L-lactate Dehydrogenase Research Articles

The Influence of Supplemental Zinc and Ractopamine Hydrochloride on the Performance and Longissimus Thoracis Proteome of Finishing Beef Steers

To determine how Zn and ractopamine hydrochloride (RAC) supplementation affect the longissimus thoracis muscle proteome in beef cattle, 48 high percentage Angus steers (494±18.2 kg) were utilized in a 2×2 factorial study design. Steers were blocked by body weight (BW) and genetic gain potential (GeneMax; Zoetis, Parsippany, NJ) into control (CON; analyzed 36 mg Zn/kg dry matter [DM]) or supranutritional Zn (SUPZN; CON+60 mg Zn/kg DM from ZnSO4+60 mg Zn/kg DM from Zn-amino acid complex; Availa Zn, Zinpro, Eden Prairie, MN) dietary treatments (ZNTRT). Starting 28 d prior to harvest, steers were blocked by BW within ZNTRT to RAC treatments (RACTRT) of 0 (NO) or 300 mg·steer−1·d−1 (RAC; Actogain 45, Zoetis). After 15 d on RACTRT, longissimus thoracis biopsies were collected from all steers for proteomic analysis. Twenty-eight steers (n=7 per treatment) were harvested at a commercial abattoir on Day 90. A ZNTRT×RACTRT effect showed SUPZN-RAC steers had a greater dressing percentage than other treatments (P≤0.02). Steers fed SUPZN had a greater hot carcass weight, carcass-adjusted final BW, overall average daily gain, and overall gain to feed (P≤0.05). Differentially abundant proteins involved in energy metabolism, muscle structure, and protein synthesis potentially indicate muscle fiber characteristic differences because of Zn and RAC supplementation.Both myosin light chain kinase 2 and eukaryotic translation initiation factor 5A-1 were more abundant in SUPZN-RAC steers than SUPZN-NO (P≤0.05) or CON-NO (P≤0.04) steers when analyzed for phosphorylation modifications. L-lactate dehydrogenase B was more abundant in SUPZN-NO steers than CON-NO (P=0.03) or CON-RAC (P=0.01) steers. In conclusion, increased Zn supplementation may be needed to optimize the hypertrophic effects of RAC through its effects on the longissimus thoracis proteome.

An Oxygen-Insensitive biosensor and a biofuel cell device based on FMN l-lactate dehydrogenase

Lactate sensing has high importance for metabolic disease diagnostics, food spoilage, sports medicine, or the construction of biofuel cell devices. Therefore, continuous lactate sensing devices which enable accurate detection should be developed. Here we present the overexpression and utilization of FMN-lactate dehydrogenase from Saccharomyces cerevisiae for oxygen-insensitive, continuous amperometric lactate biosensing. The developed sensors exhibit a high signal-to-noise ratio, low interference effect, and a wide range of linear responses using both direct and mediated electron transfer configurations. The thionine-based mediated electron transfer configuration was stable for 8 h of continuous activity and two weeks of periodic activity with storage at 4 °C. We further grafted the redox mediators on multiwall carbon nanotubes to lower the redox mediator leaching effect. The developed grafting technique improved the biosensor stability and allowed continuous operation for at least 20 h. Both the mediator-entrapped and the grafted bioanodes were further coupled with a bilirubin oxidase-based biocathode to construct a biofuel cell device. The various biofuel cells have generated a maximal power output of 110 µW/cm2 under atmospheric conditions and 200 µW/cm2 under oxygen saturation.

Mutual regulation of lactate dehydrogenase and redox robustness.

The nature of redox is electron transfer; in this way, energy metabolism brings redox stress. Lactate production is associated with NAD regeneration, which is now recognized to play a role in maintaining redox homeostasis. The cellular lactate/pyruvate ratio could be described as a proxy for the cytosolic NADH/NAD ratio, meaning lactate metabolism is the key to redox regulation. Here, we review the role of lactate dehydrogenases in cellular redox regulation, which play the role of the direct regulator of lactate-pyruvate transforming. Lactate dehydrogenases (LDHs) are found in almost all animal tissues; while LDHA catalyzed pyruvate to lactate, LDHB catalyzed the reverse reaction . LDH enzyme activity affects cell oxidative stress with NAD/NADH regulation, especially LDHA recently is also thought as an ROS sensor. We focus on the mutual regulation of LDHA and redox robustness. ROS accumulation regulates the transcription of LDHA. Conversely, diverse post-translational modifications of LDHA, such as phosphorylation and ubiquitination, play important roles in enzyme activity on ROS elimination, emphasizing the potential role of the ROS sensor and regulator of LDHA.

