ITS rRNA Gene Research Articles

Review of the Cyanobacterial Genus Phormidesmis (Leptolyngbyaceae) with the Description of Apatinema gen. nov.

Cyanobacteria are crucial components of biological soil crusts of polar landscapes and carry out many functions in subaerial environments. Simple untapered filamentous cyanobacteria are typically in the terrestrial biotopes. They appear to be a group with an abundance of cryptic taxa. We isolated 23 strains of cyanobacteria from the different habitats of the Arctic and temperate zone, from 10 locations in order to characterize their morphological and genotypic diversity. Phylogenetic analyses were conducted on the 16S and 16S–23S ITS rRNA gene regions using Bayesian inference and maximum likelihood. A morphological comparison of the isolated strains with similar known species, as well as its phylogenetic analyses, revealed that they belong to three species of the genus Phormidesmis (P. nigrescens, P. pristley, and P. communis)—and to the previously unknown genus of Leptolyngbyaceae. Using an integrative approach, we provide here a description of a new taxon Apatinema gen. nov.

Plant Performance and Soil Fungal Community Impacts of Enhancing Dioscorea opposita with Spraying Foliar Fertilizer with Different Nutrient Element Combinations

Foliar fertilization, an effective method to regulate plant nutrition has attracted much attention. In this study, the effects of different foliar fertilizers (F1: NPK formulation, F2: NPK+Fe-Mn-Zn formulation, F3: Fe-Mn-Zn formulation, and CK: deionized water) on plant growth, chemical composition, rhizosphere soil properties, and fungal community of Dioscorea opposita Thunb. were assessed by a field plot experiment. Rhizosphere fungal community was examined via Illumina MiSeq sequencing of ITS2 rRNA genes. Spraying foliar fertilizer directly affected the growth and chemical content of the plant, which depends on different foliar fertilizers. Ascomycota and Moraxella were the dominant fungal phyla. Nutrient elements were the main factors affecting fungal composition, and soil microelements positively influenced soil fungi, while soil macroelements negatively influenced soil fungi. Macroelement foliar fertilizer affected soil fungi by directly affecting the growth parameters and macroelement content of the plant or by directly affecting soil properties, while microelement foliar fertilizer affected soil fungi by directly affecting the microelement content of the plant or by directly affecting the soil pH and organic matter content. These factors were involved in the formation of a “leaf-root-soil microbe” conduction system similar to the “brain-gut-microbe” axis. Our results provide a basis for the application of foliar fertilizer in the cultivation of medicinal plants.

Soil texture is a stronger driver of the maize rhizosphere microbiome and extracellular enzyme activities than soil depth or the presence of root hairs

AimsDifferent drivers are known to shape rhizosphere microbiome assembly. How soil texture (Texture) and presence or lack of root hairs (Root Hair) of plants affect the rhizosphere microbiome assembly and soil potential extracellular enzyme activities (EEA) at defined rooting depth (Depth) is still a knowledge gap. We investigated effects of these drivers on microbial assembly in rhizosphere and on potential EEA in root-affected soil of maize.MethodsSamples were taken from three depths of root hair defective mutant rth3 and wild-type WT maize planted on loam and sand in soil columns after 22 days. Rhizosphere bacterial, archaeal, fungal and cercozoan communities were analysed by sequencing of 16S rRNA gene, ITS and 18S rRNA gene fragments. Soil potential EEA of ß-glucosidase, acid phosphatase and chitinase were estimated using fluorogenic substrates.ResultsThe bacterial, archaeal and cercozoan alpha- and beta-diversities were significantly and strongly altered by Texture, followed by Depth and Root Hair. Texture and Depth had a small impact on fungal assembly, and only fungal beta-diversity was significantly affected. Significant impacts by Depth and Root Hair on beta-diversity and relative abundances at taxonomic levels of bacteria, archaea, fungi and cercozoa were dependent on Texture. Likewise, the patterns of potential EEA followed the trends of microbial communities, and the potential EEA correlated with the relative abundances of several taxa.ConclusionsTexture was the strongest driver of rhizosphere microbiome and of soil potential EEA, followed by Depth and Root Hair, similarly to findings in maize root architecture and plant gene expression studies.

