KT2440 Genome Research Articles

Enhanced production of polyhydroxyalkanoates in Pseudomonas putida KT2440 by a combination of genome streamlining and promoter engineering

Polyhydroxyalkanoates (PHAs), a class of bioplastics produced by a variety of microorganisms, have become the ideal alternatives for oil-derived plastics due to their superior physicochemical and material characteristics. Pseudomonas putida KT2440 can produce medium-chain-length PHA (mcl-PHA) from various substrates. In this study, a novel strategy of the large-scale deletion of genomic islands (GIs) coupling with promoter engineering was developed in P. putida KT2440 for constructing the minimal genome cell factories (MGF) capable of efficiently producing mcl-PHA. Firstly, P. putida KTU-U13, a 13 GIs- and upp-deleted mutant derived from the parental strain P. putida KT2440, was used as a starting strain for further deletion of GIs to generate a series of genome-reduced strains. Subsequently, the two minimal genome strains KTU-U24 and KTU-U27, which had a 7.19% and 8.35% reduction relative to the genome size of KT2440 and were advantageous over the strain KTU (KT2440∆upp) and KTU-U13 in several physiological traits such as the maximum specific growth rate, plasmid transformation efficiency, heterologous protein expression capacity and PHA production capacity, were selected as the chassis cells for PHA metabolic engineering. To prevent the formation of the by-product gluconic acid, the glucose dehydrogenase gene was deleted in KTU-U24 and KTU-U27, resulting in KTU-U24∆gcd and KTU-U27∆gcd. To enhance the transcriptional level of PHA synthase genes (phaC) and the supply of the precursor acetyl-CoA, a strong endogenous promoter P46 was inserted into upstream of the phaC operon and pyruvate dehydrogenase gene in the genome of KTU-U24∆gcd and KTU-U27∆gcd, to generate KTU-U24∆gcd-P46CA and KTU-U27∆gcd-P46CA, with the PHA yield of 50.5 wt% and 53.8 wt% (weight percent of PHA in cell dry weight). Finally, KTU-U27∆gcd-P46CA, the most minimal KT2440 chassis currently available, was able to accumulate the PHA to 55.82 wt% in a 5-l fermentor, which is the highest PHA yield obtained with P. putida KT2440 so far. This study suggests that genome streamlining in combination with promoter engineering may be a feasible strategy for the development of the MGF for the efficient production of high value products. Moreover, further streamlining of the P. putida KT2440 genome has great potential to create the optimal chassis for synthetic biology applications.

Development of a novel promoter engineering-based strategy for creating an efficient para-nitrophenol-mineralizing bacterium

A toxic and persistent pollutant para-nitrophenol (PNP) enters into the environment through improper industrial waste treatment and agricultural usage of chemical pesticides, leading to a potential risk to humans. Although a variety of PNP-degrading bacteria have been isolated, their application in bioremediation has been precluded due to unknown biosafety, poor PNP-mineralizing capacity, and lack of genome editing tools. In this study, a novel promoter engineering-based strategy is developed for creating efficient PNP-mineralizing bacteria. Initially, a complete PNP biodegradation pathway from Pseudomonas sp. strain WBC-3 was introduced into the genome of a biosafety and soil-dwelling bacterium Pseudomonas putida KT2440. Subsequently, five strong promoters were identified from P. putida KT2440 by transcriptome analysis and strength characterization, and each of the five promoters was independently inserted into upstream of the pnp operon in the KT2440 genome. Consequently, a P8 promoter-substituted mutant strain showed the highest PNP degradation rate and strong tolerance against high concentrations of PNP. Furthermore, when using P8 promoter to regulate the transcription of all PNP degradation genes pnpABCDEF, the complete and efficient PNP mineralization was demonstrated by stable isotope 13C-labeled PNP transformation assay. Additionally, the finally constructed KTU-P8pnp can be monitored using integrated GFP on chromosome. This strategy of a combination of pathway construction and promoter engineering should open new avenues for creating efficient degraders for bioremediation.

