Japanese Isolates Research Articles

Description of Millerago gen. nov. based on taxogenomic analysis, with two new species, Millerago phaffii f.a., sp. nov. and Millerago galiae f.a., sp. nov.

Four yeast isolates obtained from tree bark and fermenting sap of Quercus spp. and insects in Colombia and Japan were phylogenetically related to Candida galis based on analyses of the sequences of the internal transcribed spacer (ITS) region and the D1/D2 domains of the large subunit rRNA gene. The novel species differs from C. galis by 20 nt substitutions and 5 indels in the D1/D2 sequences. A phylogenomic analysis suggested that these species are related to Candida ficus, the genus Phaffomyces and a small clade containing Barnettozyma botsteinii, Barnettozyma siamensis and Candida montana. Our genomic analyses suggest that the novel species and C. galis should be separated in a novel yeast genus. We propose the genus Millerago gen. nov. to accommodate these species and the species Millerago phaffii f.a., sp. nov. (CBS 18021T; MycoBank MB856172) to accommodate the Colombian and Japanese isolates. The Colombian isolate of M. phaffii differs from the Japanese isolates by three nt substitutions and one indel and two substitutions and one indel in the ITS and D1/D2 sequences, respectively, showing that they were conspecific. We also propose the new species Millerago galiae sp. nov. to validate this species according to the rules of the International Code of Nomenclature for algae, fungi and plants.

A new subtype of serovar 6, K6b:O3, of Actinobacillus pleuropneumoniae based on genotypic analysis

We have analyzed the capsule (CPS) and the lipopolysaccharide O-Antigen (O-Ag) biosynthesis loci of fifteen field isolates of Actinobacillus pleuropneumoniae, including eleven North American and four Japanese ones, reactive to antisera against serovars 3, 6, 8 and/or 15. Ten North American isolates amplified a serovar 6-indicative fragment derived from the capsular loci, whereas one North American isolate and all four Japanese isolates amplified the serovar 6-indicative fragment as well as the serovar 3-indicative fragment. The five isolates producing a 3/6 banding pattern contain a type I CPS locus, named K6b, similar to serovar 6, but with differences in the cpxABCD and cpsABC gene sequences and the length of intergenic regions (modF-cpxA, and cpsC-cpsD). The main difference found between the K6 and K6b cps genes is a loss of function of a 113 AA UDP-glycosyltransferase found in type 6b due to the amino acid substitutions in the C-terminal domain of Cps6bA. Additionally, the isolates harbor a LPS O-Ag locus highly identical to those of field and reference strains of serovars 3, 8, 15, 17 and 19 but different from that of serovar 6. Taken together, our results indicate the existence of a subtype of A. pleuropneumoniae, serovar 6, that we called “K6b:O3′′, and we propose isolate EH1248 as the reference strain.

Polymorphic microsatellite markers for genetic analysis of Berkeleyomyces rouxiae, a causal agent of black root rot

AbstractBerkeleyomyces rouxiae, a soil-borne fungal pathogen, causes black root rot on various plant species including carrot, okra, tobacco, lettuce, and other important crops. Here we analyzed the entire genome sequence of a Japanese isolate of B. rouxiae and discovered 25 microsatellite sequences. These sequences were amplified from the genomic DNA of several Japanese isolates by PCR and sequenced, revealing that the microsatellite sequences were polymorphic among isolates. These markers are useful for phylogenetic analysis, epidemiological population analysis, identification of specific isolates, and other genetic investigation of B. rouxiae.

Molecular characterization and comparison of tomato zonate spot virus isolated in Japan and China.