Prevalence and Molecular Characterization of Ascaridoid Parasites of Philippine Decapterus Species.

There are relatively few studies on parasite fauna of marine fishes in Philippine waters. This study aimed to determine the prevalence of marine ascaridoid infection in Decapterus species in Balayan Bay and Tayabas Bay. A total of 371 fishes belonging to three different species of Decapterus (D. tabl [n = 130], D. macrosoma [n = 121], and D. maruadsi [n = 120]) were collected. Ascaridoid parasite larvae were found in all fish host species, with an overall fish infection rate of 22%. The highest infection rate was observed in D. tabl (27.69%), followed by D. macrosoma (19%), and then D. maruadsi (17.50%). Moreover, a higher prevalence of infection was detected in Tayabas Bay (27.57%) than in Balayan Bay (15.59%). Molecular analyses based on the ITS2 and 18S rRNA gene supported the identification of the larvae into two species: Anisakis typica and Raphidascaris (Ichthyascaris) lophii. This is the first report of the genetic identification of these two helminth parasites in Decapterus fish species in the Philippines. Paucity in the database of Philippine marine fish parasites warrants more research efforts, especially concerning economically important fish species with implications to food safety and food security.

Screening of Bioactive Compounds from Endophytic Marine-Derived Fungi in Saudi Arabia: Antimicrobial and Anticancer Potential.

Nowadays, endophytic fungi represent a rich source of biological active compounds. In the current study, twelve endophytic fungal species were isolated from Avicennia marina leaves. From the isolates, Aspergillus niger, Penicillium rubens and Alternaria alternata recorded the highest isolation frequency (80%), relative density (12.5%) and antimicrobial activity. The antimicrobial and anticancer activities of P. rubens were more effective than those of A. niger and A. alternata; therefore, its identification was confirmed via the ITS rRNA gene. Filtrate extracts of P. rubens, A. alternata and A. niger were analyzed using GC-MS and showed different detected constituents, such as acetic acid ethyl ester, N-(4,6-Dimethyl-2-pyrimidinyl)-4-(4-nitrobenzylideneamino) benzenesulfonamide, 1,2-benzenedicarboxylic acid, hexadecanoic acid and octadecanoic acid. Filtrate extract of P. rubens exhibited the presence of more compounds than A. alternata and A. niger. Bacillus subtilis, Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Candida albicans and Aspergillus fumigatus were more inhibited by P. rubens extract than A. alternata or A. niger, with inhibition zones of 27.2 mm, 22.21 mm, 26.26 mm, 27.33 mm, 28.25 mm and 8.5 mm, respectively. We observed negligible cytotoxicity of P. rubens extract against normal cells of human lung fibroblasts (WI-38 cell line), unlike A. alternata and A. niger extracts. Proliferation of prostate cancer (PC-3) was inhibited using P. rubens extract, exhibiting mortality levels of 75.91% and 76.2% at 200 µg/mL and 400 µg/mL of the extract. Molecular docking studies against the crystal structures of C. albicans (6TZ6) and the cryo-EM structure of B. subtilis (7CKQ) showed significant interactions with benzenedicarboxylic acid and N-(4,6-dimethyl-2-pyrimidinyl)-4-(4-nitrobenzylideneamino) benzenesulfonamide as a constituent of P. rubens extract. N-(4,6-dimethyl-2-pyrimidinyl)-4-(4-nitrobenzylideneamino) benzenesulfonamide had the highest scores of −6.04905 kcal/mol and −6.590 kcal/mol towards (6tz6) and (7CKQ), respectively.

