Keratinocyte-derived Chemokine Research Articles

Mesenchymal stromal cells reduce inflammation and improve lung function in a mouse model of cystic fibrosis lung disease

Mesenchymal stromal cells (MSCs) are multipotent adult stem cells which possess immunomodulatory and repair capabilities. In this study, we investigated whether MSC therapy could modulate inflammation and lung damage in the lungs of Scnn1b-transgenic mice overexpressing the β-subunit of the epithelial sodium channel (β-ENaC), a model with features of Cystic Fibrosis lung disease. Human bone marrow derived MSC cells were intravenously delivered to mice, prior to collection of bronchoalveolar lavage (BALF) and tissue. BALF analysis revealed a significant reduction in inflammatory cells after MSC administration, with both monocytic cells and neutrophils significantly reduced. Pro-inflammatory cytokines keratinocyte-derived chemokine (KC) and osteopontin were also significantly reduced. Histological tissue analysis revealed a reduction in emphysema in Scnn1b-TG mice treated with MSCs and consistent with these findings, improvements in lung function after MSC therapy were observed. Furthermore, MSCs enhanced Ki67 staining in alveolar cells, which may indicate regeneration of the destroyed parenchyma. Mechanistically, restoration of peroxisome proliferator-activated receptor-γ (PPARγ) expression and its transcriptional program were identified after MSC treatment. Our data demonstrate that MSC therapy can reduce inflammation, damage, and lung function decline in the chronically inflamed lung of Scnn1b-Tg mice, suggesting that MSCs may provide an effective tool in the treatment of muco-obstructive diseases such as cystic fibrosis.

Gastroprotective potential of the aqueous extract of nine-steaming and nine-sun-drying processed Polygonatum cyrtonema Hua against alcoholic gastric injury in mice

Ethnopharmacological relevancePolygonatum (Huangjing) genus has been used as both food and medicine in China for 2000 years, which was regarded as a “Top-grade” herb in the Shennong Bencao Jing. The most commonly used species is the rhizome of Polygonatum cyrtonema Hua (PC) that is traditionally utilized to invigorate Qi, nourish Yin, moisten lung, and tonify spleen and kidney. Aim of the studyExcessive alcohol consumption causes severe upper-gastrointestinal diseases, notably gastric mucosal damage characterized by hemorrhagic gastritis, which lacks safe and effective intervention. This study aims to investigate the gastroprotective effects of nine-steaming and nine-drying processed Polygonatum cyrtonema Hua (PPC) on alcohol-induced gastric mucosal damage in mice. Materials and methodsPPC extract was chemically characterized by UPLC-QE-MS analysis. ICR mice were subjected to an ethanol-induced gastric lesion model and were orally administered PPC aqueous extract for 5 consecutive days. After treatment, gastric tissues were stained with hematoxylin and eosin (H&E), and the pro-inflammatory and oxidative stress factors were determined using ELISA and Multiplex assay, while the gene expressions of gastric tissues were detected by RNA-seq and Western blotting. ResultsPPC reduced the alcohol concentration of liquor in vitro and protected against alcohol-induced gastric mucosal lesion in mice. Notably, PPC aqueous extract relieved alcohol-induced pro-inflammatory and oxidative stress factors, including interleukin 6 (IL-6), IL-8, keratinocyte-derived chemokine (KC), monocyte chemotactic protein-1 (MCP-1), superoxide dismutase (SOD), glutathione (GSH), and malondialdehyde (MDA). RNA-sequencing analysis revealed that ethanol exposure activated mitogen-activated protein kinases (MAPKs), tumor necrosis factor (TNF), and IL-17 signaling pathways in gastric tissue, and these activated signaling pathways were inhibited by the PPC treatment. Consistently, Western blot data showed that PPC treatment suppressed the activation of extracellular signal-regulated kinases (ERK), p38, c-Jun N-terminal kinases (JNK), TNF-α and IL-17A pathways in gastric tissue. ConclusionIn conclusion, the aqueous extract of PPC exerted a gastroprotective effect against alcohol-induced gastric injury by alleviating inflammation and oxidative stress, potentially through the inhibition of the MAPKs, IL-17 and TNF-α pathways. These findings supported the future development of PPC as an effective intervention for alcohol-induced gastric damage.

Organotypic brain slices as a model to study the neurotropism of the highly pathogenic Nipah and Ebola viruses.

