Lake Alau Research Articles

Distribution and Diversity of Phytoplankton in Lake Alau, Maiduguri, Northeast Nigeria

The production of biodiesel from Thevetia peruviana seed oil using two different catalysts (NaOH and KOH) was evaluated. The Physical and chemical properties after extracting the seed oil were determined and the following results were obtained (density; 0.896g/cm3 , pH; 5.6, oil content; 32.5%, moisture content; 1.5%, specific gravity; 1.33, viscosity; 20mm2 /s, and refractive index; 1.48) and (Acid value; 0.3 mg of KOH/g, free fatty acid; 0.45%, iodine value; 38.5gI/100g, saponification value; was 75mg/KOH) respectively. Different catalysts were prepared by dissolving separately (0.18g. 0.20g and 0.21g) w% of NaOH and another 0.18g, 0.20, 0.21g w% of KOH pellets each in 10ml of methanol to produce concentrations of sodium and potassium methoxide respectively. Furthermore, Yellow Oleander Oil (YOO) was divided into 6 portions (25ml each) and poured into 6 different beakers (100ml) and separately placed on a magnetic stirrer. The amount of biodiesel produced at different concentrations of NaOH catalyst was 20.3ml, 20.1ml, and 22.3ml and the amount of biodiesel produced at different concentration of KOH were 24.2ml, 22.1ml, and 21.0ml. The conversion yield of the biodiesel catalysts was 81.2%, 80.4% and 89% for the NaOH catalyst and 96.8%, 88.4% and 84.0 for the KOH catalyst. The properties of the biodiesel such as flash point were 68℃, pour point was 3℃, cloud point was 7℃, cetane number was 98, the acid value was 0.5mg of KOH/g, density was g/cm3 , Iodine value was 3gI/100g, saponification value was 104, viscosity was 1.5mm2 s, the refractive index was 1.49. The results obtained from the study indicate that the physicochemical properties of the synthesized biodiesel are in agreement with the ASTM standard specifications. Both catalysts gave a considerable yield with KOH having a higher yield than NaOH in almost all the concentrations used. Thevetia peruviana can be considered a highly promising feedstock for biodiesel production.

Morphometric and Gonadosomatic Index Studies of Some Fish species Collected from Lake Alau Maiduguri Borno state Nigeria

Morphometric and Gonadosomatic Index Studies of Some Fish species Collected from Lake Alau Maiduguri Borno state Nigeria

FROM ABUNDANCE TO ADVERSITY: UNDERSTANDING THE CHANGING DYNAMICS OF LAKE ALAU'S WATER QUALITY

Lake Alau, a critical water resource in the region, was subject to an extensive water quality assessment with the aim of assessing the impact of human activities on the physico-chemical parameters of Lake Alau, with a specific focus on water quality potentials of the Lake. The study spanned over a year, capturing variations in several physicochemical parameters using standard laboratory techniques. The data were computed and analysed using ANOVA. The findings reveal that the lake generally maintains water quality within permissible limits for aquatic ecosystems. The physical parameters of the lake, including Temperature, Total Solids (TS), Total Dissolved Solids (TDS), and Total Suspended Solids (TSS), were within the range of a productive lake, but higher concentrations of TDS (365.68g/L) and TSS (171.95g/L) might have altered the ecological balance of the lake. The chemical parameters, including pH, biochemical oxygen demand (BOD), Chemical Oxygen Demand (COD), Nitrite, Nitrate, and Phosphate, were within the permissible limit for a productive lake, supporting the biological parameters of the lake However, phosphate concentrations exceed 0.1mg/l which is the limit for drinking water. The observed variations underscore the lake's vulnerability to human activities and seasonal changes. Despite some concerns, Lake Alau remains suitable for aquatic life, with certain water quality management practices recommended to maintain its intergrity.