Flavin Mononucleotide-Dependent l-Lactate Dehydrogenases: Expanding the Toolbox of Enzymes for l-Lactate Biosensors

The development of L-lactate biosensors has been hampered in recent years by the lack of availability and knowledge about a wider range and diversity of L-lactate-oxidizing enzymes that can be used as bioelements in these sensors. For decades, L-lactate oxidase of Aerococcus viridans (AvLOx) has been used almost exclusively in the field of L-lactate biosensor development and has achieved somewhat like a monopoly status as a biocatalyst for these applications. Studies on other L-lactate-oxidizing enzymes are sparse and are often missing biochemical data. In this work, we made use of the vast amount of sequence information that is currently available on protein databases to investigate the naturally occurring diversity of L-lactate-utilizing enzymes of the flavin mononucleotide (FMN)-dependent α-hydroxy acid oxidoreductase (HAOx) family. We identified the HAOx sequence space specific for L-lactate oxidation and additionally discovered a not-yet described class of soluble and FMN-dependent L-lactate dehydrogenases, which are promising for the construction of second-generation biosensors or other biotechnological applications. Our work paves the way for new studies on α-hydroxy acid biosensors and proves that there is more to the HAOx family than AvLOx.

Lactate dehydrogenases promote glioblastoma growth and invasion via a metabolic symbiosis

Lactate is a central metabolite in brain physiology but also contributes to tumor development. Glioblastoma (GB) is the most common and malignant primary brain tumor in adults, recognized by angiogenic and invasive growth, in addition to its altered metabolism. We show herein that lactate fuels GB anaplerosis by replenishing the tricarboxylic acid (TCA) cycle in absence of glucose. Lactate dehydrogenases (LDHA and LDHB), which we found spatially expressed in GB tissues, catalyze the interconversion of pyruvate and lactate. However, ablation of both LDH isoforms, but not only one, led to a reduction in tumor growth and an increase in mouse survival. Comparative transcriptomics and metabolomics revealed metabolic rewiring involving high oxidative phosphorylation (OXPHOS) in the LDHA/B KO group which sensitized tumors to cranial irradiation, thus improving mouse survival. When mice were treated with the antiepileptic drug stiripentol, which targets LDH activity, tumor growth decreased. Our findings unveil the complex metabolic network in which both LDHA and LDHB are integrated and show that the combined inhibition of LDHA and LDHB strongly sensitizes GB to therapy.

Fine-Tuning the Electrocatalytic Regeneration of NADH Cofactor Using [Rh(Cp*)(bpy)Cl]+-Functionalized Metal-Organic Framework Films.

Electrochemical regeneration of the reduced form of the nicotinamide adenine dinucleotide (NADH) cofactor catalyzed by immobilized [Rh(Cp*)(bpy)Cl]+ is a promising approach for the enzymatic synthesis of many valuable chemicals with NAD-dependent dehydrogenases. However, rational control of the efficiency is often limited by the irregular structure of the electrode/electrolyte interface and the accessibility of the molecular catalyst. Here, we propose an electrochemical system for NADH cofactor regeneration, based on highly ordered three- dimensional (3D) metal-organic framework (NU-1000) films. [Rh(Cp*)(bpy)Cl]+ is incorporated at the zirconium nodes of NU-1000 via solvent-assisted ligand incorporation (SALI), leading to a diffusion-controlled behavior, associated with an electron hopping mechanism. Varying the ratio of redox-active [Rh(Cp*)(bpy)Cl]+ and inactive postgrafting agents enables the elaboration of functional electrodes with tunable electrocatalytic activity for NADH regeneration. The exceptionally high faradic efficiency of 97%, associated with a very high turnover frequency (TOF) of ∼1400 h-1 for NADH regeneration, and the total turnover number (TTN) of over 20000 for the enzymatic conversion from pyruvate to l-lactate, when coupled with l-lactate dehydrogenases (LDH) as a model reaction, open up promising perspectives for employing these electrodes in various alternative bioelectrosynthesis approaches.