Nipah virus (NiV) and Ebola virus (EBOV) are highly pathogenic zoonotic viruses with case fatality rates of up to 90%. While the brain is a known target organ following NiV infection, involvement of the central nervous system in EBOV-infected patients only became more evident after the West African epidemic in 2013-2016. To gain a deeper comprehension of the neurotropism of NiV and EBOV with respect to target cells, affected brain regions and local inflammatory responses, murine organotypic brain slices (BS) were established and infected. Both NiV and EBOV demonstrated the capacity to infect BS from adult wt mice and mice lacking the receptor for type I IFNs (IFNAR-/-) and targeted various cell types. NiV was observed to replicate in BS derived from both mouse strains, yet no release of infectious particles was detected. In contrast, EBOV replication was limited in both BS models. The release of several pro-inflammatory cytokines and chemokines, including eotaxin, IFN-γ, IL-1α, IL-9, IL-17a and keratinocyte-derived chemokine (KC), was observed in both virus-infected models, suggesting a potential role of the inflammatory response in NiV- or EBOV-induced neuropathology. It is noteworthy that the choroid plexus was identified as a highly susceptible target for EBOV and NiV infection, suggesting that the blood-cerebrospinal fluid barrier may serve as a potential entry point for these viruses.

Schisandrol A Alleviates Allergic Asthma in Mice via Regulating the NF-κB/IκBα and Nrf2/HO-1 Signaling Pathways.

Schisandra chinensis (Turcz) Baill (S. chinensis) is the key traditional Chinese medicine for the treatment of asthma used by ancient and modern medical practitioners. However, the material basis and the main mechanism of its antiasthmatic effect remain unclear. Our preliminary results showed that schisandrol A (SCA), a representative monomer of Schisandra lignans, had the best relaxation effect on tracheal rings in isolated rats. In this research, a mouse asthma model was prepared by combining ovalbumin (OVA) with Al (OH)3 for exploring the antiasthmatic action and the underlying mechanism of SCA. The study results demonstrated that SCA improved the behavior of mice with asthma and pathological changes in their lung tissues and airways, decreased serum immunoglobulin E (IgE) and OVA-IgE levels, interleukin-4 (IL-4), IL-5, IL-13, and eotaxin contents, and leukocytes number in bronchoalveolar lavage fluid. SCA downregulated the gene expressions of keratinocyte-derived protein chemokines and ILs and reduced the expressions of phosphorylated IκB kinase α (p-IKKα) and p-nuclear factor kappa-B (NF-κB) proteins in lung tissues. In addition, it was found that SCA could significantly increase T-superoxide dismutase and catalase activities, decrease malondialdehyde content, and elevate p-IκBα, NF-E2-related-factor 2 (Nrf2), and heme oxygenase-1 (HO-1) protein expressions. In summary, SCA treatment resulted in a significant improvement in the allergic bronchial asthma in mice, and its mechanisms may involve the regulation of the NF-κB/IκBα pathway to reduce inflammatory response and the Nrf2/HO-1 pathway to improve the body's antioxidant capacity. These results suggest that SCA is a key component of S. chinensis in exerting antiasthmatic effects.

KC-like chemokine as a biomarker of sepsis in dogs with pyometra

BackgroundSepsis, defined as a dysregulated inflammatory response to infection inducing organ dysfunction, is a common cause of mortality in both humans and animals. Early detection and treatment is essential for survival, but accurate diagnosis is challenging due to the lack of specific biomarkers for sepsis. This study explored the potential of the keratinocyte-derived chemokine (KC)-like protein in dogs as a biomarker of sepsis in dogs with bacterial uterine infection (pyometra). The aim was to compare KC-like concentrations in dogs with pyometra with or without sepsis and to assess associations between KC-like and clinical variables, including days of hospitalization as an outcome.ResultsA mouse KC ELISA was validated and used to determine the concentrations of KC-like in serum from 34 dogs with pyometra and 18 healthy controls. Dogs with pyometra were classified as having sepsis based on two different criteria for systemic inflammatory response syndrome (SIRS), resulting in 74% and 30% sepsis-positive, respectively. The concentration of KC-like protein was higher in pyometra dogs with sepsis than in pyometra dogs without sepsis (p < 0.05) and in healthy controls (p < 0.0001) when using either of the two SIRS criteria. Moreover, KC-like was slightly increased in dogs with pyometra without sepsis compared with healthy controls when using the more stringent SIRS criteria (p < 0.05). Analyses of all dogs showed that KC-like concentrations correlated positively with hospitalization days, C-reactive protein (CRP) concentrations, white blood cells, and percentage of band neutrophils; however, KC-like correlated negatively with hemoglobin and did not correlate with circulating creatinine.ConclusionsOur results suggest that circulating KC-like protein increases in dogs with sepsis in pyometra and that KC-like is associated with more severe clinical illness. These findings support a potential role of KC-like as a biomarker of sepsis; however, the true identity of KC-like in dogs has yet to be uncovered.