Deletion of genomic islands in the Pseudomonas putida KT2440 genome can create an optimal chassis for synthetic biology applications

BackgroundGenome streamlining is a feasible strategy for constructing an optimum microbial chassis for synthetic biology applications. Genomic islands (GIs) are usually regarded as foreign DNA sequences, which can be obtained by horizontal gene transfer among microorganisms. A model strain Pseudomonas putida KT2440 has broad applications in biocatalysis, biotransformation and biodegradation.ResultsIn this study, the identified GIs in P. putida KT2440 accounting for 4.12% of the total genome size were deleted to generate a series of genome-reduced strains. The mutant KTU-U13 with the largest deletion was advantageous over the original strain KTU in several physiological characteristics evaluated. The mutant KTU-U13 showed high plasmid transformation efficiency and heterologous protein expression capacity compared with the original strain KTU. The metabolic phenotype analysis showed that the types of carbon sources utilized by the mutant KTU-U13 and the utilization capabilities for certain carbon sources were increased greatly. The polyhydroxyalkanoate (PHA) yield and cell dry weight of the mutant KTU-U13 were improved significantly compared with the original strain KTU. The chromosomal integration efficiencies for the γ-hexachlorocyclohexane (γ-HCH) and 1,2,3-trichloropropane (TCP) biodegradation pathways were improved greatly when using the mutant KTU-U13 as the recipient cell and enhanced degradation of γ-HCH and TCP by the mutant KTU-U13 was also observed. The mutant KTU-U13 was able to stably express a plasmid-borne zeaxanthin biosynthetic pathway, suggesting the excellent genetic stability of the mutant.ConclusionsThese desirable traits make the GIs-deleted mutant KTU-U13 an optimum chassis for synthetic biology applications. The present study suggests that the systematic deletion of GIs in bacteria may be a useful approach for generating an optimal chassis for the construction of microbial cell factories.

Biotransformation of 2,4-dinitrotoluene by the beneficial association of engineered Pseudomonas putida with Arabidopsis thaliana.

2,4-dinitrotoluene (2,4-DNT) is a priority environmental xenobiotic pollutant which has toxic, mutagenic, and carcinogenic properties. Thus, its biodegradation by applying recent approaches such as taking advantage of plant-bacteria interactions is crucial. In this work, the genes from Burkholderia sp. R34, necessary for 2,4-DNT degradation, were integrated into wild-type Pseudomonas putida (P. putida) KT2440 genome, and this strain, named KT.DNT, was inoculated to soil in in vitro conditions. To estimate the disappearance of 2,4-DNT in contaminated soil, samples were taken from different time intervals, extracted and analyzed using high-performance liquid chromatography (HPLC). Biotransformation of 2,4-DNT increased gradually and the degradation in soil after 14-days of treatment with the bacterium was found to be the 97.1%, indicating that the engineered strain could be a remarkable candidate for in situ bioremediation of 2,4-DNT-contaminated sites. In addition, in vitro interaction of this bacterium with a model plant, Arabidopsis thaliana (A. thaliana), enhanced lateral root and root hair formation together with dry root weight. Moreover, the initial 2,4-DNT concentration was decreased to 68% within 2h with the plant-associated KT.DNT in liquid culture. Hence, the usage of this bacterium with plants could also be a promising application for the 2,4-DNT biotransformation.