Natural products targeting human lactate dehydrogenases for cancer therapy: A mini review.

Reprogramming cancer metabolism has become the hallmark of cancer progression. As the key enzyme catalyzing the conversion of pyruvate to lactate in aerobic glycolysis of cancer cells, human lactate dehydrogenase (LDH) has been a promising target in the discovery of anticancer agents. Natural products are important sources of new drugs. Up to now, some natural compounds have been reported with the activity to target LDH. To give more information on the development of LDH inhibitors and application of natural products, herein, we reviewed the natural compounds with inhibition of LDH from diverse structures and discussed the future direction of the discovery of natural LDH inhibitors for cancer therapy.

Proteolysis and changes in meat quality of chicken pectoralis major and iliotibialis muscles in relation to muscle fiber type distribution

The proteolysis trends and meat quality of the chicken pectoralis major (PM) and iliotibialis (IL) muscles stored at 4°C for 7 d were investigated. After 7 d of storage, the purge loss was higher (P < 0.05) in PM than in IL muscle. The difference in the composition of muscle fibers between PM (100% fast type) and IL (88.85% fast and 11.15% slow types) resulted in differences in proteolysis. Fructose-bisphosphate aldolase, troponin I, myosin heavy chain, and malate dehydrogenase exhibited the same tendencies, but pyruvate kinase, creatine kinase, L-lactate dehydrogenase, and triosephosphate isomerase exhibited different tendencies in the 2 muscles. The activity of cathepsin B was higher in PM than in IL during storage (P < 0.05). These results indicate that the proteolysis trend and changes in meat quality during cold storage are dependent on the different muscle fiber characteristics.

Consolidated Bioprocessing in a Dairy Setting─Concurrent Yoghurt Fermentation and Lactose Hydrolysis without Using Lactase Enzymes.

Streptococcus thermophilus is a fast-growing lactic acid bacterium (LAB) used in yoghurt and cheese manufacturing. Recently, we reported how this bacterium could serve as a cell catalyst for hydrolyzing lactose when permeabilized by nisin A. To enhance the lactose hydrolyzing activity of S. thermophilus, we mutated a dairy strain and screened for variants with elevated β-galactosidase activity. Two isolates, ST30-8 and ST95, had 2.4-fold higher activity. Surprisingly, both strains were able to hydrolyze lactose when used as whole-cell lactase catalysts without permeabilization, and ST30-8 hydrolyzed 30 g/L lactose in 6 h at 50 °C using 0.18 g/L cells. Moreover, both strains hydrolyzed lactose while growing in milk. Genome sequencing revealed a mutation in l-lactate dehydrogenase, which we believe hampers growth and increases the capacity of S. thermophilus to hydrolyze lactose. Our findings will allow production of sweet lactose-reduced yoghurt without the use of costly purified lactase enzymes.

Sludge decay kinetics and metagenomic analysis uncover discrepant metabolic mechanisms in two different sludge in situ reduction systems

A comparative study was conducted between an anaerobic side-stream reactor (ASSR) process and a sludge process reduction (SPR) activated sludge (SPRAS) process for uncovering crucial metabolic mechanisms governing sludge reduction. Both of two processes were efficient in removing pollutants, while the SPRAS (62.3 %) obtained much higher sludge reduction than the ASSR (27.9 %). The highest rate coefficients of sludge decay, heterotroph lysis and particles hydrolysis were 0.106, 0.219 and 0.054 d−1 in the SPR module, followed by ASSR with coefficients of 0.060, 0.135 and 0.047 d−1. The SPR module achieved an 81.9 % higher sludge decay mass with a 32.8 % smaller volume than the ASSR module. The SPR module preferentially enriched hydrolytic/fermentative and slow-growing bacteria. Metagenomic analysis revealed that SPR strengthened the key hydrolases and L-lactate dehydrogenase in the glycolysis pathways and weakened the citrate cycle, inducing metabolic uncoupling due to the reduced biosynthesis of ATP. Inserting ASSR only altered the ATP biosynthesis pathway, but maintenance metabolism was dominant for sludge reduction, with a long sludge retention time prolonging the food chain for predation.

