Japanese Plum Research Articles

Caracterização anatômico-fisiológica da compatibilidade reprodutiva de ameixeira-japonesa

O objetivo do trabalho foi caracterizar fisiologicamente a compatibilidade reprodutiva de sete cultivares de ameixeira-japonesa (Prunus salicina Lindl) por meio de hibridações, análise de frutificação efetiva e do crescimento de tubos polínicos (CTP). O frui set foi determinado 40 dias após as hibridações controladas, realizadas a campo. O grau de compatibilidade foi avaliado invivo, para determinar o CTP. A cv. América apresentou bom fruit set quando polinizada com as cvs. Rosa Mineira (26,7%), Amarelinha (8,7%) e Reubennel (12,7%). Os cruzamentos 'Gulf Blaze' x 'Gulf Rubi', 'Gulf Rubi' x 'Gulf Rubi' e 'Gulf Rubi' x 'Gulf Blaze' obtiveram um fruit set de 11,36%, 3,84% e 9,94%, respectivamente. Na polinização em laboratório, os tubos polínicos atingiram o óvulo ou ovário nesses cruzamentos, com exceção da autopolinização da 'Gulf Rubi'. No campo, não houve frutificação efetiva na autopolinização da 'América' e 'Gulf Blaze' e no cruzamento da 'América' x 'Pluma 7'. Os tubos polínicos nesses cruzamentos não chegaram a atingir o óvulo, com exceção da autopolinização da 'Gulf Blaze'. Concluiu-se que apenas os cruzamentos entre 'América' x 'Pluma 7' são incompatíveis, e a cultivar América é autoincompatível.

A Novel Set of EST-Derived SSR Markers for Pear and Cross-Species Transferability in Rosaceae

Pear is a fruit species with worldwide distribution belonging to the Rosaceae family. In this study, transcriptomes of 12 different tissues of pear were newly assembled, with a total of 17,353 SSR loci identified. Within these, repetitive sequences with dinucleotide and trinucleotide motifs were more abundant than other types. We developed 194 EST-SSR makers from the assembled sequences to test on seven pear varieties from different genetic backgrounds, on which 132 EST-SSR primers had amplicons. There were 108 primers with dinucleotide and trinucleotide motifs detecting a total of 311 alleles, with an average per primer of 2.88 and 2.86, respectively. These had better quality than primers with tetranucleotides, pentanucleotides, and hexanucleotides. Fifty polymorphic markers divided 36 pear genotypes into two groups with a similarity coefficient of 0.62. Results showed that Japanese pears had a comparatively close relationship with Chinese pears, indicating the great potential of the novel EST-SSR makers in future evaluations of pear germplasm. Furthermore, 54 EST-SSR markers were selected to test transferability to 96 other Rosaceae cultivars from eight species, including Japanese apricot, plum, apricot, peach, cherry, apple, strawberry, and loquat. Seventeen EST-SSR primers had PCR amplification products in at least one of the 96 accessions, with the highest transferability was from pear to apple at 29.63 %. Transferability from pear to Japanese apricot, plum, apricot, peach, cherry, strawberry, and loquat was 9.26, 14.81, 11.11, 12.96, 5.56, 3.7, and 12.96 %, respectively. Therefore, the newly developed EST-SSR markers can contribute to exploring the genetic relationship, evolution and comparative genomics, and gene introgressions in the Rosaceae family.

Plum Pox Virus in Japanese Plum from Argentina: Serological Detection and Molecular Characterization of an Isolate from cv. Red Beauty

A Plum pox virus (PPV) isolate detected in a Japanese plum orchard in Pocito (San Juan, Argentina) was transmitted mechanically to Prunus tomentosa and Nicotiana benthamiana. DAS-ELISA and DASI-ELISA indicated the virus presence and serological relationship with D-strain isolates; IC-RT-PCR amplified a 1.2-kb fragment of the virus genome encoding the CP-3′ nc region. The analysis of the sequence showed the presence of the DAG motif at the 5′ end of the capsid protein and the Rsa I and Alu I sites at the 3′ end. The phylogenetic relationships and multiple alignment with PPV isolates from NCBI database indicated greatest (+98%) homology with the D strain and close identity with MNAT1 (AF360579) USA peach isolate. The sequence analysed showed two amino acid mutations towards the 5′ N-terminus of CP (the most variable region) with respect to a consensus of PPV D-strain isolates. This is the first molecular characterization of 3′terminal genome region of PPV isolate to confirm D strain in a Japanese plum from Argentina.

