-molecular weight multimers. Echocardiography disclosed severe mitral regurgitation. The mitral valve repair 32 days after the initial valvuloplasty led to prompt resolution of TMA. These suggested that TMA occurred in association with valvulopathy-triggered turbulent shear flow, mechanical hemolysis and endothelial damage. The consumption of large VWF multimers might account for the vascular high shear stress shown in Heyde syndrome. The youngest case of post-operative TMA underscores the critical coagulopathy after the first surgical intervention for congenital heart disease.

A hemostatic disorder caused by high shear stress: acquired von Willebrand syndrome

The von Willebrand factors (VWFs) play critical role in hemostasis and thrombosis formation. VWFs are produced in and secreted as large multimers from endothelial cells, and shear stress-dependently cleaved into 2-80 multimers by their specific protease, ADATS13. Because high molecular weight VWFs play important roles in platelet aggregation, the loss of high molecular weight VWFs caused by pathological high-shear stress induces a hemostatic disorder known as acquired von Willebrand syndrome (AVWS) type IIA. The most well-known cause of this loss is aortic stenosis, which is accompanied by gastrointestinal bleeding most often as a result of angiodysplasia; this comprises a condition known as Heyde's syndrome. Additionally, various cardiovascular diseases that generate excessive high-shear stress in the blood stream, such as hypertrophic obstructive cardiomyopathy (HOCM), mitral regurgitation, pulmonary hypertension, and some congenital heart diseases, and mechanical circulatory support systems, such as left ventricular assist device (LVAD), cause AVWS.

A Mechanistic Model to Quantify von Willebrand Factor Release, Survival and Proteolysis in Patients with von Willebrand Disease.

A reduced von Willebrand factor (VWF) synthesis or survival, or its increased proteolysis, alone or in combination, contributes to the development of von Willebrand disease (VWD).We describe a new, simple mechanistic model for exploring how VWF behaves in well-defined forms of VWD after its 1-desamino-8-D-arginine vasopressin (DDAVP)-induced release from endothelial cells. We aimed to ascertain whether the model can consistently predict VWF kinetic changes. The study involved 9 patients with VWD types Vicenza (a paradigmatic form with a reduced VWF survival), 8 type 2B, 2 type 2A-I, 1 type 2A-II (associated with an increased VWF proteolysis), and 42 normal controls, whose VWF levels were measured after a 24-hour-long DDAVP test. The rate constants considered were: k0, associated with the VWF release phase; k1, illustrating the phase of conversion from high- to low-molecular-weight VWF multimers; and ke, associated with the VWF elimination phase. The amount of VWF released (D) was also measured. ke and D were significantly higher in O than in non-O blood group controls; k1 was also higher, but less markedly so. All the parameters were accelerated in type Vicenza, especially ke (p < 0.0001), which explains the significant reduction in VWF half-life. In types 2B and 2A-II, k1 was one order of magnitude higher than in controls, which explains their loss of large VWF multimers. All parameters except ke were lower in type 2A-I.The proposed mechanistic model clearly describes the altered biochemical pathways in well-characterized VWD, prompting us to suggest that it might help clarify elusive forms of VWD too.

Proteolytic inactivation of ADAMTS13 by plasmin in human plasma: risk of thrombotic thrombocytopenic purpura.

Thrombotic thrombocytopenic purpura (TTP) is caused by inactivation of a von Willebrand factor (VWF)-cleaving enzyme, a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13), which leads to platelet-rich thrombi comprising unusually large VWF multimers. We have found that ADAMTS13 can bind to the inactivated form of plasmin. In addition, plasmin cleaves purified ADAMTS13 into several fragments and inactivates it. Hence, we hypothesized that activation of plasminogen to plasmin becomes a new-onset factor for TTP due to ADAMTS13 inactivation. Plasmin was added exogenously or activated from plasminogen by streprokinase addition in human plasma (HP). ADAMTS13 digestion and effects of the digestion on ADAMTS13 activity were evaluated. Exogenous plasmin cleaved ADAMTS13 into several fragments, but a portion of ADAMTS13 remained in full-length form. Digestion profile of ADAMTS13 with streprokinase added exogenously in HP was similar to that of ADAMTS13 with exogenous plasmin. ADAMTS13 activity measured using FRETS-VWF73 decreased to ∼40% compared with that for normal plasma. Endogenous VWF multimer-cleaving activity was attenuated more severely (∼10%). These data suggest that endogenous plasmin cleaves ADAMTS13 into fragments and reduces its activity to ∼10%. We suggest that endogenous plasmin activation alone is not sufficient to cause TTP, but plasmin activation with ADAMTS13 deficiency might increase the risk of TTP onset.