Integrative analysis of plasma metabolomics and proteomics reveals the metabolic landscape of breast cancer

BackgroundBreast cancer (BC) is the most commonly diagnosed cancer. Currently, mammography and breast ultrasonography are the main clinical screening methods for BC. Our study aimed to reveal the specific metabolic profiles of BC patients and explore the specific metabolic signatures in human plasma for BC diagnosis.MethodsThis study enrolled 216 participants, including BC patients, benign patients, and healthy controls (HC) and formed two cohorts, one training cohort and one testing cohort. Plasma samples were collected from each participant and subjected to perform nontargeted metabolomics and proteomics. The metabolic signatures for BC diagnosis were identified through machine learning.ResultsMetabolomics analysis revealed that BC patients showed a significant change of metabolic profiles compared to HC individuals. The alanine, aspartate and glutamate pathways, glutamine and glutamate metabolic pathways, and arginine biosynthesis pathways were the critical biological metabolic pathways in BC. Proteomics identified 29 upregulated and 2 downregulated proteins in BC. Our integrative analysis found that aspartate aminotransferase (GOT1), l-lactate dehydrogenase B chain (LDHB), glutathione synthetase (GSS), and glutathione peroxidase 3 (GPX3) were closely involved in these metabolic pathways. Support vector machine (SVM) demonstrated a predictive model with 47 metabolites, and this model achieved a high accuracy in BC prediction (AUC = 1). Besides, this panel of metabolites also showed a fairly high predictive power in the testing cohort between BC vs HC (AUC = 0.794), and benign vs HC (AUC = 0.879).ConclusionsThis study uncovered specific changes in the metabolic and proteomic profiling of breast cancer patients and identified a panel of 47 plasma metabolites, including sphingomyelins, glutamate, and cysteine could be potential diagnostic biomarkers for breast cancer.

Hybrid Flow Bioreactor with All Catalysts Immobilized for Enzymatic Electrosynthesis

AbstractThe electrochemical regeneration of the reduced form of nicotinamide adenine dinucleotide cofactor (NADH) was realized in a hybrid flow reactor coupling fuel cell technology and redox flow device, paying attention to the robust immobilization of all catalysts. The rhodium catalyst Rh(Cp✶)(bpy)Cl+ was covalently immobilized on a multi‐walled carbon nanotube (MWCNT) layer and the association with the gas diffusion electrode was carefully optimized. High stability and activity of the electrochemical system were assessed by cyclic voltammetry and amperometry in the flow reactor. Afterwards, the optimal cofactor regeneration was applied to NADH‐dependent biosynthesis using immobilized lactate dehydrogenase for the conversion of pyruvate to lactate in the flow cell in the presence of cofactor concentration as low as 10 μM. 79 % Faradaic efficiency was achieved and remarkable total turnover number (TTN) were reached: 2500, 18000, and 180000, for NADH, Rh complex and L‐lactate dehydrogenase (LDH), respectively.

Heat, cold, acid, and bile salt induced differential proteomic responses of a novel potential probiotic Lactococcus garvieae C47 isolated from camel milk

Probiotics encounter various stresses during food processing and digestion. This study evaluated the differential proteomic responses of a newly identified potential probiotic lactic acid bacteria, Lactococcus garvieae, isolated from camel milk. Lc. garvieae C47 was exposed to heat, cold, acid, and bile conditions, and stress-responsive proteins were identified. The proteomic analysis was done using 2D-IEF SDS PAGE and nano-LC-MS/MS. Out of 91 differentially expressed proteins, 20 upregulated and 27 downregulated proteins were shared among the stresses. The multivariate data analysis revealed abundance of elongation factor Ts (spot C42), uridine phosphorylase, fructose-bisphosphate aldolase, peptidase T, cobalt ECF transporter T component CbiQ, UDP-N-acetylmuramate-l-alanine ligase, uncharacterized protein, aspartokinase, chaperone protein DnaK, IGP synthase cyclase subunit, probable nicotinate-nucleotide adenylyltransferase, NADH-quinone oxidoreductase, holo-[acyl-carrier-protein] synthase, l-lactate dehydrogenase, and uncharacterized protein. The maximum number of differentially expressed proteins belonged to carbohydrate and protein metabolism, which indicates Lc. garvieae shifts towards growth and energy metabolism for resistance against stress conditions.