Phytochemical Profile, Antioxidant, Anti-Atopic, and Anti-Inflammatory Activities of Filipendula glaberrima Nakai at Different Growth Stages.

Since atopic dermatitis is an inflammatory skin disease, natural remedies, such as Filipendula glaberrima Nakai (FG), with anti-inflammatory properties are possible promising therapeutic options. This study aimed to investigate the therapeutic potential of FG extracts at different growth stages. Seven compounds were isolated from the FG leaf extracts using open-column chromatography, and they were analyzed using HPLC. The extracts were further evaluated for their total polyphenol and flavonoid content (TPC and TFC). The in vitro antioxidant properties of the FG extracts were evaluated using radical scavenging assays, whereas their anti-inflammatory activities were assessed by evaluating their ability to inhibit the production of inflammation-associated biomarkers using the Griess assay and ELISA, respectively. The MTT assay was used to evaluate the viability and cytotoxicity of the FG extracts in keratinocyte cell lines. The results showed that the full-flowering stage exhibited the highest TPC, TFC, and antioxidant activities, thus suggesting a positive correlation between these properties. All FG extracts showed significant anti-inflammatory activity by inhibiting the production of pro-inflammatory biomarkers in lipopolysaccharide-stimulated macrophages. Additionally, the FG extracts suppressed the production of cytokines and chemokines in keratinocytes, indicating their anti-atopic potential. HPLC analysis revealed that the full-flowering stage had the highest content of all the analyzed phytochemicals (gallic acid, (+)-catechin, hyperin, miquelianin, astragalin, afzelin, and quercetin). These results suggest that the full-flowering stage of FG is the most promising source for therapeutic applications owing to its superior phytochemical profile and biological activities. This study highlights the potential of FG extracts, particularly in its full-flowering stage, as a natural therapeutic agent for the management of inflammation-related diseases, and it can also serve as a reference for further research on FG.

Harnessing extracellular cold-inducible RNA binding protein by PS-OMe miR130: A promising shield against hemorrhage-induced lung injury.

Hemorrhagic shock (HS) poses a life-threatening condition with the lungs being one of the most susceptible organs to its deleterious effects. Extracellular cold-inducible RNA binding protein has emerged as a pivotal mediator of inflammation, and its release has been observed as a case of HS-induced tissue injury. Previous studies unveiled a promising engineered microRNA, designated PS-OMe miR130, which inhibits extracellular cold-inducible RNA binding protein, thereby safeguarding vital organs. In this study, we hypothesized that PS-OMe miR130 serves as a protective shield against HS-induced lung injury by curtailing the overzealous inflammatory immune response. Hemorrhagic shock was induced in male C57BL6 mice by withdrawing blood via a femoral artery cannula to a mean arterial pressure of 30 mm Hg for 90 minutes. The mice were resuscitated with twice the shed blood volume with Ringer's lactate solution. They were then treated intravenously with either phosphate-buffered saline (vehicle) or 62.5 nmol PS-OMe miR130. At 4 hours later, blood and lungs were harvested. Following PS-OMe miR130 treatment in HS mice, a substantial decrease was observed in serum injury markers including aspartate aminotransferase, alanine transaminase, lactate dehydrogenase, and blood urea nitrogen. Serum interleukin (IL)-6 exhibited a similar reduction. In lung tissues, PS-OMe miR130 led to a significant decrease in the messenger RNA expressions of pro-inflammatory cytokines (IL-6, IL-1β, and tumor necrosis factor α), chemokines (keratinocyte-derived chemokine and macrophage inflammatory protein 2), and an endothelial injury marker, E-selectin. PS-OMe miR130 also produced substantial inhibition of lung myeloperoxidase activity and resulted in a marked reduction in lung injury as evidenced by histological evaluation. This was further confirmed by the observation that PS-OMe miR130 significantly reduced the presence of lymphocyte antigen 6 family member G-positive neutrophils and terminal deoxynucleotidyl transferase dUTP nick end labeling-positive apoptotic cells. PS-OMe miR130 emerges as a potent safeguard against HS-induced lung injury by effectively inhibiting pro-inflammation and injuries, offering a promising therapeutic strategy in such critical clinical condition.

Kahweol Inhibits Pro-Inflammatory Cytokines and Chemokines in Tumor Necrosis Factor-α/Interferon-γ-Stimulated Human Keratinocyte HaCaT Cells.