Carry-over effects of deficit irrigation applied over seven seasons in a developing Japanese plum orchard

Deficit irrigation is a strategy that in the short term often allows increasing water use efficiency with minimal impacts on tree performance. However, the long-term and carry-over effects of this practice have not been sufficiently investigated. Here, we report a research that was conducted over eight years in a young Japanese plum orchard planted with cv. Black-Gold in Valencia, Spain. Different deficit irrigation and crop load regimes were applied in the first seven seasons. In the last experimental season, however, all trees were well irrigated in order to explore the possible carry-over effects of the water restrictions applied previously. The results obtained indicate that under the experimental conditions of the current research (low irrigation water salinity, and Mediterranean climate with some intense rainfall events during fall and spring), deficit irrigation applied for seven consecutive seasons did not lead to accumulation of salts in the soil, a concern when deficit irrigation is applied in the long-term. Nonetheless, water restrictions impaired the fruit bearing capacity quantified as the number of fruit per unit branch length before thinning application. This effect was partly explained by a decrease in the concentration of starch reserves in the root system in one of the deficit irrigated treatments. A decrease in the fruit bearing capacity itself did not impair yield as the cultivar employed in this study required intense thinning that offset the initial differences in the number of fruit per branch length. However, deficit irrigation led to smaller trees (31% in tree shaded area in the most stressed treatment against 47% in control trees). This effect was the ultimate cause of the 29% yield reduction observed in the eighth season, when the previous deficit irrigated trees were fully watered. It is then concluded that deficit irrigation strategies in developing orchards should be used with caution. Only slight restrictions can be imposed in order to avoid the long-term carry-over effects of deficit irrigation on tree performance.

First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan.

NEW ROOTSTOCKS WITH RESISTANCE TO PLUM POX VIRUS FOR PRUNUS DOMESTICA AND OTHER STONE FRUIT SPECIES: THE 'DOCERA' AND 'DOSPINA' ROOTSTOCK SERIES

ISHS X International Symposium on Plum and Prune Genetics, Breeding and Pomology NEW ROOTSTOCKS WITH RESISTANCE TO PLUM POX VIRUS FOR PRUNUS DOMESTICA AND OTHER STONE FRUIT SPECIES: THE 'DOCERA' AND 'DOSPINA' ROOTSTOCK SERIES

FORCED-AIR COOLING REDUCES 1-MCP APPLICATION DURATION ON PLUMS (PRUNUS SALICINA LINDL.) WITHOUT REDUCING EFFECTIVENESS

FORCED-AIR COOLING REDUCES 1-MCP APPLICATION DURATION ON PLUMS (PRUNUS SALICINA LINDL.) WITHOUT REDUCING EFFECTIVENESS

INCREASING ANTHOCYANIN CONTENT IN QUEEN GARNET PLUM AND CORRELATIONS WITH IN-FIELD MEASURES

While plums are traditionally bred for fresh fruit traits such as size, sweetness, yield and disease resistance the Queensland Government breeding program for Japanese plum ( Prunus salicina Lindl.) also selected for anthocyanin content to develop a new plum selection named 'Queen Garnet'. When ripe or overripe, it has a near black skin and deep red flesh colour, which when combined, result in exceptionally high anthocyanin content, reaching up to 277 mg/100 g fruit. The skin fraction contributes 36-66% of the total anthocyanin content of fruit. The plum is now being commercially grown to be processed into a range of functional products from food colourants to premium health products. These are sold on the basis of anthocyanin and antioxidant content. Protocols for increasing anthocyanin content have therefore been researched to maximise the total anthocyanin yield rather than fresh fruit weight and taste. The principal approach is through selective harvest of overripe plums high in colour, although post-harvest storage at 21°C results in further anthocyanin synthesis. Modified processing is also required to ensure recovery of anthocyanins from the skin fraction. The plum products have entered testing for assessing health properties beginning with an initial proof of in vivo bioavailability of the anthocyanins.