Mitochondrial DNA D-loop Genetic Relatedness and Characterization of Nile Tilapia (Oreochromis niloticus Linnaeus, 1758) from Lakes Alau and Bako, Northeast, Nigeria

This study investigated the genetic relatedness and characterization of Nile tilapia (Oreochromis niloticus) populations from Lake Bako, Mambilla Plateau and Lake Alau, Maiduguri using Mitochondrial DNA (mtDNA) D-loop sequences. Blood samples were collected from each individual of and preserved on an FTA card. DNA was extracted from the card using Aqualex extraction kits. Polymerase Chain Reaction was performed using a commercially available decamer primer: FISH COMUM D-LOOP F (5’-GGATTYTAACCCYTRCCC -3’) and (R:) as the forward primer and C. zilli_rev (5′ – AGTAAAGTCAGGACCAAGCC – 3′) as reverse primer. The results showed that, in total 117 variable sites were observed and Hap_1_Hap_40 was detected. Lake Alau population has 65.50 % A+T and 34.5% G+C, while 65.5% and 34.9% were the nucleotide composition of Lake Bako population. Both populations have 1.00 Haplotypes diversity. The nucleotide diversity observed in Lake Bako population is 0.0342, while 0.0285 were recorded in Lake Bako population. The average number of nucleotide differences of 26.61053 and 31.98421 were observed in Lakes Bako and Alau populations, respectively with and overall value of 29.996. The Neighbour-Joining phylogenetic tree revealed two major clusters. The genetic variation among population is 95.31%and within population is 4.69%. Populations of O. niloticus in Lakes Bako and Alau are genetically different. Lake Bako population seemed to have intact genetic structure. Both populations have high genetic diversity, hence have high potential for genetic improvement and conservation.

Prevalence of Intestinal and Urinary Helminth Parasite Infections among ‎Residents of Communities around Lake Alau, Maiduguri

Intestinal and urinary helminth infections affect up to a quarter of the world’s population, with the potential of causing significant public health and economic burden. The occurrence of helminth parasites in stool and urine of residents, and water and soil samples of some communities around Lake Alau, Maiduguri, Nigeria was determined using direct microscopy, floatation and sedimentation techniques. A total of 349 (34.7%) residents were infected out of the 1,005 examined, consisting of 220 (21.9%) males and 129 (12.8%) females, with significant (p<0.05) variation based on gender. Similarly, the infection was significantly (p<0.05) higher among young individuals 197(19.6%) than the adults 152(15.1%). Among the ten communities (Logajiri, Melari, Dumbari, AlauLimanti, Awa Isari, Limanti, Gaskeri, Attakeri, Chellomi and Gomari Karekǝri) examined, the infection was significantly (p<0.05) highest at Gomari Karekǝri 57 (5.7%) and Alau Limanti 55(5.5%) and least at Gaskeri 19 (1.9%) and Chellomari 20 (2.0%). Intestinal parasites encountered consist of Ascaris lumbricoides 234 (23.3%), Trichuris trichiura 24 (2.4%), Strongyloides stercoralis 10 (1.0%), Schistosoma mansoni 8 (0.8%), and Taenia species 1 (0.1%) (p<0.05). Schistosoma haematobium 72 (7.2%) was the only helminth parasite recovered from urine samples examined. Environmental (water and soil) contamination with parasite stages was predominantly with pre-parasitic nematode larvae 50 (25%), eggs of Strongyloides stercoralis 50 (25%), Ascaris lumbricoides 30 (15%), Strongyle spp. 30 (15%) and cysts of protozoans; Entamoeba histolytica 30 (15%) and Giardia intestinalis 10 (5%). The results suggest that infection with intestinal and urinary parasites is common among the residents of the study area and that socio-cultural habits may favour the survival and transmission of these parasites in the area.

Reproductive Tract Morphometry and Evaluation of Fresh Wild African ‎Catfish (Clarias gariepinus) Milt from Lake Alau, Maiduguri, Nigeria‎

Reproductive morphometry of Clarias gariepinus (C. gariepinus) is essential in distinguishing different species that are closely related to it and adequate information is required regarding the seasonal variation of milt characteristic of wild species. This study was designed to document the reproductive tract morphometric dimensions and milt characteristics of wild C. gariepinus during spawning and non-spawning seasons in Lake Alau, Maiduguri, Nigeria. Sixty male brood stocks were used comprising thirty each for spawning and non-spawning seasons. The reproductive tracts were removed and their dimensions measured. The milt samples were collected, pooled and evaluated. Results of the study showed that the body weight, sperm concentration and testicular indices differed significantly (p˂0.05) between the two seasons of evaluation. In addition, a positive correlation (p˂ 0.05) between body weight of fish and milt volume (r = 0.656 and r = 0.646) was also observed in both seasons. It was concluded that the left testis of C. gariepinus is heavier, longer and thicker than the right. Nonetheless, the C. gariepinus had larger body weights and higher spermatozoa concentration in spawning season than in non-spawning season; those with larger body weights had higher volume of milt than those with lower body weights.