Interkingdom Plant–Soil Microbial Ecological Network Analysis under Different Anthropogenic Impacts in a Tropical Rainforest

Plants and their associated soil microorganisms interact with each other and form complex relationships. The effects of slash-and-burn agriculture and logging on aboveground plants and belowground microorganisms have been extensively studied, but research on plant–microbial interkingdom ecological networks is lacking. In this study, using old growth forest as a control, we used metagenomic data (ITS and 16S rRNA gene amplified sequences) and plant data to obtain interdomain species association patterns for three different soil disturbance types (slash-and-burn, clear cutting and selective cutting) in a tropical rainforest based on interdomain ecological network (IDEN) analysis. Results showed that the soil bacterial–fungal and plant–microbe ecological networks had different topological properties among the three forest disturbance types compared to old growth forest. More nodes, links, higher modularity and negative proportion were found in the selective cutting stand, indicating higher stability with increasing antagonistic relationships and niche differentiation. However, the area of slash-and-burn forest yield opposite results. Network module analysis indicated that different keystone species were found in the four forest types, suggesting alternative stable states among them. Different plant species had more preferential associations with specific fungal taxa than bacterial taxa at the genus level and plant–microbe associations lagged behind bacterial–fungal associations. Overall, compared with old growth forests, the bacterial–fungal and plant–microbe ecological networks in the slash-and-burn and clear cutting stands were simpler, while the network in the selective cutting stand was more complex. Understanding the relationships between aboveground plants and belowground microorganisms under differing disturbance patterns in natural ecosystems will help in better understanding the surrounding ecosystem functions of ecological networks.

Soil Microbial and Organic Carbon Legacies of Pre-Existing Plants Drive Pioneer Tree Growth during Subalpine Forest Succession

Fast-growing pioneer tree species play a crucial role in triggering late successional development in forests. Experimental evidence of the soil legacy effects of pre-existing plants on pioneer tree performance is lacking. We explored the legacy effects of soils conditioned by early successional herbs (Poa poophagorum Bor and Potentilla fragarioides L.) and mid-successional shrubs (Rhododendron fortunei Lindl. and Enkianthus quinqueflorus Lour.) on late-successional ectomycorrhizal (ECM) pioneer tree (Betula platyphylla Sukaczev) seedling growth. The soils were analyzed for soil nutrient status and fungal and bacterial compositions using ITS and 16S rRNA gene sequencing. B. platyphylla seedlings produced higher biomass in soils conditioned by shrubs. Soil organic carbon (SOC) and bacterial and fungal legacies most impacted pioneer tree seedling growth. Additionally, the partial least squares path model revealed that soil nutrients, especially SOC, indirectly affected seedling biomass by their direct effects on the bacterial and fungal communities. The changes in bacterial community composition had a stronger effect on seedling biomass than those of fungi because bacteria with shorter turnover times are generally considered to be more efficient than fungi in enhancing nutrient availability. Our study integrates soil microbial and nutrient legacies to explain the potential mechanisms of pioneer tree regeneration.

Microbial Community Compositional Stability in Agricultural Soils During Freeze-Thaw and Fertilizer Stress

Microbial activity persists in cold region agricultural soils during the fall, winter, and spring (i.e., non-growing season) and frozen condition, with peak activity during thaw events. Climate change is expected to change the frequency of freeze-thaw cycles (FTC) and extreme temperature events (i.e, altered timing, extreme heat/cold events) in temperate cold regions, which may hasten microbial consumption of fall-amended fertilizers, decreasing potency come the growing season. We conducted a high-resolution temporal examination of the impacts of freeze-thaw and nutrient stress on microbial communities in agricultural soils across both soil depth and time. Four soil columns were incubated under a climate model of a non-growing season including precipitation, temperature, and thermal gradient with depth over 60 days. Two columns were amended with fertilizer, and two incubated as unamended soil. The impacts of repeated FTC and nutrient stress on bacterial, archaeal, and fungal soil community members were determined, providing a deeply sampled longitudinal view of soil microbial response to non-growing season conditions. Geochemical changes from flow-through leachate and amplicon sequencing of 16S and ITS rRNA genes were used to assess community response. Despite nitrification observed in fertilized columns, there were no significant microbial diversity, core community, or nitrogen cycling population trends in response to nutrient stress. FTC impacts were observable as an increase in alpha diversity during FTC. Community compositions shifted across a longer time frame than individual FTC, with bulk changes to the community in each phase of the experiment. Our results demonstrate microbial community composition remains relatively stable for archaea, bacteria, and fungi through a non-growing season, independent of nutrient availability. This observation contrasts canonical thinking that FTC have significant and prolonged effects on microbial communities. In contrast to permafrost and other soils experiencing rare FTC, in temperate agricultural soils regularly experiencing such perturbations, the response to freeze-thaw and fertilizer stress may be muted by a more resilient community or be controlled at the level of gene expression rather than population turn-over. These results clarify the impacts of winter FTC on fertilizer consumption, with implications for agricultural best practices and modeling of biogeochemical cycling in agroecosystems.