EFFECT OF SHIFRING TO DRIP IRRIGATION ON SOME PLUM CULTIVARS GROWN IN CLAY LOAMY SOIL

This study was conducted on 23-years old plum trees (Golden Japanese, Dorado and Santa Rosa cultivars) budded on Mariana rootstock and planted at 5  5 m apart on clay loamy soil under flood irrigation system (5180 and 5124 m3/feddan/season) or drip irrigation system (2607.4 and 2553.6 m3/fed./season) during 2010 and 2011 seasons, respectively. Drip irrigation system supported an increase of vegetative growth parameters (shoot length, leaf area, leaf dry weight %, number of leaves/shoot and foliation %), fruit attributes (flowering %, fruit set, number of fruits/tree and yield), fruit quality (weight, size, firmness, TSS and acidity), root length, root dry weight (roots 6 mm), as well as narrow and broad-leaf weeds spread. However some of these differences were not significant. Golden Japanese plum cv. produced higher fruit set, yield, number of fruits/tree, as well as water use efficiency and less fruit juice acidity. While Santa Rose cv. resulted better foliation, fruit weight and size, as well as juice TSS and more suitable fruit firmness. Meanwhile larger leaves with much dry weight % and less fruit drop were proceeded from Dorado plum cv. So we can recommend plum growers on clay loamy soil to converse flood irrigation system to drip system to save 50.1 % of irrigation water with better growth, fruit yield, fruit quality, much water use efficiency and to reduce weed spreation.

Comparative tree growth, phenology and fruit yield of several Japanese plum cultivars in two newly established orchards, organic and conventionally managed

The growth, phenology and fruit yield of 14 Japanese plum cultivars (Prunus salicina Lindl) were studied in two newly established experimental orchards under organic and conventional management. The experiment was conducted during 2005-2011 in the province of Seville (SW Spain), an important region of Japanese plum culture. Trunk cross-section areas (TCSA), flowering, yield and tree defoliation before winter dormancy were analysed over several years. After one year, TCSA were larger in the organically managed orchard (OMO) for most of the cultivars, in the next two years they were equal, and from the fourth year, several cultivars showed significantly larger TCSA in the conventionally managed orchard (CMO). Flowering in the conventional orchard started from 2 to 6 days before and lasted for 3 to 5 days more than in the OMO. Several cultivars produced significantly more fruit in the CMO, being the average fruit yield in the organic orchard about 72% of the conventionally managed orchard. Autumn defoliation was significantly advanced in the organic orchard, especially in cultivars highly susceptible to rust (Tranzschelia pruni spinosae), a disease not adequately controlled in the organic orchard.

S genotyping in Japanese plum and sweet cherry by allele-specific hybridization using streptavidin-coated magnetic beads

We report a rapid and reliable method for S genotyping of Rosaceae fruit trees, which would to be useful for successful planting of cross-compatible cultivars in orchards. Japanese plum (Prunus salicina) and sweet cherry (Prunus avium), belonging to the family Rosaceae, possess gametophytic self-incompatibility controlled by a single polymorphic locus containing at least two linked genes, S-RNase and SFB (S-haplotype-specific F-box gene). For successful planting of cross-compatible cultivars of Rosaceae fruit trees in commercial orchards, it is necessary to obtain information on S genotypes of cultivars. Recently, a method of dot-blot analysis utilizing allele-specific oligonucleotides having sequences of SFB-HVa region has been developed for identification of S haplotypes in Japanese plum and sweet cherry. However, dot-blot hybridization requires considerable time and skill for analysis even of a small number of plant samples. Thus, a quick and efficient method for S genotyping was developed in this study. In this method, instead of a nylon membrane used for dot-blot hybridization, streptavidin-coated magnetic beads are used to immobilize PCR products, which are hybridized with allele-specific oligonucleotide probes. Our improved method allowed us to identify 10 S haplotypes (S-a, S-b, S-c, S-d, S-e, S-f, S-h, S-k, S-7 and S-10) of 13 Japanese plum cultivars and 10 S haplotypes (S-1, S-2, S-3, S-4, S-4', S-5, S-6, S-7, S-9 and S-16) of 13 sweet cherry cultivars utilizing SFB or S-RNase gene polymorphism. This method would be suitable for identification of S genotypes of a small number of plant samples.