A Comparative Study on the Gonadosomatic Index and Milt Volume of Four Populations of Clarias gariepinus (Burchell, 1822) Broodstock Strains from North-East Nigeria

This study was carried out to compare and assess the Gonadosomatic Index (GSI) and Milt Volume of African catfish (Clarias gariepinus) from four population strains in the North-East of Nigeria. The broodstocks for the experiment were collected from lake Alau in Borno State, Lake Dadin Kowa in Gombe State, Lake Maladumba in Bauchi State and Lake Mayo Ranewo in Taraba State. The experiment was carried out at the hatchery complex of the Department of Fisheries, University of Maiduguri. A total of eighty C. gariepinus, twenty from each lake were collected. Standard methods were used to determine the gonadosomatic index and milt volume of the broodstock fish. The result obtained showed that the highest GSI value in males was 0.48±0.14 for fish caught from Lake Mayo Ranewo and the lowest GSI in males value was 0.28±0.01 for fish caught from Lake Maladumba. While the highest GSI value in females was 9.18±2.48 for fish caught from Lake Maladumba and the lowest GSI in females value was 4.06±0.65 for fish caught from Lake Dadin Kowa. There was a significant difference (P<0.05) on the GSI among the males and females fish broodstocks among Lakes The highest milt volume 2.66±0.16 was recorded for fish caught from Lake Mayo Ranewo and the lowest milt volume in males value was 2.32±0.11 and 2.32±0.11 for fish caught from Lake Alau and Lake Dadin Kowa respectively. The results obtained in this study have increase our knowledge on the reproductive biology of wild C. gariepinus from the North-East of Nigeria and have also provided relevant information for fisheries and aquaculture management as well as breeding programmes.

Distribution of Heterotrophic and Nitrogen fixing Rhizobacteria in Irrigation Sites of Lake Alau Borno State Northeastern Nigeria

This study was conducted to know the population of rhizobacteria in both irrigation and non-irrigation sites of the dam. The dense population of these organism indirectly promote plant growth and development. Five sites (A, B, C, D and E) were used to collect soil samples randomly and transported to the laboratory for analysis. Total heterotrophic bacterial count was done using nutrient agar (NA) and nitrogen fixing bacteria was counted using Ashbey’s media (AM). The result shows that highest number of total heterotrophic bacteria in site C (46.0×106) cfu/g in irrigation site whereas higher count in non-irrigation site was (13.0×106) site D, the nitrogen fixing bacterial count in irrigation site was higher at site E with (12.0×106) and for the non-irrigation site was higher at site D with (14.0×106) The total heterotrophic bacteria isolated in the soil sample are the species of Bacillus alvei, Bacillus alvei, Bacillus cereus, Bacillus cereus, Pseudomonas putida, Klebsiella aeruginosa and Enterobacter aeruginosa. Likewise, the Nitrogen fixing bacteria isolated are the species of Rhizobium leguminosarum, Klebsiella pneumonia, Bacillus lentus, Azotobacter nigricans, Azotobacter tropicalis, Azotobacter spp, and Azotobacter tropicalis. The long history of agricultural activities in the lake area has directly influenced the diversity of microbial population in the area.