Combination of ssDNA recombineering and CRISPR-Cas9 for Pseudomonas putida KT2440 genome editing

Pseudomonas putida KT2440 is a Gram-negative, biosafety strain that plays important roles in environmental and biotechnological applications. Highly efficient genome editing strategy is essential to the elucidation of gene function and construction of metabolic engineered strains. Building on our previously established recombineering-mediated markerless and scarless P. putida KT2440 chromosomal gene deletion methods, herein we combined single-stranded DNA (ssDNA) recombineering and CRISPR-Cas9 technologies for P. putida KT2440 genome editing. Firstly, an inactive kanamycin resistance gene was knocked into the P. putida KT2440 chromosome. Then, based on kanamycin selection, recombinase gene selection, ssDNA recombineering condition optimization, and gRNA expression promoter selection were performed. A two-plasmid genome editing system was established; the first is a broad host range, RK2 replicon-based plasmid cloned with the tightly regulated redβ and cas9 genes; the second is a broad host range, pBBR1 replicon-based, sgRNA expression plasmid. Gene point mutations and gene deletions were carried out; the genome editing efficiency is as high as 100%. The method will expedite the P. putida KT2440 metabolic engineering and synthetic biology studies.

Coexistence of two d-lactate-utilizing systems in Pseudomonas putida KT2440.

It is advantageous for rhizosphere-dwelling microorganisms to utilize organic acids such as lactate. Pseudomonas putida KT2440 is one of the most widely studied rhizosphere-dwelling model organisms. The P. putida KT2440 genome contains an NAD-dependent d-lactate dehydrogenase encoding gene, but mutation of this gene does not play a role in d-lactate utilization. Instead, it was found that d-lactate utilization in P. putida KT2440 proceeds via a multidomain NAD-independent d-lactate dehydrogenase with a C-terminal domain containing several Fe-S cluster-binding motifs (Fe-S d-iLDH) and glycolate oxidase, which is widely distributed in various microorganisms. Both Fe-S d-iLDH and glycolate oxidase were identified to be membrane-bound proteins. Neither Fe-S d-iLDH nor glycolate oxidase is constitutively expressed but both of them can be induced by either enantiomer of lactate in P. putida KT2440. This study shows a case in which an environmental microbe contains two types of enzymes specific for d-lactate utilization.

Pseudomonas 2.0: genetic upgrading of P. putida KT2440 as an enhanced host for heterologous gene expression.

BackgroundBecause of its adaptability to sites polluted with toxic chemicals, the model soil bacterium Pseudomonas putida is naturally endowed with a number of metabolic and stress-endurance qualities which have considerable value for hosting energy-demanding and redox reactions thereof. The growing body of knowledge on P. putida strain KT2440 has been exploited for the rational design of a derivative strain in which the genome has been heavily edited in order to construct a robust microbial cell factory.ResultsEleven non-adjacent genomic deletions, which span 300 genes (i.e., 4.3% of the entire P. putida KT2440 genome), were eliminated; thereby enhancing desirable traits and eliminating attributes which are detrimental in an expression host. Since ATP and NAD(P)H availability – as well as genetic instability, are generally considered to be major bottlenecks for the performance of platform strains, a suite of functions that drain high-energy phosphate from the cells and/or consume NAD(P)H were targeted in particular, the whole flagellar machinery. Four prophages, two transposons, and three components of DNA restriction-modification systems were eliminated as well. The resulting strain (P. putida EM383) displayed growth properties (i.e., lag times, biomass yield, and specific growth rates) clearly superior to the precursor wild-type strain KT2440. Furthermore, it tolerated endogenous oxidative stress, acquired and replicated exogenous DNA, and survived better in stationary phase. The performance of a bi-cistronic GFP-LuxCDABE reporter system as a proxy of combined metabolic vitality, revealed that the deletions in P. putida strain EM383 brought about an increase of >50% in the overall physiological vigour.ConclusionThe rationally modified P. putida strain allowed for the better functional expression of implanted genes by directly improving the metabolic currency that sustains the gene expression flow, instead of resorting to the classical genetic approaches (e.g., increasing the promoter strength in the DNA constructs of interest).Electronic supplementary materialThe online version of this article (doi:10.1186/s12934-014-0159-3) contains supplementary material, which is available to authorized users.