The complete genome sequence of Orthotospovirus tomatozonae (tomato zonate spot virus, TZSV) isolated in Japan was determined and compared with that of Chinese isolates. The lengths of the S, M, and L segments of the RNA genomes of the Japanese isolate (TZSV-TZ1-3) were 3194, 4675, and 8916 nucleotides, respectively, which were similar to the Chinese isolates. Moreover, the eight motifs on the RNA-dependent RNA polymerase (RdRp) gene were conserved in both TZSV-TZ1-3 and Chinese TZSV isolates (TZSV-Bidens and TZSV-Tomato-YN). The nucleotide identity of the genes among the TZSV isolates was more than 94%, indicating low diversity among viruses. The phylogenetic analysis and the prediction of the cleavage sites in the glycoprotein showed that the TZSV-TZ1-3 isolate was closely related to TZSV-Tomato-YN isolated from China. However, there were unique frameshifts and deletions on the RdRp and glycoprotein genes of the TZSV-Tomato-YN isolate, suggesting that both isolates were genetically distinct. The findings of this study indicate that the TZSV-TZ1-3 isolate originated in China and show the sequence diversity among TZSV isolates.

Identification of Enterococcus spp. from food sources by matrix-assisted laser desorption ionization-time of flight mass spectrometry and characterization of virulence factors, antibiotic resistance, and biofilm formation

The continuous detection of multi-drug-resistant enterococci in food source environments has aroused widespread concern. In this study, 198 samples from chicken products, animal feces, raw milk, and vegetables were collected in Japan and Egypt to investigate the prevalence of enterococci and virulence characterization. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) was employed for species identification and taxonomic analysis of the isolates. The results showed that the rates of most virulence genes (efaA, gelE, asa1, ace, and hyl) in the Japanese isolates were slightly higher than those in the Egyptian isolates. The rate of efaA was the highest (94.9 %) among seven virulence genes detected, but the cylA gene was not detected in all isolates, which was in accordance with γ-type hemolysis phenotype. In Enterococcus faecalis, the rate of kanamycin-resistant strains was the highest (84.75 %) among the antibiotics tested. Moreover, 78 % of E. faecalis strains exhibited multi-drug resistance. Four moderately vancomycin-resistant strains were found in Egyptian isolates, but none were found in Japanese isolates. MALDI-TOF MS analysis correctly identified 98.5 % (68/69) of the Enterococcus isolates. In the principal component analysis dendrogram, strains isolated from the same region with the same virulence characteristics and similar biofilm-forming abilities were characterized by clustered distribution in different clusters. This finding highlights the potential of MALDI-TOF MS for classifying E. faecalis strains from food sources.

Characterization of genotype V Japanese encephalitis virus isolates from Republic of Korea

ABSTRACT Japanese encephalitis (JE), caused by the Japanese encephalitis virus (JEV) infection, continues to pose significant public health challenges worldwide despite efficient vaccines. The virus is classified into five genotypes, among which genotype V (GV) was not detected for a long period after its initial isolation in 1952, until reports emerged from China and the Republic of Korea (ROK) since 2009. The characteristics of the virus are crucial in estimating its potential epidemiological impact. However, characterization of GV JEVs has so far been limited to two strains: Muar, the original isolate, and XZ0934, isolated in China. Two additional ROK GV JEV isolates, NCCP 43279 and NCCP 43413, are currently available, but their characteristics have not been explored. Our phylogenetic analysis revealed that GV virus sequences from the ROK segregate into two clades. NCCP 43279 and NCCP 43413 belong to different clades and exhibit distinct in vitro phenotypes. NCCP 43279 forms larger plaques but demonstrates inefficient propagation in cell culture compared to NCCP 43413. In vivo, NCCP 43279 induces higher morbidity and mortality in mice than NCCP 43413. Notably, NCCP 43279 shows more severe blood–brain barrier damage, suggesting superior brain invasion capabilities. Consistent with its higher virulence, NCCP 43279 displays more pronounced histopathological and immunopathological outcomes. In conclusion, our study confirms that the two ROK isolates are not only classified into different clades but also exhibit distinct in vitro and in vivo characteristics.

Molecular characterization of Japanese isolates of soil-borne wheat mosaic virus in the genus Furovirus

Molecular characterization of Japanese isolates of soil-borne wheat mosaic virus in the genus Furovirus

Molecular characterization and host reaction to tomato mottle mosaic virus isolated from sweet pepper seeds in Japan.