Breeding in peach, cherry and plum: from a tissue culture, genetic, transcriptomic and genomic perspective

This review is an overview of traditional and modern breeding methodologies being used to develop new Prunus cultivars (stone fruits) with major emphasis on peach, sweet cherry and Japanese plum. To this end, common breeding tools used to produce seedlings, including in vitro culture tools, are discussed. Additionally, the mechanisms of inheritance of many important agronomical traits are described. Recent advances in stone fruit transcriptomics and genomic resources are providing an understanding of the molecular basis of phenotypic variability as well as the identification of allelic variants and molecular markers. These have potential applications for understanding the genetic diversity of the Prunus species, molecular marker-assisted selection and transgenesis. Simple Sequence Repeat (SSR) and Single Nucleotide Polymorphism (SNPs) molecular markers are described as useful tools to describe genetic diversity in peach, sweet cherry and Japanese plum. Additionally, the recently sequenced peach genome and the public release of the sweet cherry genome are discussed in terms of their applicability to breeding programs.

Are <i>Umezu</i> polyphenols in the Japanese plum (<i>Prunus mume</i>) protective against mild hypertension and oxidation? Evidence from a double-blind randomized placebo-controlled trial

Medications or lifestyle changes to prevent or improve hypertension often press considerable efforts on patients suffering from mild hypertension. Beverages including Umezu polyphenols (UP), polyphenols in Japanese plums, may help them to control their blood pressure. Healthy medical students, workers, and community dwellers who had some concerns about their blood pressure were randomized in a doubleblind manner into UP ingesting and placebo groups. The first two samples (medical students and workers) were placed in a preliminary study, and based on the results from that study, and the dose of UP for the community dwellers was determined. All three groups were followed for 5 weeks, and blood pressure, as well as biochemical markers related to hypertension and atherosclerosis and self-perceived quality-of-life outcomes, was monitored during that period. Group × time interactions on blood pressure changes were examined. For the community dwellers, blood pressure changes did not significantly differ between the UP ingesting and placebo groups. And although studies of students and workers showed subtle differences in blood pressure among the UP and placebo groups, a dose-dependent effect of UP on decreasing blood pressure could not be confirmed. On the other hand, anti-oxidative effects of UP were confirmed especially among male drinkers who were community dwellers. For the community dwellers, self-perceived physical health significantly improved in those who ingested UP. In conclusion, UP might prevent oxidation. A longer monitoring period as well as a higher dose of UP might enable us to confirm effects of UP against hypertension.

Identification of Species of Fruit-Boring Lepidopteran Pests Observed in Peachs and Japanese Plums in Mixed-Cropping Orchards

Identification of Species of Fruit-Boring Lepidopteran Pests Observed in Peachs and Japanese Plums in Mixed-Cropping Orchards

Physiological and Psychological Response to Floral Scent

To better understand how fragrance may enhance human health, this study examined psychophysiological responses to Japanese plum blossom fragrance. Although previous studies used essential oils or fragrance components, the present study measured the effects of floral scent naturally diffused by the plant itself to simulate the way we generally experience natural scent in everyday life. Subjects were Japanese males (n = 26), and the data collected included cerebral and autonomic nervous system activities, semantic differential (SD) scale, and profile of mood states (POMS). Exposure to the fragrance significantly activated the sympathetic nervous system and the cerebral areas related to movement, speech, and memory. SD scale and POMS results showed the fragrance evoked cheerful, exciting, and active images and changed mood states by enhancing vigor while suppressing feelings of depression. These findings indicate that contact with a floral scent such as plum blossom fragrance can improve mood states and may foster the brain functions of memory, speech, and movement, potentially leading to improvements in emotional health, depression, and memory disorders.