Atopic dermatitis (AD), marked by intense itching and eczema-like lesions, is a globally increasing chronic skin inflammation. Kahweol, a diterpene that naturally occurs in coffee beans, boasts anti-inflammatory, antioxidative, and anti-cancer properties. This research explores the anti-inflammatory action of kahweol on HaCaT human keratinocytes stimulated by tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ), focusing on key signal transduction pathways. Our results demonstrate that kahweol markedly reduces the production of IL-1β, IL-6, C-X-C motif chemokine ligand 8, and macrophage-derived chemokine in TNF-α/IFN-γ-activated HaCaT cells. Furthermore, it curtails the phosphorylation of key proteins in the mitogen-activated protein kinase (MAPK) pathways, including c-Jun N-terminal kinase, extracellular signal-regulated kinase, and p38. Additionally, kahweol impedes the phosphorylation and nuclear translocation of the NF-κB p65 subunit and constrains its DNA-binding capability. It also hampers the phosphorylation, nuclear translocation, and DNA-binding activities of signal transducer and activator of transcription 1 (STAT1) and STAT3. Collectively, these findings suggest that kahweol hinders the generation of cytokines and chemokines in inflamed keratinocytes by inhibiting the MAPK, NF-κB, and STAT cascades. These insights position kahweol as a promising agent for dermatological interventions, especially in managing inflammatory skin conditions such as AD.

Voluntary exercise preserves visual function and reduces inflammatory response in an adult mouse model of autosomal dominant retinitis pigmentosa

Whole-body physical exercise has been shown to promote retinal structure and function preservation in animal models of retinal degeneration. It is currently unknown how exercise modulates retinal inflammatory responses. In this study, we investigated cytokine alterations associated with retinal neuroprotection induced by voluntary running wheel exercise in a retinal degeneration mouse model of class B1 autosomal dominant retinitis pigmentosa, I307N Rho. I307N Rho mice undergo rod photoreceptor degeneration when exposed to bright light (induced). Our data show, active induced mice exhibited significant preservation of retinal and visual function compared to inactive induced mice after 4 weeks of exercise. Retinal cytokine expression revealed significant reductions of proinflammatory chemokines, keratinocyte-derived chemokine (KC) and interferon gamma inducible protein-10 (IP-10) expression in active groups compared to inactive groups. Through immunofluorescence, we found KC and IP-10 labeling localized to retinal vasculature marker, collagen IV. These data show that whole-body exercise lowers specific retinal cytokine expression associated with retinal vasculature. Future studies should determine whether suppression of inflammatory responses is requisite for exercise-induced retinal protection.

Abstract 7478: Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production

Abstract Background: The study of TPC2 is of great interest in the field of cancer and immune diseases, as it plays a crucial role in various cellular processes, and there is substantial evidence that TPC2 sustains several cancer hallmarks (angiogenesis, autophagy, and metastasis). The expression and role of TPC2 and its relevance to cancer in the innate immune system remain unknown. Methods: U937 TPCN2 knockdown (KD) cells were developed by nucleofection-based transfection of CRISPR-Cas9 gene editing tools. sgRNA (single guide RNA): CGUGCUGGUGAGUGAGGAUG was designed to target the fourth exon of the TPCN2 gene (Transcript ID: ENST00000294309). The model was used in tandem with pharmacological modulators of TPC2 channel activity to underpin its function in monocyte differentiation, macrophage development, and IL-8 production. Molecular biology techniques, including Sanger sequencing, qPCR, ELISA, and WB, were utilized. Proteins of murine TPC2 WT and TPC2 KO cells were extracted and sent to the Discovery Proteomics Facility of the Target Discovery Institute for label-free quantification and proteomics analysis using mass spectrometry. Results: We developed TPC2-deficient human monocytes (U937 cells) with a 75% reduction in TPCN2 expression levels, and we demonstrated that TPCN2 genetically modified U937 monocytes were resistant to monocyte differentiation after treatment with increasing concentrations of PMA ranging from 100 ng/mL to 400 ng/mL. TPC2-deficient U937 monocytes were not differentiated into Mϕ. TPC2 acts as a major regulator of monocyte differentiation by modulating PKC-alpha via calpain. In addition, the levels of IL-8 were significantly reduced after treating U937 cells with Ned 19 (an NAADP antagonist) or TPC2 KD. Keratinocyte-derived chemokine (KC) and Macrophage inflammatory protein-2 (MIP-2) are the murine IL-8 homologues. Notably, the levels of MIP-2, but not KC, were significantly reduced in the TPC2 KO murine cells compared to the WT controls. Thus, TPC2 appears to be involved in IL-8 secretion in both humans and mice. In contrast to KC at the protein level, the KC expression level was significantly reduced in TPC2-deficient murine cells. TPC2 in EE/RE is involved in lipopolysaccharide (LPS)-mediated IL-8 production in U937 cells. TPC2 modulates immune targets involving CD38, PKC-alpha, and AKT.We found that 28 different proteins that play roles in cancer immunity showed significant changes in expression in TPC2-deficient murine cells (three overexpressed proteins and 25 down-expressed proteins), compared to WT. Conclusion: Our data provide the first preclinical proof of concept for TPC2 as a potential target for blocking macrophage development and modulating CD38/IL8 levels as therapeutic strategies for cancer patients, raising questions regarding the clinical utility of TPC2 as a biomarker or immunotherapy target to modulate immune responses. Citation Format: Abeer Alharbi, John Parrington. Unveiling the role of two-pore channel 2 (TPC2) in cancer immunity from monocyte differentiation to cytokine production [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7478.