Many countries have identified tomato mottle mosaic virus (ToMMV) as a serious threat to tomato production. Here, we constructed and characterized infectious clones of ToMMV isolated from Japanese sweet pepper seeds. The genome of the Japanese isolate is 6399 nucleotides in length and exhibits thehighest identity withpreviously characterized isolates. For example, it is 99.7% identical to that of the Mauritius isolate, which occurs worldwide. Phylogenetic analysis based on complete genome sequences revealed that the Japanese isolates clustered in the same clade as those from other countries. When homozygous tomato cultivars with tobamovirus resistance genes were inoculated with an infectious cDNA clone of ToMMV, the virus systemically infected tomato plants with symptoms typical of Tm-1-carrying tomato cultivars. In contrast, tomato cultivars carrying Tm-2 or Tm-22 showed symptoms only on the inoculated leaves. Furthermore, when commercial cultivars of Tm-22 heterozygous tomato were inoculated with ToMMV, systemic infections were observed in all cultivars, with infection frequencies ranging from 25 to 100%. Inoculation of heterozygous sweet pepper cultivars with tobamovirus resistance genes (L1, L3, and L4) with ToMMV resulted in an infection frequency of about 70%, but most of the infected L1, L3, and L4 cultivars were symptomless, and 10-20% showed symptoms of necrosis and yellowing. Tomato mosaic virus strain L11A, an attenuated virus, did not provide cross-protection against ToMMV and led to systemic infection with typical symptoms. These results suggest that ToMMV might cause extensive damage to existing tomato and sweet pepper cultivars commonly grown in Japan.

Whole-genome comparison of two same-genotype macrolide-resistant Bordetella pertussis isolates collected in Japan.

The emergence of macrolide-resistant Bordetella pertussis (MRBP) is a significant problem because it reduces treatment options for pertussis and exacerbates the severity and spread of the disease. MRBP has been widely prevalent in mainland China since the 2010s and has been sporadically detected in other Asian countries. In Japan, two MRBP clinical strains were first isolated in Tokyo and Osaka between June and July 2018. The isolates BP616 in Osaka and BP625 in Tokyo harbored the same virulence-associated allelic genes (including ptxP1, ptxA1, prn1, fim3A, and fhaB3) and MT195 genotype and exhibited similar antimicrobial susceptibility profiles. However, despite their simultaneous occurrence, a distinguishable epidemiological link between these isolates could not be established. To gain further insight into the genetic relationship between these isolates in this study, we performed whole-genome analyses. Phylogenetic analysis based on genome-wide single-nucleotide polymorphisms revealed that the isolates belonged to one of the three clades of Chinese MRBP isolates, but there were 11 single-nucleotide polymorphism differences between BP616 and BP625. Genome structure analysis revealed two large inversions (202 and 523 kbp) and one small transposition (3.8 kbp) between the genomes. These findings indicate that the two Japanese MRBP isolates are closely related to Chinese MRBP isolates but are genomically distinct, suggesting that they were introduced into Japan from mainland China through different transmission routes.

Geographic characteristics of HTLV-1 molecular subgroups and genetic substitutions in East Asia: Insights from complete genome sequencing of HTLV-1 strains isolated in Taiwan and Japan.

Although Japan is a major endemic area for human T-lymphotropic virus type 1 (HTLV-1) and the virus has been well-studied in this region, there is limited research on HTLV-1 in surrounding regions. In this study, we determined the complete genome sequences of HTLV-1 strains isolated from Taiwan and Japan and investigated the geographic characteristics of molecular subgroups and substitution mutations to understand the spread of HTLV-1 and its correlation with human migration. The complete genome sequences of 26 HTLV-1 isolates from Taiwan were determined using next-generation sequencing and were compared with those of 211 isolates from Japan in terms of subgroup and genetic mutations. In total, 15/26 (58%) isolates from Taiwan belonged to the transcontinental subgroup and 11/26 (42%) isolates belonged to the Japanese subgroup. The transcontinental subgroup was significantly more prevalent among Taiwanese isolates than Japanese isolates (58% vs 18%, P < 0.0001). The mutation rate for the complete HTLV-1 sequence was as low as 0.2%. On examining individual base substitutions, the G-to-A mutation was predominant. Bayesian phylogenetic tree analysis estimated the time to the most recent common ancestor for the transcontinental and Japanese subgroups to be 28447 years. The transcontinental subgroups from Taiwan and Japan appeared to form clusters according to their respective regions. The transcontinental subgroup of HTLV-1 is predominant in Taiwan, while the Japanese subgroup is common in Japan. The difference in subgroup distribution may be attributed to the initial spread of the transcontinental subgroup in East Asia, followed by the influx of the Japanese subgroup.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Antimicrobial resistance patterns of Streptococcus uberis isolates from bovine milk in Chiba prefecture, Japan: association between multidrug resistance and clonal complex 996.