Chronic Pruritus in Atopic Patients Treated with Dupilumab: Real Life Response and Related Parameters in 354 Patients.

Chronic pruritus is a major symptom of atopic dermatitis (AD). Its etiopathogenesis is complex, and an understanding of the driving factors of its pathogenesis allows for the development of new molecule-targeted therapies. Dupilumab, targeting and blocking interleukin-4 (IL-4) and interleukin-13 (IL-13) molecules, has shown great efficacy in treating AD symptoms such chronic itching. We performed a retrospective observational study to evaluate possible chronic-itch-related characteristics and parameters in 356 AD patients who received dupilumab. The objective of the study was to evaluate the factors associated with the level of pruritus reported by patients at each of the 1575 detections in the form of the peak pruritus numerical rating scale (NRSpp) and sleep disturbance numerical rating scale (NRSsd). We focused on: the eczema area and severity index (EASI), dermatology life quality index (DLQI), patient-oriented eczema measure (POEMS), eosinophilia, L-lactate dehydrogenase (LDH), immunoglobulin E (IgE) and the time from the start of dupilumab therapy. NRSpp fell from 8.6 (sd 1.7) at baseline to 1.7 (sd 2.3) at 36 months and NRSsd from 7 (sd 3) to 0. Regarding the parameters that correlate with NRSpp, all the parameters analysed were significantly correlated except for eosinophils (p = 0.136). In the multivariate analysis, both considering and not considering treatment duration, the parameters were correlated (p < 0.001); EASI, DLQI, POEM, and LDH significantly correlated with NRSpp (p < 0.001 for each, except for LDH p = 0.003); while IgE tot lost significance (p = 0.337). Similar results were obtained for the parameters correlating with NRSsd. Our results confirm the efficacy of dupilumab on pruritus. The use of questionnaires such as DLQI and POEM is advisable in clinical practice and is adequate for assessing the impact of itching on AD. The low correlation of IgE and eosinophils, the ambiguity of LDH levels with the level of pruritus, and a poor clinical validity and unclear correlation with disease severity suggest a progressive abandonment of monitoring of these values.

Microbial and genes diversity analysis: Relationship between starch conversion and carbohydrate metabolism during Niandoubao fermentation via the glutinous proso millet (GPM) process

Niandoubao is an ancient Chinese northeast fermented food mainly manufactured by glutinous proso millet (GPM). Succession and carbohydrate metabolism of complex microorganisms during GPM soaking (primarily spontaneous fermentation) may affect pH and starch content and then change the texture properties of Niandoubao. This study determined physicochemical parameters during the GPM spontaneous fermentation period, including pH, starch components, and reducing sugar content. Analysis of microbial diversity and the functional pathways related to these physicochemical parameters were also performed by 16S rDNA and metagenomics sequencing. Results showed that the pH value significantly decreased during the GPM spontaneous fermentation process. The total starch content and amylopectin content of fermented samples decreased significantly (p < 0.05), and amylose content increased overall but decreased slightly during fermentation while reducing sugar content increased. In addition, the Lactococcus genus was a predominate genus during the spontaneous fermentation period according to high throughput sequencing results. The metagenomic results further confirmed that Lactococcus lactis species encodes α-amylase (amyA/malS), α-glucosidase (malZ), and l-lactate dehydrogenase (ldh) contributed the most to starch degradation and increased of reducing sugar content and lactic acid production. Our study provides a new research angle to 16S rDNA high throughput sequencing combined with metagenomic sequencing analysis on microorganisms and metabolisms in spontaneous GPM fermentation for starch's acidic and enzymatic degradation. It is also concluded that Lactococcus lactis showed the potential use as a starter for Niandoubao manufacture.

Sugar Shock: Probing Streptococcus pyogenes Metabolism Through Bioluminescence Imaging.