Radiation Dermatitis: Radiation-Induced Effects on the Structural and Immunological Barrier Function of the Epidermis.

An important hallmark of radiation dermatitis is the impairment of the mitotic ability of the stem/progenitor cells in the basal cell layers due to radiation-induced DNA damage, leading to suppressed cell renewal in the epidermis. However, this mechanism alone does not adequately explain the complex pathogenesis of radiation-induced skin injury. In this review, we summarize the latest findings on the complex pathogenesis of radiation dermatitis and correlate these with the clinical features of radiation-induced skin reactions. The current studies show that skin exposure to ionizing radiation induces cellular senescence in the epidermal keratinocytes. As part of their epithelial stress response, these senescent keratinocytes secrete pro-inflammatory mediators, thereby triggering skin inflammation. Keratinocyte-derived cytokines and chemokines modulate intercellular communication with the immune cells, activating skin-resident and recruiting skin-infiltrating immune cells within the epidermis and dermis, thereby orchestrating the inflammatory response to radiation-induced tissue damage. The increased expression of specific chemoattractant chemokines leads to increased recruitment of neutrophils into the irradiated skin, where they release cytotoxic granules that are responsible for the exacerbation of an inflammatory state. Moreover, the importance of IL-17-expressing γδ-T cells to the radiation-induced hyperproliferation of keratinocytes was demonstrated, leading to reactive hyperplasia of the epidermis. Radiation-induced, reactive hyperproliferation of the keratinocytes disturbs the fine-tuned keratinization and cornification processes, leading to structural dysfunction of the epidermal barrier. In summary, in response to ionizing radiation, epidermal keratinocytes have important structural and immunoregulatory barrier functions in the skin, coordinating interacting immune responses to eliminate radiation-induced damage and to initiate the healing process.

TRPM2-dependent autophagy inhibition exacerbates oxidative stress-induced CXCL16 secretion by keratinocytes in vitiligo.

Vitiligo is a depigmented skin disease due to the destruction of melanocytes. Under oxidative stress, keratinocyte-derived chemokine C-X-C motif ligand 16 (CXCL16) plays a critical role in recruiting CD8+ T cells, which kill melanocytes. Autophagy serves as a protective cell survival mechanism and impairment of autophagy has been linked to increased secretion of the proinflammatory cytokines. However, the role of autophagy in the secretion of CXCL16 under oxidative stress has not been investigated. Herein, we initially found that autophagy was suppressed in both keratinocytes of vitiligo lesions and keratinocytes exposed to oxidative stress in vitro. Autophagy inhibition also promoted CXCL16 secretion. Furthermore, upregulated transient receptor potential cation channel subfamily M member 2 (TRPM2) functioned as an upstream oxidative stress sensor to inhibit autophagy. Moreover, TRPM2-mediated Ca2+ influx activated calpain to shear autophagy related 5 (Atg5) and Atg12-Atg5 conjugate formation was blocked to inhibit autophagy under oxidative stress. More importantly, Atg5 downregulation enhanced the binding of interferon regulatory factor 3 (IRF3) to the CXCL16 promoter region by activating Tank-binding kinase 1 (TBK1), thus promoting CXCL16 secretion. These findings suggested that TRPM2-restrained autophagy promotes CXCL16 secretion via the Atg5-TBK1-IRF3 signaling pathway under oxidative stress. Inhibition of TRPM2 may serve as a potential target for the treatment of vitiligo. © 2024 The Pathological Society of Great Britain and Ireland.

NLRP3 regulates CIITA/MHC II axis and interferon-γ-inducible chemokines in Malassezia globosa-infected keratinocytes.