DNA barcoding, phylogeny and phylogeography of the cyst nematode species of the Humuli group from the genus Heterodera (Tylenchida: Heteroderidae)

Summary The Humuli group of the genus Heterodera contains species that parasitise dicotyledons and are characterised by a lemon-shaped cyst having a bifenestrate vulval cone (ambifenestrate for H. fici), long vulval slit and weak underbridge. Presently, the Humuli group includes seven species: H. amaranthusiae, H. fici, H. humuli, H. litoralis, H. ripae, H. turcomanica and H. vallicola. In this study we provided comprehensive phylogenetic analyses of COI and ITS rRNA gene sequences of species from the Humuli group using Bayesian inference, maximum likelihood, and maximum and statistical parsimony. All seven valid species from the Humuli group, one putatively new species belonging to this group and the willow cyst nematode, H. salixophila, sharing a common ancestor with the Humuli group, were analysed. Some 84 COI and 5 ITS rRNA new gene sequences from 37 nematode populations collected from 12 countries were obtained in this study. Our results confirmed that the COI gene is a powerful DNA barcoding marker for identification of populations and species from the Humuli group. Based on the results of phylogeographical analysis and age estimation of clades with a molecular clock approach, it was hypothesised that some species of the Humuli group primarily originated and diversified in Western and Middle Asian regions during the Pleistocene and Holocene periods and then dispersed from this region across the world. Two secondary diversification centres of the Humuli group were likely located in East and Southeast Asia, Russian Far East, and Oceania.

Effects of Microbial-Mineral Interactions on Organic Carbon Stabilization in a Ponderosa Pine Root Zone: A Micro-Scale Approach

Soil microbial communities affect the formation of micro-scale mineral-associated organic matter (MAOM) where complex processes, including adhesion, aggregate formation, microbial mineral weathering and soil organic matter stabilization occur in a narrow zone of large biogeochemical gradients. Here we designed a field study to examine carbon stabilization mechanisms by using in-growth mesh bags containing biotite that were placed in a ponderosa pine root zone for 6 months and compared to the surrounding bulk soil. We sought to determine the composition of the microbial community in the mesh bags compared to the surrounding soils, analyze the direct interactions between microbes and biotite, and finally identify the nature of the newly formed MAOM within the mesh-bags. Our results revealed that minerals in the mesh bags were colonized by a microbial community that produced organic matter in situ. The 16S rRNA gene sequencing and ITS2 region characterization showed phylogenetic similarity between the mesh bag and bulk soil archaea/bacteria and fungi microbiomes, with significant differences in alpha- and beta-diversity and species abundances. Organic matter pools in the mesh bags, analyzed by Fourier transform ion cyclotron resonance mass spectrometry, contained protein- (peptides) and lipid-like compounds while the bulk soil OM was comprised of lignin-like and carboxyl-rich alicyclic molecules. These results support that the newly formed biotite associated organic compounds have a microbial signature in the mesh bags. High-resolution electron microscopy documented strongly adhered organic compounds to biotite surfaces, formation of microaggregates, elemental uptake at the microbe (organic matter)-mineral interface, and distortion of biotite layers. Overall, this study shows the direct and indirect involvement of soil microbial communities from the root zone of ponderosa pine in the formation of MAOM, soil organic carbon stabilization, microaggregation, and mineral weathering at micro- and nano-scales.