Haemoglobin polymorphism in wild and cultured African catfish (<i>Clarias gariepinus</i> Burchell, 1822)

Haemoglobin polymorphism, haemoglobin concentration, blood group and genotypes of wild and cultured Clarias gariepinus were investigated. Blood samples of Clarias gariepinus collected from Lake Alau (wild) and Dalori fish farm (cultured) were subjected to cellulose acetate electrophoresis to reveal the activities of hemoglobin (Hb). The result shows that both wild and cultured C. gariepinus had AA, BB and CC genotypes in the males and females. However, BD genotype was observed only in the female wild C. gariepinus . The percentage AA and BB genotypes of wild male C. gariepinus was 6.6% each. Wild females had AA, BB, CC and BD genotype with frequencies of 26.6, 33.3, 20 and 6.6% respectively. Cultured male C. gariepinus had AA, BB and CC with frequencies of 13.3, 26.6 and 6.6%, respectively, while the female C. gariepinus had AA, BB and CC with frequencies of 20, 13.3 and 20% respectively. Wild C. gariepinus had the highest (10.36 g/dl) haemoglobin concentration value while the cultured strain had 8.86 g/dl. The blood groups of wild male C. gariepinus were O - (10% of the population) and AB + (10% of the population). The wild females had O - , O + , A + , B + and AB + with 40, 10, 10, 10 and 10% of the population respectively, Cultured male had O + , A + and AB + (10, 20 and 20% of the fish observed) respectively. The blood group observed in the cultured female C. gariepinus were O - (30%), A + (10%) and B + (10%). The BD genotype observed in a wild strain of C. gariepinus indicates incomplete (partial) dominance and rare allele. This could be an indication of natural hybridization. Keywords : Haemoglobin concentration, polymorphism, genotype, blood group, wild and cultured, Clarias

Length-Weight and Length-Length Relationships of Heterotis niloticus (Cuvier, 1829) and Raiamas senegalensis (Steindachner, 1870)

The sustainable exploitation of freshwater fish species of commercial value is inevitable for fishery to continuously play its role in the social and economic growth of Nigeria. Heterotis niloticus and Raiamas senegalensis are two commercially available species in Lake Alau. The length-weight relationship (LWR) and length-length relationship (LLR) of these species were investigated to determine their growth patterns and state of wellbeing. Fish samples were collected from fishermen landings weekly for four months. The morphometric indices such as Total Length (TL), Standard Length (SL) and Body Weight (BW) were assessed using standard methods. A total of 1583 specimens comprising 602 H. niloticus (51.61% males and 48.39% females) and 981 R. Senegalensis (56.57% males and 43.43% females) were collected. TL ranged from 10.2 to 42.8 cm; 15.5 to 41.6 cm, SL 9.5 to 39.9 cm; 14.0 to 39.9 cm and weighed between 128.50 and 420.14 g; 123.05 and 401.8 cm for H. niloticus and R. Senegalensis, respectively. The growth coefficient (b) ranged between 3.127 and 3.340 for H. niloticus and 2.592 and 3.193 for R. Senegalensis. This indicates positive allometric growth pattern for the two-species investigated. The LLR varied from 1.511 to 2.148 and 1.506 to 1.820 for H. niloticus and R. Senegalensis, with mean condition factor of 2.04 ± 1.76 (H. niloticus) and 1.97 ± 1.98 (R. Senegalensis). This study therefore concludes that Lake Alau is favourable to good growth, reproduction, and survival of these species.

Physico – Chemical Water Quality Analyses of Lake Alau, North – Eastern Nigeria

This study was conducted on the physico – chemical water quality analyses of Lake Alau, North – eastern Nigeria. Water was sampled biweekly for the period of seven months from five sampling stations. The physico – chemical qualities were determined using the methods described by APHA, (1985) and Boyd (1990). The mean values of the physico – chemical parameters of water qualities analysed are 23.04°C, 56.21 cm, 7.8, 6.41 mg / l, 0.68, 0.034 mg / l, 0.07 mg / l, 39.46 mg / l and 56.28 mg / l for temperature, turbidity, pH, DO, BOD, Nitrite, NH3, alkalinity and total hardness of Lake Alau. The results indicated that, there are no variations between the five stations, except ammonia and nitrate which exhibited significant variations. The water quality parameters were within the range recommended for aquatic life; fish production and domestic use. The physico – chemical parameters were within the observed ranges in unpolluted water bodies and also were found to be within tolerable limit for high yield for aquatic life; fish production and domestic use. It provided vital information on about some of the quality status of Lake Alau, and its suitability for fish production and uses. Any variation, weather seasonal or spatial in physical and chemical characteristic of the Lake has being influence by climatic regime and catchment characteristic, i.e. extent of human activities and water volume fluctuations. Farmers bordering the Lake, dispose both their organic and inorganic wastes in to the Lake directly or indirectly. It is recommended that the relevant stakeholder charged with management of the Lake should carry out a sensitization campaign to educate the people on the danger associated with loading of the Lake with waste (toxic), from washing disinfectant or herbicides spraying machine in the Lake Alau.