Pseudomonas 2.0: genetic upgrading of P. putida KT2440 as an enhanced host for heterologous gene expression

Because of its adaptability to sites polluted with toxic chemicals, the model soil bacterium Pseudomonas putida is naturally endowed with a number of metabolic and stress-endurance qualities which have considerable value for hosting energy-demanding and redox reactions thereof. The growing body of knowledge on P. putida strain KT2440 has been exploited for the rational design of a derivative strain in which the genome has been heavily edited in order to construct a robust microbial cell factory. Eleven non-adjacent genomic deletions, which span 300 genes (i.e., 4.3% of the entire P. putida KT2440 genome), were eliminated; thereby enhancing desirable traits and eliminating attributes which are detrimental in an expression host. Since ATP and NAD(P)H availability – as well as genetic instability, are generally considered to be major bottlenecks for the performance of platform strains, a suite of functions that drain high-energy phosphate from the cells and/or consume NAD(P)H were targeted in particular, the whole flagellar machinery. Four prophages, two transposons, and three components of DNA restriction-modification systems were eliminated as well. The resulting strain (P. putida EM383) displayed growth properties (i.e., lag times, biomass yield, and specific growth rates) clearly superior to the precursor wild-type strain KT2440. Furthermore, it tolerated endogenous oxidative stress, acquired and replicated exogenous DNA, and survived better in stationary phase. The performance of a bi-cistronic GFP-LuxCDABE reporter system as a proxy of combined metabolic vitality, revealed that the deletions in P. putida strain EM383 brought about an increase of >50% in the overall physiological vigour. The rationally modified P. putida strain allowed for the better functional expression of implanted genes by directly improving the metabolic currency that sustains the gene expression flow, instead of resorting to the classical genetic approaches (e.g., increasing the promoter strength in the DNA constructs of interest).

Expression and characterization of (R)-specific enoyl coenzyme A hydratases making a channeling route to polyhydroxyalkanoate biosynthesis in Pseudomonas putida

We investigated the expression of (R)-specific enoyl coenzyme A hydratase (PhaJ) in Pseudomonas putida KT2440 accumulating polyhydroxyalkanoate (PHA) from sodium octanoate in order to identify biosynthesis pathways of PHAs from fatty acids in pseudomonads. From a database search through the P. putida KT2440 genome, an additional phaJ gene homologous to phaJ4(Pa) from Pseudomonas aeruginosa, termed phaJ4(Pp), was identified. The gene products of phaJ1(Pp), which was identified previously, and phaJ4(Pp) were confirmed to be functional in recombinant Escherichia coli on PHA synthesis from sodium dodecanoate. Cytosolic proteins from P. putida grown on sodium octanoate were subjected to anion exchange chromatography and one of the eluted fractions with hydratase activity included PhaJ4(Pp), as revealed by western blot analysis. These results strongly suggest that PhaJ4(Pp) forms a channeling route from β-oxidation to PHA biosynthesis in P. putida. Moreover, the substrate specificity of PhaJ1(Pp) was suggested to be different from that of PhaJ1(Pa) from P. aeruginosa although these two proteins share 67% amino acid sequence identity.

Characterization of the RND family of multidrug efflux pumps: in silico to in vivo confirmation of four functionally distinct subgroups.

SummaryWe have developed a generalized profile that identifies members of the root‐nodulation‐cell‐division (RND) family of efflux pumps and classifies them into four functional subfamilies. According to Z‐score values, efflux pumps can be grouped by their metabolic function, thus making it possible to distinguish pumps involved in antibiotic resistance (group 1) from those involved in metal resistance (group 3). In silico data regarding efflux pumps in group 1 were validated after identification of RND efflux pumps in a number of environmental microbes that were isolated as resistant to ethidium bromide. Analysis of the Pseudomonas putida KT2440 genome identified efflux pumps in all groups. A collection of mutants in efflux pumps and a screening platform consisting of 50 drugs were created to assign a function to the efflux pumps. We validated in silico data regarding efflux pumps in groups 1 and 3 using 9 different mutants. Four mutants belonging to group 2 were found to be more sensitive than the wild‐type to oxidative stress‐inducing agents such as bipyridyl and methyl viologen. The two remaining mutants belonging to group 4 were found to be more sensitive than the parental to tetracycline and one of them was particularly sensitive to rubidium and chromate. By effectively combining in vivo data with generalized profiles and gene annotation data, this approach allowed the assignment, according to metabolic function, of both known and uncharacterized RND efflux pumps into subgroups, thereby providing important new insight into the functions of proteins within this family.