CIITA, a member of NOD-like receptor (NLR) family, is the major MHC II trans-activator and mediator of Th1 immunity, but its function and interaction with NLRP3 have been little studied. We found activation of NLRP3 inflammasome, increased expression of CIITA, CBP, pSTAT1, STAT1, MHC II, IFN-γ and IFN-γ-inducible chemokines (CCL1 and CXCL8), and colocalisation of NLRP3 with CIITA in Malassezia folliculitis lesions, Malassezia globosa-infected HaCaT cells and mouse skin. CoIP with anti-CIITA or anti-NLRP3 antibody pulled down NLRP3 or both CIITA and ASC. NLRP3 silencing or knockout caused CIITA downexpression and their colocalisation disappearance in HaCaT cells and mouse skin of Nlrp3-/- mice, while CIITA knockdown had no effect on NLRP3, ASC, IL-1β and IL-18 expression. NLRP3 inflammasome inhibitors and knockdown significantly suppressed IFN-γ, CCL1, CXCL8 and CXCL10 levels in M. globosa-infected HaCaT cells. CCL1 and CXCL8 expression was elevated in Malassezia folliculitis lesions and reduced in Nlrp3-/- mice. These results demonstrate that M. globosa can activate NLRP3 inflammasome, CIITA/MHC II signalling and IFN-γ-inducible chemokines in human keratinocytes and mouse skin. NLRP3 may regulate CIITA by their binding and trigger Th1 immunity by secreting CCL1 and CXCL8/IL-8, contributing to the pathogenesis of Malassezia-associated skin diseases.

A Nanoinhibitor Targeting cGAS‐STING Pathway to Reverse the Homeostatic Imbalance of Inflammation in Psoriasis

AbstractPsoriasis is a chronic skin inflammation characterized by dysregulated crosstalk between immune cells and keratinocytes. Here we show that the cyclic GMP‐AMP synthase (cGAS)‐stimulator of interferon genes (STING) pathway is a key regulator of psoriatic inflammation in a mouse model. Platinum‐doped positively charged carbon dots (Pt‐CDs) were designed to inhibit the cGAS‐STING pathway. By inhibiting the cGAS‐STING pathway with Pt‐CDs, the secretion of proinflammatory cytokines in macrophages was reduced, and the proinflammatory cytokines‐induced breakdown of immunological tolerance and overexpression of chemokines in keratinocytes was restored, which reversed the homeostatic imbalance through breaking these cytokines‐mediated intercellular positive feedback loop. Topical Pt‐CDs treatment exhibited therapeutic effects in imiquimod‐induced psoriasis mice without noticeable toxicity. The reversal of elevated expression of STING, phosphorylated STING, and downstream genes within psoriatic lesions indicates that Pt‐CDs effectively inhibit the cGAS‐STING pathway. This work suggests a promising strategy for psoriasis treatment by targeting the cGAS‐STING pathway with Pt‐CDs nanoinhibitor to restore skin homeostatic balance.

A Nanoinhibitor Targeting cGAS-STING Pathway to Reverse the Homeostatic Imbalance of Inflammation in Psoriasis.

Psoriasis is a chronic skin inflammation characterized by dysregulated crosstalk between immune cells and keratinocytes. Here we show that the cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) pathway is a key regulator of psoriatic inflammation in a mouse model. Platinum-doped positively charged carbon dots (Pt-CDs) were designed to inhibit the cGAS-STING pathway. By inhibiting the cGAS-STING pathway with Pt-CDs, the secretion of proinflammatory cytokines in macrophages was reduced, and the proinflammatory cytokines-induced breakdown of immunological tolerance and overexpression of chemokines in keratinocytes was restored, which reversed the homeostatic imbalance through breaking these cytokines-mediated intercellular positive feedback loop. Topical Pt-CDs treatment exhibited therapeutic effects in imiquimod-induced psoriasis mice without noticeable toxicity. The reversal of elevated expression of STING, phosphorylated STING, and downstream genes within psoriatic lesions indicates that Pt-CDs effectively inhibit the cGAS-STING pathway. This work suggests a promising strategy for psoriasis treatment by targeting the cGAS-STING pathway with Pt-CDs nanoinhibitor to restore skin homeostatic balance.

Ethanol extract of Herpetospermum caudigerum Wall ameliorates psoriasis-like skin inflammation and promotes degradation of keratinocyte-derived ICAM-1 and CXCL9