Streptococcus uberis is one of major pathogens causing bovine mastitis. However, there is poor information on antimicrobial resistance (AMR) among the Japanese isolates. To provide treatment information for the mastitis caused by S. uberis in Japan, we aimed to clarify AMR patterns of the isolates from bovine milk mainly in Chiba. AMR phenotyping/genotyping [blaZ-erm(A)-erm(B)-mef(A)-linB-lnuD-tet(M)-tet(O)-tet(K)-tet(L)-tet(S)] and multilocus sequence typing were performed to analyze relationships between AMR patterns and clonal complexes (CCs). Resistance to tetracycline-, macrolide-, and lincosamide-classes was mainly associated with possession of tet(O), tet(S), erm(B), linB, and lnuD genes. CC996 was significantly associated with multidrug resistance (P<0.0001). These findings will aid Chiba farm animal clinics in treating bovine mastitis.

Antimicrobial resistance and AmpC production in ESBL-producing Klebsiella pneumoniae and Klebsiella quasipneumoniae: A retrospective study in Japanese clinical isolates.

The study of Klebsiella quasipneumoniae, Klebsiella variicola, and AmpC production in extended-spectrum β-lactamase (ESBL)-producing Klebsiella in Japan is limited, and existing data are insufficient. This study aims to characterize Klebsiella species, determine AmpC production rates, and analyze antimicrobial resistance patterns in ESBL-producing Klebsiella isolates in Japan. A total of 139 clinical isolates of ESBL-producing Klebsiella were collected in Japan, along with their corresponding antimicrobial susceptibility profiles. The isolates were identified using a web-based tool. ESBL genes within the isolates were identified using multiplex PCR. Screening for AmpC-producing isolates was performed using cefoxitin disks, followed by multiplex PCR to detect the presence of AmpC genes. Antimicrobial resistance patterns were analyzed across the predominant ESBL genotypes. The web-based tool identified 135 isolates (97.1%) as Klebsiella pneumoniae and 4 (2.9%) as K. quasipneumoniae subsp. similipneumoniae, with no instances of K. variicola detected. Among K. pneumoniae, the CTX-M-1 group emerged as the predominant genotype (83/135, 61.5%), followed by K. quasipneumoniae subsp. similipneumoniae (3/4, 75.0%). The CTX-M-9 group was the second most prevalent genotype in K. pneumoniae (45/135, 33.3%). The high resistance rates were observed for quinolones (ranging from 46.7% to 63.0%) and trimethoprim/sulfamethoxazole (78.5%). The CTX-M-1 group exhibited higher resistance to ciprofloxacin (66/83, 79.5%) compared to the CTX-M-9 group (18/45, 40.0%), a trend also observed for levofloxacin and trimethoprim/sulfamethoxazole. Among the 16 isolates that tested positive during AmpC screening, only one K. pneumoniae isolates (0.7%) were confirmed to carry the AmpC gene. Klebsiella pneumoniae with the CTX-M-1 group is the most common ESBL-producing Klebsiella in Japan and showed a low proportion of AmpC production. These isolates are resistant to quinolones and trimethoprim/sulfamethoxazole, highlighting the challenge of managing this pathogen. The findings underscore the importance of broader research and continuous monitoring to address the resistance patterns of ESBL-producing Klebsiella.

Comparative pathogenomic analysis reveals a highly tetanus toxin-producing clade of Clostridium tetani isolates in Japan.