Identification of conditionally essential genes for growth ofPseudomonas putidaKT2440 on minimal medium through the screening of a genome‐wide mutant library

In silico models for Pseudomonas putida KT2440 metabolism predict 68 genes to be essential for growth on minimal medium. In this study a genome-wide collection of single-gene P. putida KT2440 knockouts was generated by mini-Tn5 transposon mutagenesis and used to identify genes essential for growth in minimal medium with glucose. Our screening of the knockout library allowed us to rescue mutants for 48 different knockouts that were conditionally essential for growth on minimal medium. The in vivo screening showed that 24 of these mutants had a insertion in genes proposed to be conditionally essential based on in silico models, whereas another 24 newly implicated conditionally essential genes have been found. For 10 of the in silico proposed conditionally essential genes not found in the screening, knockout mutants were available at the Pseudomonas Reference Culture Collection. These mutants were tested for conditional growth on minimal medium, but none of them was shown to be essential, suggesting that the in silico proposal was inaccurate. Among the set of identified conditionally essential genes were a number of genes involved in the biosynthesis of certain amino acids and vitamins. Auxotrophs for all amino acids predicted by the in silico models were found and, in addition, we also found auxotrophs for proline, serine, threonine and methionine, as well as auxotrophs for biotin, nicotinate and vitamin B12 that were not predicted in silico. Metabolic tests were performed to validate the mutants' phenotypes. Auxotrophies for l-Arg, l-Leu, l-Pro and l-Cys were bypassed by external addition of the corresponding d-amino acids, suggesting the existence of number of d- to l-amino acid racemases encoded by the KT2440 genome. Therefore, the in vivo high-throughput analysis presented here provides relevant insights into the metabolic cross-road of biosynthetic pathways in this microorganism, as well as valuable information for the fine tuning of current in silico metabolic models.

A genome-scale metabolic reconstruction of Pseudomonas putida KT2440: i JN746 as a cell factory

BackgroundPseudomonas putida is the best studied pollutant degradative bacteria and is harnessed by industrial biotechnology to synthesize fine chemicals. Since the publication of P. putida KT2440's genome, some in silico analyses of its metabolic and biotechnology capacities have been published. However, global understanding of the capabilities of P. putida KT2440 requires the construction of a metabolic model that enables the integration of classical experimental data along with genomic and high-throughput data. The constraint-based reconstruction and analysis (COBRA) approach has been successfully used to build and analyze in silico genome-scale metabolic reconstructions.ResultsWe present a genome-scale reconstruction of P. putida KT2440's metabolism, iJN746, which was constructed based on genomic, biochemical, and physiological information. This manually-curated reconstruction accounts for 746 genes, 950 reactions, and 911 metabolites. iJN746 captures biotechnologically relevant pathways, including polyhydroxyalkanoate synthesis and catabolic pathways of aromatic compounds (e.g., toluene, benzoate, phenylacetate, nicotinate), not described in other metabolic reconstructions or biochemical databases. The predictive potential of iJN746 was validated using experimental data including growth performance and gene deletion studies. Furthermore, in silico growth on toluene was found to be oxygen-limited, suggesting the existence of oxygen-efficient pathways not yet annotated in P. putida's genome. Moreover, we evaluated the production efficiency of polyhydroxyalkanoates from various carbon sources and found fatty acids as the most prominent candidates, as expected.ConclusionHere we presented the first genome-scale reconstruction of P. putida, a biotechnologically interesting all-surrounder. Taken together, this work illustrates the utility of iJN746 as i) a knowledge-base, ii) a discovery tool, and iii) an engineering platform to explore P. putida's potential in bioremediation and bioplastic production.