ObjectiveTo explore whether the ethanol extract of Herpetospermum caudigerum Wall (EHC), a Xizang medicinal plant traditionally used for treating liver diseases, can improve imiquimod-induced psoriasis-like skin inflammation. MethodsImmunohistochemistry and immunofluorescence staining were used to determine the effects of topical EHC use in vivo on the skin pathology of imiquimod-induced psoriasis in mice. The protein levels of interferon-γ (IFN-γ), tumor necrosis factor-α (TNF-α), and interleukin-17A (IL-17A) in mouse skin samples were examined using immunohistochemical staining. In vitro, IFN-γ-induced HaCaT cells with or without EHC treatment were used to evaluate the expression of keratinocyte-derived intercellular cell adhesion molecule-1 (ICAM-1) and chemokine CXC ligand 9 (CXCL9) using Western blotting and reverse transcription-quantitative polymerase chain reaction. The protein synthesis inhibitor cycloheximide and proteasome inhibitor MG132 were utilized to validate the EHC-mediated mechanism underlying degradation of ICAM-1 and CXCL9. ResultsEHC improved inflammation in the imiquimod-induced psoriasis mouse model and reduced the levels of IFN-γ, TNF-α, and IL-17A in psoriatic lesions. Treatment with EHC also suppressed ICAM-1 and CXCL9 in epidermal keratinocytes. Further mechanistic studies revealed that EHC suppressed keratinocyte-derived ICAM-1 and CXCL9 by promoting ubiquitin–proteasome-mediated protein degradation rather than transcriptional repression. Seven primary compounds including ehletianol C, dehydrodiconiferyl alcohol, herpetrione, herpetin, herpetotriol, herpetetrone and herpetetrol were identified from the EHC using ultra-performance liquid chromatography-quadrupole-time of flight-mass spectrometry. ConclusionTopical application of EHC ameliorates psoriasis-like skin symptoms and improves the inflammation at the lesion sites.Please cite this article as: Zhong Y, Zhang BW, Li JT, Zeng X, Pei JX, Zhang YM, Yang YX, Li FL, Deng Y, Zhao Q. Ethanol extract of Herpetospermum caudigerum Wall ameliorates psoriasis-like skin inflammation and promotes degradation of keratinocyte-derived ICAM-1 and CXCL9. J Integr Med. 2023; Epub ahead of print.

IL-8 Triggers Neutrophil Extracellular Trap Formation Through an Nicotinamide Adenine Dinucleotide Phosphate Oxidase- and Mitogen-Activated Protein Kinase Pathway-Dependent Mechanism in Uveitis.

To explore the mechanism underlying IL-8-induced neutrophil extracellular trap (NET) formation in patients with ocular-active Behçet's disease (BD) and the effect of inhibiting NET formation on the severity of inflammation in experimental autoimmune uveitis (EAU) mice. The serum extracellular DNA and neutrophil elastase (NE) and IL-8 levels in patients with ocular-active BD, the expression of myeloperoxidase, NE, and histone H3Cit in IL-8-induced neutrophils isolated from healthy controls, and the effects of NETs on HMC3 cells were detected. Female C57BL/6J mice were immunized with IRBP651-670 to induce EAU and EAU mice received intravitreal injection of the CXCR2 (IL-8 receptor) antagonist SB225002 or PBS. The serum levels of extracellular DNA, NE, and keratinocyte-derived chemokine (the mouse ortholog of human IL-8) and expression of myeloperoxidase, NE, and histone H3Cit in mouse retinas were detected. Disease severity was evaluated by clinical and histopathological scores. Serum keratinocyte-derived chemokine expression levels in EAU mice and IL-8 expression levels in patients with ocular-active BD increased. IL-8 notably increased NET formation in a dose-dependent manner through an nicotinamide adenine dinucleotide phosphate oxidase and mitogen-activated protein kinase pathway dependent mechanism. IL-8-induced NET formation damaged HMC3 cells in vitro. Pretreatment with SB225002 notably ameliorated the production of NETs in EAU mice. Our data confirm that NET formation is induced by IL-8. IL-8-induced NET formation was found to be related to mitogen-activated protein kinase and nicotinamide adenine dinucleotide phosphate pathways. Pretreatment with the CXCR2 antagonist SB225002 alleviated neutrophil infiltration and suppressed NET formation in EAU mice.

Development of Procathepsin L (pCTS-L)-Inhibiting Lanosterol-Carrying Liposome Nanoparticles to Treat Lethal Sepsis.