In vitro shoot-tip grafting for safe Prunus budwood exchange

The exchange of fruit tree propagation material to different growing regions and countries is a primary source of new pests and pathogens, particularly graft-transmissible viruses and viroids affecting Prunus species worldwide. Traditional procedures often cannot effectively quarantine pathogens and pests with unknown etiology, prompting the study of alternative procedures including those based on tissue culture techniques. In vitro shoot-tip grafting (STG), also called micrografting, consists of aseptically grafting a small shoot-tip onto an in vitro rootstock seedling and is often used to produce virus-free plants. In this study, an improved STG procedure for obtaining and introducing virus-free peach and Japanese plum plants is presented as an alternative to standard quarantine methods. The shoot-tip source is critical for STG success. Two viruses (Apple chlorotic leaf spot virus, Prunus necrotic ringspot virus) and a viroid (Peach latent mosaic viroid) were successfully eliminated in nearly 100% of the micrografted plants using buds from contaminated plants, grafted onto rootstocks forced in vivo at 35°C, as shoot-tip source. The subsequent development of healthy plants for tested peach and Japanese plum cultivars demonstrates the suitability of this method for safe transport of plant material.

Genetic characterization of Japanese plum cultivars (Prunus salicina) using SSR and ISSR molecular markers

B. Carrasco, C. Diaz, M. Moya, M. Gebauer and R. Garcia-Gonzalez. 2012. Genetic characterization of Japanese plum cultivars (Prunus salicina) using SSR and ISSR molecular markers. Cien. Inv. Agr. 39(3): 533-543. The genetic characterization of 29 elite Japanese plum cultivars (Prunus salicina) and 4 Prunus cultivars was carried out by analyzing 97 Simple Sequence Repeat (SSR) alleles and 232 binary Inter Simple Sequence Repeat (ISSR) loci. A high level of genetic variability was found for these two molecular markers among the Japanese plum cultivars compared to other Prunus species. On average, the variability found by analyzing the SSR alleles were Na = 12.1, Ne = 5.2, Ho = 0.9, He = 0.8 and F= -0.127, whereas ISSR yielded values of h = 0.15 and I = 0.27. The genetic relationship among cultivars was estimated with Principal Coordinate Analysis (PCA) and a Bayesian clustering approach using the software program Structure. This program identified two subgroups (k=2). The first group included cultivars of four Prunus species: P. salicina, P. armeniaca, P. domestica and P. ceracifera, whose memberships ranged between 0.74 and 1.0. The second group included 19 Japanese plum cultivars and one plumcot cultivar, with memberships between 0.57 and 0.99. With some exceptions, similar relationships among cultivars were foundPCA. The level of genetic differentiation between two groups was low (G st =0.055 and  ST =0.04), and a low level of linkage disequilibrium (LD) was observed for all allele combinations. These results suggest that the high level of genetic variability, the low level of LD and the scarce degree of differentiation detected by Structure between the two genetic groups can be explained by the self-incompatibility mechanism that favors the exchange between genetically distant Prunus cultivars and by the intra- and interspecific hybridization strategies frequently used in plum breeding programs.

Atividade fotossintética em plantas de ameixeira submetidas ao déficit hídrico e ao alagamento

O objetivo no presente trabalho foi avaliar o impacto do déficit hídrico e do alagamento na atividade fotossintética de ameixeiras cultivar 'América'. Foram analisadas a fluorescência da clorofila a e as trocas gasosas em plantas de aproximadamente 12 meses, cultivadas em casa de vegetação. As análises foram iniciadas dois dias após do início do déficit hídrico e um dia após o início do alagamento, totalizando quatro avaliações durante a manutenção dos estresses. A fotossíntese líquida foi reduzida pela limitação estomática em ambos os estresses. A condição de restrição hídrica não alterou o rendimento quântico máximo fotoquímico. Os índices de performance fotossintético revelaram diferenças entre os estresses, caracterizando as plantas de ameixeira, cv. 'América', como mais suscetíveis ao déficit hídrico do que ao alagamento.