A global response to sulfur starvation inPseudomonas putidaand its relationship to the expression of low-sulfur-content proteins

Sulfur is essential for life on Earth, but its availability is limited in many environments. Here the sulfur-starvation response of the model soil bacterium Pseudomonas putida KT2440 is shown to be associated with an approximately fivefold reduction in the total soluble thiol content of the cell. A bioinformatic survey of the P. putida KT2440 genome identified 646 genes encoding proteins with a significantly lower than average sulfur content (low sulfur-content proteins, LSPs), the expression of which may have a role in the global reduction of cellular thiol content during sulfur starvation. Analysis of the genetic organization of the LSP-encoding genes showed that 31% were potentially transcriptionally associated with at least one other gene encoding a protein defined as an LSP. In particular, 55 LSP genes were located in three large clusters, termed low-sulfur islands (LSIs) here. The predicted identities of the proteins encoded by the LSIs strongly suggest that the LSIs have a role in acquiring sulfur from organic sulfur sources during sulfur starvation. This hypothesis was supported by transcription fusion studies on a limited number of LSP promoters under low-sulfur conditions. In a wider survey of bacterial species, LSIs were found to be more prevalent in free-living, Gram-negative bacteria than in Gram-positive or obligately intracellular bacteria.

Characterization of thePseudomonas putidaMobile Genetic Element ISPpu10: an Occupant of Repetitive Extragenic Palindromic Sequences

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

Expression analysis of the fpr (ferredoxin-NADP + reductase) gene in Pseudomonas putida KT2440

The ferredoxin-NADP + reductase ( fpr) participates in cellular defense against oxidative damage. The fpr expression in Pseudomonas putida KT2440 is induced by oxidative and osmotic stresses. FinR, a LysR-type transcriptional factor near the fpr gene in the P. putida KT2440 genome, is required for induction of the fpr under both conditions. We have shown that the fpr and finR gene products can counteract the effects of oxidative and osmotic stresses. Interestingly, FinR-independent expression occurs either during a long period of incubation with paraquat or with high concentrations of oxidative stress agent. This result indicates that there may be additional regulators present in the P. putida KT2440 genome. In contrast to in vivo expression kinetics of fpr from the plant pathogen, Pseudomonas syringae, the fpr gene from P. putida KT2440 exhibited unusually prolonged expression after oxidative stress. Transcriptional fusion and Northern blot analysis studies indicated that the FinR is negatively autoregulated. Expression of the fpr promoter was higher in minimal media than in rich media during exponential phase growth. Consistent with this result, the fpr and finR mutants had a long lag phase in minimal media in contrast to wild-type growth characteristics. Antioxidants such as ascorbate could increase the growth rate of all tested strains in minimal media. This result confirmed that P. putida KT2440 experienced more oxidative stress during exponential growth in minimal media than in rich media. Endogenous promoter activity of the fpr gene is much higher during exponential growth than during stationary growth. These findings demonstrate new relationships between fpr, finR, and the physiology of oxidative stress in P. putida KT2440.