Plasmodium Falciparum Clearance in Malaria Treated Children at Lake Alau Settlements, North Eastern Nigeria: Effects of Body Weight

The influence of body weights on Plasmodium falcifarum clearance in malaria positive children was conducted using AT+SP and AQ+SP combination therapies, at the malaria holo - endemic and risk settlements of lake - alau, North Eastern Nigeria. A total of 313 children (6 - 59 months) were admitted into the study, to assess the efficacies of the combination therapies in children (6 - 59 months) using the effects of Body weights (kg) on parasite densities. Each child's weight was determined on days 0, 1, 2, 3, 4, 7, 14 and 28 during the follow up periods. The drugs were administered between 0-3 days. Finger prick and venipuncture (syringe) techniques were employed and blood was sampled by pricking using sterilized needle on days 0, 1, 2, 3, 4, 7, 14 and 28 for the assessment of parasite densities count (per µl) while blood smear was prepared using Giemsa stained slides making thick and thin blood smears. The result shows body weight exerted negative effects on Plasmodium falciparum between the range of 71.63 to 96.0% for AT+SP and 87.79 to 96.38% for AQ+SP in the first three days of treatment. Furthermore, results showed for each kg gain in body weight there was a synchronous parasite clearance by 325.79 versus 1199.91∕µ, 16.621 versus 157.06∕µ, 17.445 versus 153.5∕µ for AT+SP versus AQ+SP on days 1, 2, and 3, respectively. The terminal resultsindicated a higher residual parasitaemia at the onset of late phase in children treated with AQ+SP (195.17 to 113.92∕µ) tcompared to AT+SP (182.48 to 25.531∕µ). The respective parasite densities clearance per kg body weight for days 7, 14 and 28 for AT+SP versus AQ+SP was 33.82 versus 35.887∕µ, 10.076 versus 29.578∕µ and 2.3548 versus 26.368∕µ respectively. Thus, on each of the late follow-up days, the rate of parasite depletion was higher in AQ+SP than AT+SP.*Corresponding Author: muskokoss@gmail.com

Examinations of the Stomach Contents of Two Fish Species (Clarias Gariepinus and Oreochromis Niloticus) in Lake Alau, North �C Eastern Nigeria

This study was conducted on the examinations of the stomach contents of two commercially important fish species of Catfish and Tilapia fish (Clarias gariepinus and Oreochromis niloticus) known as “Tarwada” and “Karfasa” in Hausa language, determined from Lake Alau, North – Eastern Nigeria, using frequency of occurrence and volumetric methods between June to December, 2013. Gill nets and Malian traps were used to catch the fish every fortnight. Three hundred and fifty (350) individual fish of each species obtained and their stomach contents examined. The results obtained expressed in mean percentage indicated that out of the three hundred and fifty (350) individual fish of each species examined, 121 (35%) fish had an empty stomach contents in Clarias gariepinus, and out of the 350 samples examined, 145 fish had an empty stomach content in Oreochromis niloticus representing 41%. The stomach contents of Clarias gariepinus consisted of animal and plant materials, planktons, (zooplanktons and phytoplankton) and others. Fish prey was the dominant animal material (51%) with mean contribution of 32% by volume, and plant material consisted of leaves and offal (6% by volume). The stomach content of Oreochromis niloticus consisted mainly of animal and plant materials, planktons and detritus. Algae represented by Chlorella, Volvox, Scenedesmus, Pediastrum, and Spirogyra species accounted for 66% by volume followed by detritus and mud with 20 %, zooplankton represented by Daphnia and Moina species represented the low food content by volume with 8 %. The study reveals the importance of algae, fish, insects and plant materials as food for fish in Lake Alau, and zooplanktons form important items in the diet of the species examined. Both species are omnivorous and occupy the same ecological niche; hence, there is the need to control pollution into the lake to prevent eutrophication.