Identification and phylogenetic characterization based on DNA sequences from RNA ribosomal genes of thermophilic microorganisms in a high elevation Andean tropical geothermal spring

Several microorganisms can survive in harsh acid environments in geothermal springs at high temperatures across the Equatorial Andes Mountains. However, little is known about their physiological features and phylogenetic composition. Here we identify thermophilic microorganisms (bacteria, fungi, and microalgae) hosted in an almost unexplored geothermal spring (known as “Aguas Hediondas”). The phylogeny of the cultures was determined by analyzing physiological features and DNA sequences of PCR products for 16S rRNA, ITS, and 23S rRNA genes. Twenty pure cultures were isolated from the samples, including 17 for bacteria, one for cyanobacterium, one for eukaryotic microalgae, and one for fungus. Most bacterial strains were gram-positive, spore-forming, and bacilli (Bacillus). Cyanobacterium strain belonged to Chroococcidiopsis and the eukaryotic microalgae to Chlorophyta. The unique fungal strain isolated was closely related to T. duponti. Through our study, isolated thermophilic bacteria, microalgae and fungi from the “Aguas Hediondas” geothermal spring were characterized and identified. This study represents one of the first extensive molecular characterizations of extremophile microbes in the Tropical Equatorial Andes. Keywords. microbial diversity; DNA markers; extremophiles; phylogenetics

Into the Plastisphere, Where Only the Generalists Thrive: Early Insights in Plastisphere Microbial Community Succession

The ubiquity of plastic debris in marine environments raises the question, what impacts do plastics have on our marine microbiota? To investigate this, we applied bacterial 16S rRNA gene and fungal ITS2 region sequencing to identify changes in microbial biofilm community compositions on marine plastic, over time. We sampled biofilm on virgin linear low-density polyethylene (LLDPE), nylon-6 (PA) and glass after 2, 6 and 12 weeks of constant immersion in Te Whakaraupō-Lyttelton Harbour, Aotearoa-New Zealand. Of the prokaryotes, Proteobacteria and Bacteroidetes were predominant in all samples and Verrucomicrobiota were most abundant in mature biofilms. Microbial communities on the three substrate types were significantly distinct from those in the surrounding seawater, regardless of age, but not between attachment substrates. Bacterial communities occurring two weeks after immersion and fungal communities at six weeks were found to vary more among substrate types than at other times; however, no significant substrate-specific communities were identified overall. Taxa closely related to previously reported plastic-biodegrading species were found in very low abundance across all substrates, including on the glass slides. Our findings suggest that microorganisms do not selectively persist on the LLDPE or PA surfaces to gain significant direct metabolic benefit, instead using these plastics primarily as an attachment surface on which they form generalist biofilm communities.

Farm-scale differentiation of active microbial colonizers

Microbial movement is important for replenishing lost soil microbial biodiversity and driving plant root colonization, particularly in managed agricultural soils, where microbial diversity and composition can be disrupted. Despite abundant survey-type microbiome data in soils, which are obscured by legacy DNA and microbial dormancy, we do not know how active microbial pools are shaped by local soil properties, agricultural management, and at differing spatial scales. To determine how active microbial colonizers are shaped by spatial scale and environmental conditions, we deployed microbial traps (i.e. sterile soil enclosed by small pore membranes) containing two distinct soil types (forest; agricultural), in three neighboring locations, assessing colonization through 16S rRNA gene and fungal ITS amplicon sequencing. Location had a greater impact on fungal colonizers (R2 = 0.31 vs. 0.26), while the soil type within the microbial traps influenced bacterial colonizers more (R2 = 0.09 vs. 0.02). Bacterial colonizers showed greater colonization consistency (within-group similarity) among replicate communities. Relative to bacterial colonizers, fungal colonizers shared a greater compositional overlap to sequences from the surrounding local bulk soil (R2 = 0.08 vs. 0.29), suggesting that these groups respond to distinct environmental constraints and that their in-field management may differ. Understanding how environmental constraints and spatial scales impact microbial recolonization dynamics and community assembly are essential for identifying how soil management can be used to shape agricultural microbiomes.

Phylogeny of Amphidinium (Dinophyceae) from Guam and Okinawa, with descriptions of A. pagoense sp. nov. and A. uduigamense sp. nov.