Biofilm formation of Pseudomonas putida IsoF: the role of quorum sensing as assessed by proteomics

Pseudomonas putida strains are frequently isolated from the rhizosphere of plants and many strains promote plant-growth, exhibit antagonistic activities against plant pathogens and have the capacity to degrade pollutants. Factors that appear to contribute to the rhizosphere fitness are the ability of the organism to form biofilms and the utilization of cell-to-cell-communication systems (quorum sensing, QS) to co-ordinate the expression of certain phenotypes in a cell density dependent manner. Recently, the ppu QS locus of the tomato rhizosphere isolate P. putida Iso F was characterized and an isogenic QS-negative ppuI mutant P. putida F117 was generated. In the present study we investigated the impact of QS and biofilm formation on the protein profile of surface-associated proteins of P. putida IsoF. This was accomplished by comparative proteome analyses of the P. putida wild type IsoF and the QS-deficient mutant F117 grown either in planktonic cultures or in 60 h old mature biofilms. Differentially expressed proteins were identified by peptide mass fingerprinting and database search in the completed P. putida KT2440 genome sequence. The sessile life style affected 129 out of 496 surface proteins, suggesting that a significant fraction of the bacterial genome is involved in biofilm physiology. In surface-attached cells 53 out of 484 protein spots were controlled by the QS system, emphasizing its importance as global regulator of gene expression in P. putida IsoF. Most interestingly, the impact of QS was dependent on whether cells were grown on a surface or in suspension; about 50% of the QS-controlled proteins identified in planktonic cultures were found to be oppositely regulated when the cells were grown as biofilms. Fifty-seven percent of all identified surface-controlled proteins were also regulated by the ppu QS system. In conclusion, our data provide strong evidence that the set of QS-regulated proteins overlaps substantially with the set of proteins differentially expressed in sessile cells.

Cell envelope components contributing to biofilm growth and survival of Pseudomonas putida in low-water-content habitats.

Bacteria in terrestrial habitats frequently reside as biofilm communities on surfaces that are unsaturated, i.e. biofilms are covered in water films varying in thickness depending on the environmental conditions. Water availability in these habitats is influenced by the osmolarity of the water (solute stress) and by cellular dehydration imposed by matric stress, which increases as water content decreases. Unfortunately, we understand relatively little about the molecular mechanisms required for bacterial growth in low-water-content habitats. Here, we describe the use of mini-Tn5-'phoA to identify genes in Pseudomonas putida that are matric water stress controlled and to generate mutants defective in desiccation tolerance. We identified 20 genes that were induced by a matric stress but not by a thermodynamically equivalent solute stress, 11 genes were induced by both a matric and a solute stress, three genes were induced by a solute stress and three genes were repressed by a matric stress. Their patterns of expression were analysed in laboratory media, and their contribution to desiccation tolerance was evaluated. Twenty-six genes were homologous to sequences present in the completed P. putida KT2440 genome sequence or plasmid pWWO sequence that are involved in protein fate, nutrient or solute acquisition, energy generation, motility, alginate biosynthesis or cell envelope structure, and the function of five could not be predicted from the sequence. Together, these genes and their importance to desiccation tolerance provide a view of the environment perceived by bacteria in low-water-content habitats, and suggest that the mechanisms for adaptation for growth in low-water-content habitats are different from those for growth in high-osmolarity habitats.

Characterization of a new solvent-responsive gene locus in Pseudomonas putida F1 and its functionalization as a versatile biosensor.

A new gene cluster, designated sepABC and a divergently transcribed sepR, was found downstream of the two-component todST phosphorelay system that regulates toluene degradation (the tod pathway) in Pseudomonas putida F1 (PpF1). The deduced amino acid sequences encoded by sepABC show a high homology to bacterial proteins known to be involved in solvent efflux or multidrug pumps. SepA, SepB and SepC are referred to be periplasmic, inner membrane and outer membrane efflux proteins respectively. Effects on growth of various PpF1 mutants compared to that of the wild type in the presence of toluene indicated a possible protective role of the solvent efflux system in a solvent-stressed environment. Growth tests with the complemented mutants confirmed the involvement of the Sep proteins in conferring solvent tolerance. The sepR gene encodes a 260-residue polypeptide that is a member of the E. coli IclR repressor protein family. The repressor role of SepR was established by conducting tests with a sep-lacZ transcriptional fusion in Escherichia coli and PpF1, expression of SepR as a maltose-binding fusion protein in a DNA binding assay, and mRNA analysis. Southern hybridization experiments and analysis of the P. putida KT2440 genome sequence indicated that sepR is a relatively rare commodity compared to homologues of the sepABC genes. We developed a whole-cell bioluminescent biosensor, PpF1G4, which contains a chromosomally based sep-lux transcriptional fusion. The biosensor showed significant induction of the sepABC genes by a wide variety of aromatic molecules, including benzene, toluene, ethylbenzene, and all three isomers of xylene (BTEX), naphthalene, and complex mixtures of aliphatic and aromatic hydrocarbons. PpF1G4 represents a second-generation biosensor that is not based on a catabolic promoter but is nonetheless inducible by aromatic pollutants and moreover functional under nutrient-rich conditions.