The pathogenesis of microbial infections and sepsis is partly attributable to dysregulated innate immune responses propagated by late-acting proinflammatory mediators such as procathepsin L (pCTS-L). It was previously not known whether any natural product could inhibit pCTS-L-mediated inflammation or could be strategically developed into a potential sepsis therapy. Here, we report that systemic screening of a NatProduct Collection of 800 natural products led to the identification of a lipophilic sterol, lanosterol (LAN), as a selective inhibitor of pCTS-L-induced production of cytokines [e.g., Tumor Necrosis Factor (TNF) and Interleukin-6 (IL-6)] and chemokines [e.g., Monocyte Chemoattractant Protein-1 (MCP-1) and Epithelial Neutrophil-Activating Peptide (ENA-78)] in innate immune cells. To improve its bioavailability, we generated LAN-carrying liposome nanoparticles and found that these LAN-containing liposomes (LAN-L) similarly inhibited pCTS-L-induced production of several chemokines [e.g., MCP-1, Regulated upon Activation, Normal T Cell Expressed and Presumably Secreted (RANTES) and Macrophage Inflammatory Protein-2 (MIP-2)] in human blood mononuclear cells (PBMCs). In vivo, these LAN-carrying liposomes effectively rescued mice from lethal sepsis even when the first dose was given at 24 h post the onset of this disease. This protection was associated with a significant attenuation of sepsis-induced tissue injury and systemic accumulation of serval surrogate biomarkers [e.g., IL-6, Keratinocyte-derived Chemokine (KC), and Soluble Tumor Necrosis Factor Receptor I (sTNFRI)]. These findings support an exciting possibility to develop liposome nanoparticles carrying anti-inflammatory sterols as potential therapies for human sepsis and other inflammatory diseases.

OVERLOAD-INDUCED EXTRACELLULAR MITOCHONDRIA RELEASING FROM TENDON ORGANOID LEADS TO INFLAMMATION

Tendinopathy is the most frequent musculoskeletal disease that requires medical attention. Mechanical overload has been considered as a key driver of its pathology. However, the underline mechanism on how overload induces tendinopathy and inflammation is unclear. Extracellular mitochondria (EM) are newly identified as cell-to-cell communicators. The aim of this study is to elucidate the role of mitochondria in overload-induced inflammation.We performed three-dimensional uniaxial stretching to mouse tendon organoid in bioreactors. Cyclic strain of uniaxial loadings included underload, normal load, and overload, according to previous work. We then harvested microvesicles including EM, from the bioreactor by differential centrifugation and evaluated their characteristics by flow cytometry and super-resolution confocal microscopy. Raw 264.7 mouse macrophage cell line was used for chemotaxis assay in a Boyden Chamber System with Magnetic-Activated Cell Sorting Technology. EM induced cytokines secretion by macrophages was analyzed by a bead-based multiplex assay panel. N-Acetyl-L-cysteine (NAC) was used as the antioxidant to tendon organoid to regulate mitochondrial fitness.We showed mechanical load induced tendon organoid to release microvesicles including mitochondria. The size of microvesicles is mainly in the range from 220nm to 880nm. More than 75% of microvesicles could be stained by PKH26, confirming they were with lipophilic membrane. Super-resolution confocal microscopy identified two forms of mitochondria, including mitochondria encapsulated in vesicles and free mitochondria. Overload led to the degeneration of the organoid and induced microvesicles release containing most EM. Chemotaxis assay showed that EM from overloaded tendon organoid induced macrophages chemotaxis. In addition, microvesicles extracted from overloaded tendon organoid induced the production of proinflammatory cytokines including IL-6, KC (Keratinocyte-Derived Chemokine) and IL-18. NAC treatment to tendon cells could attenuate overload-induced macrophage chemotaxis.Overload induces EM releasing from tendon cells, which leads to chemotaxis of macrophages toward tendon, resulting in induction of inflammation.

CXCR2 Antagonist RIST4721 Acts as a Potent Chemotaxis Inhibitor of Mature Neutrophils Derived from Ex Vivo-Cultured Mouse Bone Marrow

Neutrophils act as critical mediators of innate immunity, which depends on their rapid responses to chemokines followed by their migration towards sites of infection during chemotaxis. Chemokine receptors expressed on the surface of neutrophils mediate chemotaxis by activating contractile machinery as the cells escape from capillary beds and then attack pathogens. Neutrophils also contribute to inflammatory responses, which support pathogen destruction but can lead to acute and chronic inflammatory disorders. CXCR2, a G-protein-coupled chemokine receptor expressed on both myeloid and epithelial cells, is well-characterized for its capacities to bind multiple chemokines, including interleukin-8 and growth-related oncogene alpha in humans or keratinocyte chemokine (KC) in mice. Here we show that a small molecule CXCR2 antagonist termed RIST4721 can effectively inhibit KC-stimulated chemotaxis by neutrophils derived from ex vivo-cultured mouse bone marrow in a potent and dose-dependent manner. Antagonistic properties of RIST4721 are thoroughly characterized, including the maximal, half-maximal and minimum concentrations required to inhibit chemotaxis. Importantly, RIST4721-treated neutrophils exhibit robust phagocytosis and reactive oxygen species production, confirming drug specificity to chemotaxis inhibition. Together our data indicate that RIST4721 acts to inhibit inflammation mediated and potentiated by neutrophils and therefore promises to facilitate treatment of a host of inflammatory conditions.