ABSTRACT Marine benthic dinoflagellates within the genus Amphidinium were isolated from Guam and Okinawa. Isolated strains were identified to species-level using phylogenetic analyses of 28S rRNA and ITS-5.8S rRNA genes as well as microscopy. Of the six isolated strains, two were new species: A. pagoense sp. nov. and A. uduigamense sp. nov. Other isolates included strains of A. massartii and A. operculatum from Guam, and two strains of A. operculatum from Okinawa. Both new species were described using light and electron microscopy (SEM and TEM). The combination of characteristics that make A. pagoense sp. nov. unique includes a pair of centrally-located pyrenoids, variable cell shape, absence of scales and a long, curved ventral ridge. For A. uduigamense sp. nov., a combination of several morphological features distinguishes it from other species. These include a constriction near the anterior of the hypocone, two centrally located pyrenoids, a longitudinal flagellum inserted in the posterior one-third of the cell, cell size, cell division in the motile stage and the absence of scales. Toxicity was confirmed in these two novel species by testing methanol extracts in an Artemia bioassay. Previously unrecorded ITS rRNA gene sequences from A. operculatum were also sequenced from both locations. Species identified and newly described in this study expand the taxonomic knowledge of Amphidinium in the Pacific.

Assessment of cleaning techniques and its effectiveness for controlling biodeterioration fungi on wall paintings of Maijishan Grottoes

Biodeterioration is one of the main challenges in conservation of cultural heritage. This study tested and evaluated non-destructive methods to clean and control the microbial mycelia grown on the surface of wall paintings at the World Cultural Heritage Site of Maijishan Grottoes in China. Culture-dependent methods were used for isolation of fungi prior to identification by ITS rRNA gene sequences. The mycelia grown on the surface of wall paintings were removed with soft brushes under a negative pressure provided by a modified vacuum pump, and the pre-screened biocides were then selected and applied. Using a portable microscope, a microbial ATP bioluminescence detector, and a colorimeter, the effectiveness of cleaning and controlling against fungal mycelia on the wall paintings was evaluated. The results showed that the fungal isolates were dominated by Arachnomyces spp. with 92.28% sequence identity. Other major culturable fungal isolates were Parengyodontium album, Beauveria bassiana, and Scopulariopsis brumptii. The microscopic examination indicated the surface of the wall paintings was nearly free of visible fungal mycelia after the manual removal. There was a significant reduction of ATP bioluminescence before (43,303 ± 10, 280 RLU/cm2) and after (2,833 ± 388, RLU/cm2) the mechanical removal. The color difference (ΔE∗ab value) were less than 2.0 before and after biocide treatment, such difference could almost be ignored. Additionally, octylisothiazolinone was found to be the most efficient biocide for controlling fungal growth and could be an emergency protection measure. Furthermore, the key environmental factors that triggered periodic breakouts of the microorganisms on wall paintings were long-term higher relative humidity at the interface of earthen plaster layer and supporting sandstone during raining seasons and poor ventilation of the cave. This study provides a reference for the scientific conservation of biodeteriorated ancient wall paintings.

Microbial traces and their role in forensic science.

Forensic microbiology, also known as the microbiology of death, is an emerging branch of science that is still underused in criminal investigations. Some of the cases might be difficult to solve with commonly used forensic methods, and then they become an operational field for microbiological and mycological analyses. The aim of our review is to present significant achievements of selected studies on the thanatomicrobiome (micro-organisms found in the body, organs and fluids after death) and epinecrotic community (micro-organisms found on decaying corpses) that can be used in forensic sciences. Research carried out as a part of the forensic microbiology deals with the thanatomicrobiome and the necrobiome-communities of micro-organisms that live inside and outside of a putrefying corpse. Change of species composition observed in each community is a valuable feature that gives a lot of information related to the crime. It is mainly used in the estimation of post-mortem interval (PMI). In some criminal investigations, such noticeable changes in the microbiome and mycobiome can determine the cause or the actual place of death. The microbial traces found at the crime scene can also provide clear evidence of guilt. Nowadays, identification of micro-organisms isolated from the body or environment is based on metagenome analysis and 16S rRNA gene amplicon-based sequencing for bacteria and ITS rRNA gene amplicon-based sequencing for fungi. Cultivation methods are still in use and seem to be more accurate; however, they require much more time to achieve a final result, which is an unwanted feature in any criminal investigation.