Interaction profile for As, Cd, Cr and Pb in tissues of fishes (Tilapia gallier, Clarias lazera and Heterotis niloticus).

The levels of Arsenic (As), Cadmium (Cd), Chromium (Cr) and Lead (Pb) referred to as the quaternary heavy metals (QHMs) were investigated in fish tissues (gill, stomach, intestine and liver) of Tilapia gallier, Clarias lazera and Heterotis niloticuscaught from Lake Alau, Nigeria with the aim of presenting the QHMs interaction profile and hence provide further supportive information to existing literature. The standard calibration method of flame atomic absorption spectrophotometry (FAAS) was employed in the determination of the QHMs. The results indicated presence of the QHMs in the all tissues and fish species analysed. Their concentrations varied for each metal in the different tissues and species, but only in few occasions were these variations statistically significant (p < 0.05). T. gallier accumulates the highest (39%) of Arsenic in the intestine, C. lazera with highest (29%) of Lead in stomach and H. niloticus showed highest (38%) of Cadmium in the liver. On the whole, the results of this study revealed that the concentrations of these QHMs are within safe limits for human consumption. The doughnut plot was found useful for profiling the interactions of the QHMs in fish tissue samples, provide supportive information to earlier findings and confirms that these metals do show varying concentrations at different facets of a particular system. Key words: Gills, stomach, intestine, liver, doughnut plots, quaternary heavy metals.

Fisheries Status And Fishing Gears Of A West African Arid Zone Lake

The lake Alau fisheries of the North East zone of Nigeria, Maiduguri contains relatively low fish species exploited artisanally by 365 fishers in all the sampled stations. Station 4 has the highest mean number of fishers (275 ± 21.30) while station 2 has the least mean number (35 ± 9.30). A total of one thousand, eight hundred and thirty one (1831) fish specimens were sampled. The major fish species were from the families; Characidae, Cichlidae, Mochokidae, Schilbeidae, Mormyridae, Cyprinidae, Clariidae, Bagridae, Centropomidae, Polypteridae and Osteoglossidae. The most dominant family observed was the Cichlidae. The species composition recorded was 28 in all the studied stations. Heterotis niloticus was dominant with mean number of 40.4 ± 1.1.28 and percentage composition of 11.2 %. Sex ratio of 1 male to 0.95 female was recorded for Heterotis niloticus. Multi gears fishing were observed. The percentage composition of fishing gears observed were in the order of clap net (33 %), cast net (20 %), gill net (20 %), long line (11 %), Mali trap (15 %) and seine net (1 %). There was a steady increase in number of fishers employing nets of various kinds. Lake Alau fisheries can be rated as over fished due to the pressure of fishers and the quality of their catches.

Molluscan Population Of An African Arid Zone Lake

The species composition, abundance and distribution of molluscs population together with some physico-chemical variables from five different stations in the littoral region of lake Alau, MaiduguriBorno state, were studied from October 2001 to September 2002. Three patterns of seasonal abundance were found, maximal abundance duringthe rainy season (July -September), moderate abundance during the harmattan season (November – February) and minimal abundance in the dry hot season (March - June). Significant diferences in species composition and abundance of the molluscs were found between stations studied. The total number of organisms recorded was 3368 comprising of 1924 Bivalves and 1544 Gastropoda. 8 families were recorded which includes Bithyniidae, Hydrobiidae, Lymnaeidae, Physidae, Valvatidae, Vivipariidae, Sphaeridae and Unionidae while 15 species were observed in this study. The predominant families in terms of total number collected from all stations Sphaeridae and Unionidae recording 1006 and 933 organisms with the percentage compositions of 2986% and 277%. The least was from the families Lymnacidae wh ota number of 116 and 3.44% as the percentage composion. The abundance of the molluscs was positively and significantly correlated at 5% confidencewith temperature (r =0.675), dissolved oxygen (r = 0.832), phosphate (r = 0.528). Keywords: Molluscs, Littoral Region, Abundance, UnionidaeAnimal Research International Vol. 4 (2) 2007 pp. 680-684