C. tetani is a spore-forming, anaerobic bacterium that produces a toxin causing muscle stiffness and paralysis. Tetanus is preventable with the toxoid vaccine, but it remains a significant public health threat in regions with low vaccine coverage. However, there are relatively few isolates and limited genomic information available worldwide. In Japan, about 100 cases are reported each year, but there have been no nationwide surveys of isolates, and no genomic information from Japanese isolates has been published. In our study, we analyzed the genomes of 151 strains from a limited survey of soil in Kumamoto, Japan. Our findings revealed a high degree of genetic diversity, and we also identified a subset of strains that produced significantly more toxin, which provides new insights into the pathogenesis of tetanus. Our findings lay the foundation for future studies to investigate the distribution and evolution of C. tetani in Japan and neighboring countries.

Molecular and biological investigating of tea plant necrotic ring blotch virus as a worldwide threat

Tea plant necrotic ring blotch virus (TPNRBV) has emerged as a significant threat to tea plantations, primarily in China. Since 2020, similar symptoms have been observed in tea plants in northern Iran, raising concerns about the spread of this viral infection. In this study, we conducted an extensive investigation involving approximately 70 samples collected from both symptomatic and asymptomatic tea plants. Using reverse transcription-polymerase chain reaction with specially designed primers, we successfully amplified DNA fragments from 26 samples, confirming the presence of TPNRBV. Subsequent sequencing of these fragments revealed various segments of the TPNRBV genome. Our phylogenetic analysis revealed that the Iranian TPNRBV isolates formed a distinct sub-cluster alongside Chinese isolates, distinguishing them from Japanese isolates. These finding sheds light on the genetic diversity and relationships of TPNRBV across different regions. Additionally, we explored the potential modes of TPNRBV transmission. Mechanical transmission experiments confirmed the ability of the virus to infect Nicotiana rustica and Chenopodium quinoa seedlings, highlighting the risk of mechanical spread within tea plantations. Moreover, we investigated seed transmission and found evidence of TPNRBV in various parts of tea seeds, suggesting the possibility of seed-borne transmission. Overall, this comprehensive study enhances our understanding of the biological and molecular characteristics of TPNRBV, an emerging threat to global tea production. Our findings provide valuable insights into the virus’s transmission dynamics and genetic diversity, which are essential for developing effective management strategies to mitigate its impact on tea cultivation worldwide.

In vitro Azole Susceptibility Testing of Japanese Isolates of Itraconazole-Resistant Dermatophytes.

We conducted antifungal susceptibility testing on itraconazole (ITCZ)-resistant isolates of Trichophyton interdigitale and Trichophyton rubrum collected from Japanese patients in 2021 and 2022. The aim of the present study was to determine the most effective drug against ITCZ-resistant strains of dermatophytes. In all isolates, the minimum inhibitory concentrations (MICs) were > 32 mg/l for ITCZ, < 0.03 to 0.5 mg/l for ravuconazole (RVCZ), and < 0.03 mg/l for efinaconazole (EFCZ), luliconazole (LUCZ), and terbinafine (TRBF). Thus, in tinea unguium cases with ITCZ-resistant strains, treatment should be switched to TRBF or other azoles with a stronger antifungal efficacy, such as EFCZ, LUCZ, or RVCZ, and treatment must continue until the infectious organisms are completely eliminated.

Emerging porcine Enterovirus G infections, epidemiological, complete genome sequencing, evolutionary and risk factor analysis in India

The current study reports the in-depth analysis of the epidemiology, risk factors, and molecular characterization of a complete genome of Enterovirus G (EV-G) isolated from Indian pigs. We analysed several genes of EV-G isolates collected from various provinces in India, using phylogenetic analysis, recombination detection, SimPlot, and selection pressure analyses. Our analysis of 534 porcine faecal samples revealed that 11.61% (62/534) of the samples were positive for EV-G. While the G6 genotype was the most predominant, our findings showed that Indian EV-G strains also clustered with EV-G types G1, G6, G8, and G9. Furthermore, Indian EV-G strains exhibited the highest nucleotide similarity with Vietnamese (81.3%) and Chinese EV-G isolates (80.3%). Moreover, we identified a recombinant Indian EV-G strain with a putative origin from a Japanese isolate and South Korean EV-G isolate. In summary, our findings provide significant insights into the epidemiology, genetic diversity, and evolution of EV-G in India.