Streptococcus pyogenes (S. pyogenes) can thrive in its host during an infection, and, as a result, it must be able to respond to external stimuli and available carbon sources. The preclinical use of engineered pathogens capable of constitutive light production may provide real-time information on microbial-specific metabolic processes. In this study, we mapped the central metabolism of a luxABCDE-modified S. pyogenes Xen20 (Strep. Xen20) to its de novo synthesis of luciferase substrates as assessed by the rate of light production in response to different environmental triggers. Previous characterization predicted that the lux operon was under the myo-inositol iolE promotor. In this study, we revealed that supplementation with myo-inositol generated increased Strep. Xen20 luminescence. Surprisingly, when supplemented with infection-relevant carbon sources, such as glucose or glycine, light production was diminished. This was presumably due to the scavenging of pyruvate by L-lactate dehydrogenase (LDH). Inhibition of LDH by its inhibitor, oxamate, partially restored luminescent signal in the presence of glucose, presumably by allowing the resulting pyruvate to proceed to acetyl-coenzyme A (CoA). This phenomenon appeared specific to the lactic acid bacterial metabolism as glucose or glycine did not reduce signal in an analogous luxABCDE-modified Gram-positive pathogen, Staph. Xen29. The Strep. Xen20 cells produced light in a concentration-dependent manner, inversely related to the amount of glucose present. Taken together, our measures of microbial response could provide new information regarding the responsiveness of S. pyogenes metabolism to acute changes in its local environments and cellular health.

Survival in adult patients with BRAFV600 mutation-positive advanced melanoma: a noninterventional ambispective study of patients with cobimetinib combined with vemurafenib during the French early access program: MELANIS study.

Cobimetinib combined with vemurafenib was available in France in 2015 through a 'Temporary Authorization for Use' program (TAU, preapproval access pending its marketing on 2016) for patients with v-raf murine sarcoma viral oncogene homolog B1-mutant advanced melanoma. This study aimed to provide real-world outcomes in patients previously registered in this TAU. This noninterventional, ambispective, multicentre French study, conducted in patients previously registered in TAU, aimed to estimate overall survival (OS) and progression-free survival (PFS) and to describe the tolerability of the therapeutic combination. At first cobimetinib intake (in combination with vemurafenib), 88% of the 185 evaluable patients had disease stage IV (brain metastasis: 70% of them), 31% had elevated lactate dehydrogenases, and 10% had an Eastern Cooperative Oncology Group (ECOG) index ≥2. Median OS was 16.1 months (95% CI, 12.5-20.7). Brain metastasis ( P < 0.001), ECOG index ≥2 ( P = 0.007), and hepatic impairment ( P = 0.037) were found as independent factors significantly associated with shorter survival. Median PFS was 7.3 months (95% CI, 5.2-8.4). ECOG index ≥2 ( P = 0.006) was significantly associated with shorter PFS. Between cobimetinib start and inclusion, increased CPK (3% of patients), retinal serous detachment (3%), decreased left ventricular ejection fraction (3%), increased transaminases (3%), and rash (3%) were the most reported serious adverse events. This study provides real-world outcomes in France for the vemurafenib-cobimetinib combination available in patients with BRAF-mutant-advanced melanoma. Our data tend to confirm in the real-life setting that this combination therapy is effective in such patients, with a safety profile consistent with previous interventional studies.

Quantitative Computed Tomography Parameters in Coronavirus Disease 2019 Patients and Prediction of Respiratory Outcomes Using a Decision Tree.

BackgroundChest computed tomography (CT) scans play an important role in the diagnosis of coronavirus disease 2019 (COVID-19). This study aimed to describe the quantitative CT parameters in COVID-19 patients according to disease severity and build decision trees for predicting respiratory outcomes using the quantitative CT parameters.MethodsPatients hospitalized for COVID-19 were classified based on the level of disease severity: (1) no pneumonia or hypoxia, (2) pneumonia without hypoxia, (3) hypoxia without respiratory failure, and (4) respiratory failure. High attenuation area (HAA) was defined as the quantified percentage of imaged lung volume with attenuation values between −600 and −250 Hounsfield units (HU). Decision tree models were built with clinical variables and initial laboratory values (model 1) and including quantitative CT parameters in addition to them (model 2).ResultsA total of 387 patients were analyzed. The mean age was 57.8 years, and 50.3% were women. HAA increased as the severity of respiratory outcome increased. HAA showed a moderate correlation with lactate dehydrogenases (LDH) and C-reactive protein (CRP). In the decision tree of model 1, the CRP, fibrinogen, LDH, and gene Ct value were chosen as classifiers whereas LDH, HAA, fibrinogen, vaccination status, and neutrophil (%) were chosen in model 2. For predicting respiratory failure, the decision tree built with quantitative CT parameters showed a greater accuracy than the model without CT parameters.ConclusionsThe decision tree could provide higher accuracy for predicting respiratory failure when quantitative CT parameters were considered in addition to clinical characteristics, PCR Ct value, and blood biomarkers.