Length-weight relationship and condition factor of clarias gariepinus and tilapia zillii in lake alau and monguno hatchery,

Length-Weight relationship and condition factor of Clarias gariepinus and Tilapia Zillii were studiedin lake Alau and Monguno hatchery, both in Borno State of Nigeria, for a period of two weeks. A total of 98 C. gariepinus and 140. T. zillii were measured. The length-weight regression coefficient (b) for both fishes in lake Alau were not significantly different from the hypothesized value 3, but for both fishes in Monguno hatchery (b) differed signifcantly from the hypotheszed value. Isometric growth of both fshes was recorded in lake Alau while a comparative decline in weight in relation to specific length of fishes was recordedin Monguno hatchery. Furthermore, condition of C.gareipinus in lake Alau revealed that all size groups of the fsh grew better than those in Monguno hatchery, while the condiion of T. zillii in Monguno hatchery was better than that in lake Alau. Although our results suggest that C. gariepinus in lake Alau grew faster than that cultured in Monguno hatchery, the study is not conclusive as abiotic, biotic, and sampling error might have interplayed. The reverse is also true for the growthpotentials of T. zillii in Monguno hatchery whencompared to that in lake Aau. Keywords: Clarias gariepinus, Tilapia zillii, lake, Hatchery pond Animal Research International Vol. 4 (1) 2007 pp. 635-638

The Physico-Chemical Parameters Of An African Arid Zone Man Made Lake

Physico-chemical studies were conducted in lake Alau, a large reservoir in the northeast arid zone of Nigeria, between October, 2001 and September, 2002. Five stations were selected to determine the physico-chemical characteristics. The results showed that water temperature values ranged from 23 o C to 27 o C, depth varied from 2.85 m to 7.23 m, water current was between 19.62 cm/sec and 26.71 cm/sec, Secchi disc transparency ranged from 0.26 m to 0.42 m, pH varied from 6.59 to 7.29, conductivity was between 118.41 homs/cm and 131.45 homs/cm, free CO 2 ranged from 2.55 mg/l to 3.06 mg/l, Biochemical oxygen demand (BOD) was between 4.30 mg/l and 5.31 mg/l and nitrate-nitrogen concentration was between 30.30 mg/l and 47.0 mg/l. There were significant differences (P < 0.05) between these parameters in relation to stations. Generally, the physico-chemical characteristics of lake Alau fall within the productive values for aquatic systems, and strongly indicate that the lake is unpolluted.

Studies on some aspects of reproductive biology of some important fish species in Lake Alau in Borno state, Nigeria

No Abstract. Bulletin of Animal Health and Production in Africa Vol. 52 (2) 2004: pp. 99-110

Distribution and Statistical Analysis of Bacteria in Lake Alau in the Arid Northern Nigeria

The direct microscopic count using bright field illumination was subjected to a statistical comparison with four different microbial cell viability procedures viz., pour plate, spread plate, most probable number (MPN) and membrane filtration (MF) for the analysis of the distribution of bacteria in water samples from Lake Alau Dam in the arid Northern Nigeria. A total of 27 samples were collected from three locations of the dam site and analysed. The total coliform represented 32% of the 22 isolates and of this 10% represented the fecal coliform bacteria. The fecal coliform level of 6.0 x 102 to 8.8 x 102/100ml placed lake Alau Dam water samples in the EEC Grade A2 and thus, the water is recommended for further treatments before it can be distributed to municipalities for domestic use. Statistical analysis using one-way analysis of variance (ANOVA) showed significant differences in counts between three locations, based on the direct microscopic counts. There were no significant differences in counts between locations using the four cultural methods. There was an honestly significant difference (hsd, 5% level, Tukeys test) between the direct microscopic counts and the four cultural methods, but there was not honestly significant difference (hsd, 5% level) between the four cultural methods. It is concluded that in the absence of more sophisticated procedures, the four cultural methods together with the direct bright field microscopic count procedure served to establish a good measure of the microbiological quality of the Lake Alau water, this is strengthened by the statistical correlations. Journal of Applied Sciences and Environmental Management Vol. 8 (1) 2004: 5-9