Congenital malformations caused by Akabane virus in porcine fetuses in southern Japan.

Akabane virus (AKAV) is known as a major teratogenic agent of ruminant fetuses. In this study, we investigated the relationship between porcine abnormal deliveries and AKAV by serology, pathology, and virology investigations using specimens from 16 stillborn fetuses delivered in southern Japan between 2013 and 2015. The major clinical manifestations in stillborn fetuses were hydranencephaly, arthrogryposis, spinal curvature, and both skeletal muscle and subcutaneous edema. Histologic examination of the specimens identified atrophy of skeletal muscle fibers accompanied by adipose replacement. Nonsuppurative encephalomyelitis and decreased neuronal density in the ventral horn of the spinal cord were shown in two separate fetuses, respectively. Neutralizing antibody titers to AKAV were detected in most of the tested fetuses (13/16). The AKAV sequences detected in the affected fetuses in 2013 and 2015 were highly identical and closely related to Japanese AKAV isolates which were isolated in 2013 and sorted into genogroup I of AKAV. Immunohistochemistry visualized AKAV antigens in the neuronal cells of the central nervous system of the fetuses. These findings indicate that AKAV was involved in the birth of abnormal piglets at the affected farm. The clinical manifestations and histopathological features in the stillborn fetuses were very similar to those in ruminant neonates affected by AKAV. To avoid misdiagnosis and to evaluate the precise impact of AKAV on pig reproduction, AKAV should be considered in differential diagnoses of reproductive failures in pigs.

Cryphonectria carpinicola discovered in Japan: first report of the sexual state on Carpinus tree.

Cryphonectria carpinicola is an ascomycetous fungus that has been regularly found in its asexual form on European hornbeam (Carpinus betulus) in Europe over the past two decades. Here we describe the discovery of C. carpinicola in Japan and report for the first time its sexual state on Carpinus species. No symptomatic trees were observed, but stromata were found saprotrophically on broken branches of Carpinus species on the forest floor. The sexual structures of C. carpinicola resembled that of other Cryphonectria species and strongly resembled those of the closely related species C. radicalis. A phylogenetic tree based on the internal transcribed spacer sequences showed monophyly for the Japanese and European isolates of C. carpinicola. Further studies on the distribution and host range of C. carpinicola in Japan and on the life history strategies of this fungus are needed.

Prevalence and Genetic Diversity of Cross-Assembly Phages in Wastewater Treatment Plants in Riyadh, Saudi Arabia.

The most common DNA virus found in wastewaters globally is the cross-assembly phage (crAssphage). King Saud University wastewater treatment plant (KSU-WWTP); Manfoha wastewater treatment plant (MN-WWTP); and the Embassy wastewater treatment plant (EMB-WWTP) in Riyadh, Saudi Arabia were selected, and 36 untreated sewage water samples during the year 2022 were used in the current study. The meteorological impact on crAssphage prevalence was investigated. CrAssphage prevalence was recorded using PCR and Sanger sequencing. The molecular diversity of crAssphage sequences was studied for viral gene segments from the major capsid protein (MCP) and membrane protein containing the peptidoglycan-binding domain (MP-PBD). KSU-WWTP and EMB-WWTP showed a higher prevalence of crAssphage (83.3%) than MN-WWTP (75%). Phylogenetic analysis of MCP and MP-PBD segments depicted a close relationship to the Japanese isolates. The MCP gene from the current study's isolate WW/2M/SA/2022 depicted zero evolutionary divergence from 3057_98020, 2683_104905, and 4238_99953 isolates (d = 0.000) from Japan. A significant influence of temporal variations on the prevalence of crAssphage was detected in the three WWTPs. CrAssphage displayed the highest prevalence at high temperatures (33-44 °C), low relative humidity (6-14%), and moderate wind speed (16-21 Km/h). The findings provided pioneering insights into crAssphage prevalence and its genetic diversity in WWTPs in Riyadh, Saudi Arabia.