Transcriptomic analysis of the genes for lactate dehydrogenase isomers in the reindeer' rumen of the Nenets Autonomous District in summer

Reindeer are unique arctic ruminants. They exist in conditions of extremely poor nutrition; therefore, the processes occurring in the rumen are of great scientific interest. It is known that the formation of lactate in the rumen is a key mechanism of metabolic disorders in the body of ruminants. Therefore, the aim of our study was to study the difference in the expression of two isomers of lactate dehydrogenases in the rumen of reindeer and to assess the level of enzymes depending on the sex and age of the animals.To assess the differences in the formation of lactate by microorganisms of the rumen community of reindeer in the summer‐autumn period, we carried out a transcriptomic analysis of the D and L genes of lactate dehydrogenases. For this, 12 samples were taken to isolate RNA from females (vazhenki), males (choirs), and calves of rumen fluid from deer in the summer‐autumn period in the Nenets Autonomous District. Relative expression was calculated using the 2 ‐∆∆Ct method. The 16SrRNA gene was chosen as a reference gene. Primers for L‐lactate dehydrogenase: F: CATCAAAAAGTTGTGTTAGTCGGCG, R: TCAGCTAAACCGTCGTTAAGCACTT. Primers for D‐lactate dehydrogenase: F: CTGGGATCCGTTGAGGGAGATGCTTAAG, R: CCGAAGCTTTTAGTTGACCCGGTTGAC.As a result of our work, we identified differences in the expression of lactate dehydrogenase genes between male and female reindeer. In males, a lower level of expression of genes of lactate dehydrogenases L and D types in the rumen was noted in comparison with females. It was 10 times less than that in the female rumen (p = 0.002 for L‐ldh, p = 0.001 for D‐ldh). Calves also showed higher levels of expression of these two genes compared to adult animals. The expression level of L‐ldh in the rumen of calves was 3 times higher than in adult animals (p = 0.03), and D‐ldh was two times less than in adult animals (p = 0.04). Lactic acid is formed as a result of lactic acid fermentation under the action of two different forms of lactate dehydrogenases: one of them (EC 1.1.1.27) produces the isomer L (+) ‐ lactate L‐lactate dehydrogenase, and the other (EC 1.1.1.28) produces the isomer D (‐) ‐ lactate D‐lactate dehydrogenase. The synthesized optical isomers have significant differences. These differences are essential for the normal physiological state of the animal, since the isomers differ in their ability to be excreted by the kidneys. D‐lactate has a lower excretion capacity and this determines its role in provoking metabolic acidosis. In addition, the genes of two isomers of lactate dehydrogenases are capable of performing the function of biological markers for the activity of the processes of lactic acid synthesis in the rumen of ruminants. In our study, females had a higher level of expression of both types of lactate dehydrogenases compared to males. Consequently, females may be more susceptible to associated metabolic disorders such as acidosis.

Abnormal laboratory findings review in SARS-CoV-2 infection

COVID-19 can trigger damage to the function and integrity of multiple cells, tissue or organs. In the progression of clinical manifestations, laboratory biomarkers can be used as predictors of prognosis to support in clinical conduction. This study aims to evidence an updated review of the literature of changes in biochemical and hematological laboratory tests of individuals with COVID-19 from articles prospected from the SciELO, LILACS and PubMed databases. Although in severe clinical spectrums, especially in patients admitted to intensive care unit, tissue lesions are more intense and more evident laboratory changes, can be observed in general in patients infected with SARS-CoV-2 increased levels of transaminases, alkaline phosphatase, gamma glutamyl transferase, bilirubin, urea, creatinine, lactic dehydrogenases, amylase, lipase, troponins, NT-ProBNP, pro-BNP, as well as reduction of MCV and MCHC, lymphopenia, neutrophilia, eosinopenia, thrombocytopenia, and prolongation of PT and aPTT.