Global features of the Pseudomonas putida KT2440 genome sequence.

The compositional bias of the G+C, di- and tetranucleotide contents in the 6 181 862 bp Pseudomonas putida KT2440 genome was analysed in sliding windows of 4000 bp in steps of 1000 bp. The genome has a low GC skew (mean 0.066) between the leading and lagging strand. The values of GC contents (mean 61.6%) and of dinucleotide relative abundance exhibit skewed Gaussian distributions. The variance of tetranucleotide frequencies, which increases linearly with increasing GC content, shows two overlapping Gaussian distributions of genome sections with low (minor fraction) or high variance (major fraction). Eighty per cent of the chromosome shares similar GC contents and oligonucleotide bias, but 105 islands of 4000 bp or more show atypical GC contents and/or oligonucleotide signature. Almost all islands provide added value to the metabolic proficiency of P. putida as a saprophytic omnivore. Major features are the uptake and degradation of organic chemicals, ion transport and the synthesis and secretion of secondary metabolites. Other islands endow P. putida with determinants of resistance and defenceor with constituents and appendages of the cell wall. A total of 29 islands carry the signature of mobile elements such as phage, transposons, insertion sequence (IS) elements and group II introns, indicating recent acquisition by horizontal gene transfer. The largest gene carries the most unusual sequence that encodes a multirepeat threonine-rich surface adhesion protein. Among the housekeeping genes, only genes of the translational apparatus were located in segments with an atypical signature, suggesting that the synthesis of ribosomal proteins is uncoupled from the rapidly changing translational demands of the cell by the separate utilization of tRNA pools.

Identification and characterization of the AgmR regulator of Pseudomonas putida: role in alcohol utilization.

Two-phase partitioning bioreactors (TPPBs) comprise an aqueous phase containing all non-carbon nutrients necessary for microbial growth and a solvent phase containing high concentrations of inhibitory or toxic substrates that partition at sub-inhibitory levels to the aqueous phase in response to cellular demand. This work aimed at eliminating the growth of Pseudomonas putida ATCC 11172 on medium-chain-length (C8-C12) aliphatic alcohols, hence enabling their use as xenobiotic delivery solvents within two-phase partitioning bioreactors. Experiments resulted in the isolation of a mini-Tn5 mutant unable to utilize these alcohols. The mutation, which also eliminated growth on glycerol and ethanol, was identified to be within a homologue of the P aeruginosa agmR gene, which encodes a response regulator. Enzyme analysis of the agmR::Tn5Km mutant cell extracts revealed a 10-fold decrease in pyrroloquinoline quinone (PQQ)-dependent alcohol dehydrogenase activity. A knockout in a gene (exaA) encoding a PQQ-linked alcohol dehydrogenase slowed but did not eliminate growth on medium-chain-length alcohols or ethanol, suggesting metabolic redundancy within P. putida ATCC 11172. Analysis of P. putida KT2440 genome sequence data indicated the presence of two PQQ-linked alcohol dehydrogenase-encoding genes. The successful elimination of alcohol utilization in the agmR mutant indicates control by AgmR on multiple pathways and presents a useful strain for biotechnological applications requiring alcohol non-utilizing microbial catalysts.