EVOLUTION OF PLUM CULTURE; CONSTRAINS AND PERSPECTIVES

European plum (Prunus domestica) and Japanese plum (Prunus salicina and hybrids) culture are facing a relative critical period world wide. In the last two decades the annual world plum production went up to more then 7 million tones, which has 2 to 5% increase over the 1970-1990 period, although large variation from one year to another were recorded. The European plum type production is 5.5 to 5.6 million tons per year and the Japanese type plums represent 1.5 to 1.6 million tons (21 to 23% of the total plum production). The plum culture situation is dependent on the human society demands either for fresh consumption plums or processed plums. Decrease of demands for plums are due to the competitively with other fruits (apples, peaches, oranges, bananas, etc.) and availability of those all year long as result of trade globalization. The morphological characteristics of plum fruits (size, shape, and color), taste, storage ability, etc., are only several elements that contribute to decrease of demand. Advertising and information on plum consumption benefits for healthy and balanced diet are less and less present. Investments in new plum orchards in the traditional plum growing countries like Romania, Serbia, Bulgaria, Hungary and Moldova or in Greece are very low; this can be explained by the last period economical situation of these countries which is continuing due to the financial crisis. In order to have perspectives in favor of plum culture improvements have to be done regarding cultivar assortment and behavior to virus diseases, rootstocks and orchard management. The cultivar assortment needs commercial valuable and productive genotypes, which produce large and tasty fruits that can be stored and shipped extensively. Plum rootstocks are necessary to be more available, especially those of low vigor and having good compatibility with many cultivars. Issues regarding virus infection and their reaction on plums have to be solved as soon as possible. Plum orchard management requires modernizing from all points of vue especially for the super-intensive culture.

Role of Membrane Lipid Peroxidation, Enzymatic and Non-enzymatic Antioxidative Systems in the Development of Chilling Injury in Japanese Plums

Chilling injury (CI) is a major postharvest constraint in the long-term cold storage, transportation, and distribution of japanese plums (Prunus salicina). The aim of the work was to explain the development and severity of CI in japanese plums based on the oxidative stress theory following time course analysis of enzymatic and non-enzymatic antioxidants. Changes in membrane lipid peroxidation and enzymatic and non-enzymatic antioxidative systems in japanese plum cultivar Blackamber were determined at weekly intervals during 5 weeks of cold storage at 0 °C and at 2-day intervals during poststorage simulated shelf conditions (21 ± 1 °C) for 8 days after each week of cold storage. Fruit respiration and ethylene production rates showed typical climacteric patterns after removal from cold storage and these rates were relatively high after 4 and 5 weeks compared with 0 to 3 weeks of storage. The CI symptoms first appeared after 3 weeks of cold storage after fruit had been transferred to simulated shelf conditions. The incidence and severity of CI intensified with increasing storage duration. The extent of lipid peroxidation indicated by concentration of thiobarbituric acid-reactive substances and membrane damage manifested as electrolyte leakage increased with increasing duration of storage and subsequent simulated shelf conditions. Membrane lipid peroxidation exhibited positive correlation with the severity of CI. Activities of primary antioxidant enzymes and the enzymes involved in the ascorbate–glutathione cycle were determined to explain the levels of reduced and oxidized forms of cellular redox buffers, ascorbate and glutathione. In response to chilling stress, antioxidative protection systems operated efficiently during the first 3 weeks of cold storage, but extended storage resulted in loss of ability to ameliorate increasing levels of oxidative stress. In this study, the comprehensive analyses of various metabolites and antioxidative systems explain the series of events involved in development of CI in japanese plums in support of the oxidative stress theory.