VWF/ADAMTS13 is associated with on-aspirin residual platelet reactivity and clinical outcome in patients with stable coronary artery disease

BackgroundThe mechanisms behind residual platelet reactivity (RPR) despite aspirin treatment are not established. It has been shown that coronary artery disease (CAD) patients with high on-aspirin RPR have elevated levels of von Willebrand factor (vWF). ADAMTS13 is a metalloprotease cleaving ultra large vWF multimers into less active fragments.Our aim was to investigate whether ADAMTS13 and vWF/ADAMTS13 ratio were associated with high RPR, and further with clinical endpoints after 2 years.MethodsStable aspirin-treated CAD patients (n = 999) from the ASCET trial. RPR was assessed by PFA-100. ADAMTS13 antigen and activity were analysed using chromogenic assays. Endpoints were a composite of acute myocardial infarction, stroke and death.ResultsThe number of patients with high RPR was 258 (25.8%). Their serum thromboxane B2 (TxB2) levels were low, indicating inhibition of COX-1. They had significantly lower levels of ADAMTS13 antigen compared to patients with low RPR (517 vs 544 ng/mL, p = 0.001) and significantly lower ADAMTS13 activity (0.99 vs 1.04 IU/mL, p = 0.020). The differences were more pronounced when relating RPR to ratios of vWF/ADAMTS13 antigen and vWF/ADAMTS13 activity (p < 0.001, both). We found an inverse correlation between vWF and ADAMTS13 antigen (r = −0.14, p < 0.001) and ADAMTS13 activity (r = −0.11, p < 0.001). No correlations between TxB2 and ADAMTS13 antigen or activity, were observed, implying that ADAMTS13 is not involved in TxB2 production. Patients who experienced endpoints (n = 73) had higher vWF level (113 vs 105%, p = 0.032) and vWF/ADAMTS13 antigen ratio (0.23 vs 0.20, p = 0.012) compared to patients without. When dichotomizing vWF/ADAMTS13 antigen at median level we observed that patients above median had higher risk for suffering endpoints, with an adjusted OR of 1.86 (95% CI 1.45, 2.82).ConclusionThese results indicate that ADAMTS13 is of importance for RPR, and that it in combination with vWF also is associated with clinical endpoints in stable CAD patients on aspirin.Trial registrationClinicaltrials.gov NCT00222261. Registered 13.09.2005. Retrospectively registered.

Quantification of Von Willebrand Factor Cleavage by adamts-13 in Patients Supported by Left Ventricular Assist Devices.

Patients supported by left ventricular assist devices (LVADs) often present with the loss of large von Willebrand factor (VWF) multimers. This VWF deficiency is believed to contribute to the bleeding diathesis of patients on LVAD support and is caused by excessive VWF cleavage by the metalloprotease ADAMTS-13 under high shear stress. However, only a small percentage of patients who have suffered the loss of large VWF multimers bleed. The actual rates of VWF cleavage in these patients have not been reported, primarily because of the lack of reliable detection methods. We have developed and validated a selected reaction monitoring (SRM) mass spectrometry method to quantify VWF cleavage as the ratio of the ADAMTS-13-cleaved peptide MVTGNPASDEIK to the ILAGPAGDSNVVK peptide. The rate of VWF cleavage was found to be 1.26% ± 0.36% in normal plasma. It varied significantly in patient samples, ranging from 0.23% to 2.5% of total VWF antigen, even though all patients had the loss of large VWF multimers. Von Willebrand factor cleavage was greater in post-LVAD samples from patients in whom bleeding had developed, but was mostly reduced in patients in whom thrombosis had developed. This SRM method is reliable to quantify the rate of VWF cleavage in patients on LVAD support.

JS4-3 - New Challenges That We Are Facing LVAD Therapy for End-stage at Heart Failure

Surgical management for patients with end-stage at heart failure has been dramatically improved after clinical introduction of implantable LVAD. Although neurological event and driveline infection remain major complications after LVAD installation, new challenges for previously unpredicted complications have evolved. De novo aortic insufficiency (AI) has been highlighted as a significant issue that affect hemodynamic efficiency in a patient with LVAD support. Conventional transthoracic echocardiography fails to accurately assess the severity of AI due to unique features of LVAD-associated de novo AI. Several possible risk factors related to development of de novo AI have been addressed through multiple clinical analyses including lack of aortic valve opening and loss of pulsatile flow. Non-surgical management of patient condition and LVAD therapy are primarily recommended to prevent this devastating condition; however, surgical aortic valve closure or replacement can be reliable options for resolution of this entity. Secondly, acquired von Willebrand syndrome has also been recognized as an implantable LVAD-associated complication. Reduction of large multimer of con Willebrand factor is mediated by a cleavage enzyme of ADAMTS13, and the cleavage takes place when von Willebrand factor is exposed to high shear stress produced by high-speed rotary pump. Mechanism of gastrointestinal bleeding is at least in part attributable to acquired von Willebrand syndrome. Development of angiodysplasia is also suspected to be involved in the disease process.

Life-threatening subdural hematoma after aortic valve replacement in a patient with Heyde syndrome: a case report

BackgroundHeyde syndrome is known as a triad of calcific aortic stenosis, anemia due to gastrointestinal bleeding from angiodysplasia, and acquired type 2A von Willebrand disease. This acquired hemorrhagic disorder is characterized by the loss of the large von Willebrand factor multimers due to the shear stress across the diseased aortic valve. The most frequently observed type of bleeding in these patients is mucosal or skin bleeding, such as epistaxis, followed by gastrointestinal bleeding. On the other hand, intracranial hemorrhage complicating Heyde syndrome is extremely rare.Case presentationA 77-year-old woman presented to our hospital with severe aortic stenosis and severe anemia due to gastrointestinal bleeding and was diagnosed with Heyde syndrome. Although aortic valve replacement was performed without recurrent gastrointestinal bleeding, postoperative life-threatening acute subdural hematoma occurred with a marked midline shift. Despite prompt surgical evacuation of the hematoma, she did not recover consciousness and she died 1 month after the operation.ConclusionsPostoperative subdural hematoma is rare, but it should be kept in mind as a devastating hemorrhagic complication, especially in patients with Heyde syndrome.