Chronic stress and captivity alter the cloacal microbiome of a wild songbird

There are complex interactions between an organism's microbiome and its response to stressors, often referred to as the 'gut-brain axis'; however, the ecological relevance of this axis in wild animals remains poorly understood. Here, we used a chronic mild stress protocol to induce stress in wild-caught house sparrows (Passer domesticus), and compared microbial communities among stressed animals, those recovering from stress, captive controls (unstressed) and a group not brought into captivity. We assessed changes in microbial communities and abundance of shed microbes by culturing cloacal samples on multiple media to select for aerobic and anaerobic bacteria and fungi. We complemented this with cultivation-independent 16S and ITS rRNA gene amplification and sequencing, pairing these results with host physiological and immune metrics, including body mass change, relative spleen mass and plasma corticosterone concentrations. We found significant effects of stress and captivity on the house sparrow microbiomes, with stress leading to an increased relative abundance of endotoxin-producing bacteria - a possible mechanism for the hyperinflammatory response observed in captive avians. While we found evidence that the microbiome community partially recovers after stress cessation, animals may lose key taxa, and the abundance of endotoxin-producing bacteria persists. Our results suggest an overall link between chronic stress, host immune system and the microbiome, with the loss of potentially beneficial taxa (e.g. lactic acid bacteria), and an increase in endotoxin-producing bacteria due to stress and captivity. Ultimately, consideration of the host's microbiome may be useful when evaluating the impact of stressors on individual and population health.

Effect of Long-Term Agricultural Management on the Soil Microbiota Influenced by the Time of Soil Sampling

Application of agrochemicals and mechanization enabled increasing agricultural productivity yet caused various environmental and soil health-related problems. Agricultural practices affect soil microorganisms, which are the key players of many ecosystem processes. However, less is known about whether this effect differs between time points. Therefore, soil was sampled in winter (without crop) and in summer (in the presence of maize) from a long-term field experiment (LTE) in Bernburg (Germany) managed either under cultivator tillage (CT) or moldboard plow (MP) in combination with either intensive nitrogen (N)-fertilization and pesticides (Int) or extensive reduced N-fertilization without fungicides (Ext), respectively. High-throughput sequencing of 16S rRNA gene and fungal ITS2 amplicons showed that changes in the microbial community composition were correlated to differences in soil chemical properties caused by tillage practice. Microbial communities of soils sampled in winter differed only depending on the tillage practice while, in summer, also a strong effect of the fertilization intensity was observed. A small proportion of microbial taxa was shared between soils from the two sampling times, suggesting the existence of a stable core microbiota at the LTE. In general, taxa associated with organic matter decomposition (such as Actinobacteria, Bacteroidetes, Rhizopus, and Exophiala) had a higher relative abundance under CT. Among the taxa with significant changes in relative abundances due to different long-term agricultural practices were putative pathogenic (e.g., Gibellulopsis and Gibberella) and beneficial microbial genera (e.g., Chitinophagaceae, Ferruginibacter, and Minimedusa). In summary, this study suggests that the effects of long-term agricultural management practices on the soil microbiota are influenced by the soil sampling time, and this needs to be kept in mind in future studies for the interpretation of field data.

First Report of Meloidogyne enterolobii on Ormosia hosiei in China.

Ormosia hosiei is an evergreen tree that belongs to the family of Fabaceae. It is prized for ornamental and medicinal value and rosewood. In November 2020, galls were observed on roots of stunted O.hosiei plants in the Nanning arboretum (22°43'38″ N, 108°18'06″ E), Guangxi, China. Disease incidence was approximately 80% (150 plants evaluated). Females were obtained by dissecting galls and J2s were collected from a single egg mass hatching. The female white body was pear to globular-shaped with a distinct neck region, while the perineal pattern usually was oval-shaped with a moderately high dorsal arch. J2 bodies were translucent with narrow tails and pointed tips, with hyaline tail termini. Those morphological characters were consistent with description of Meloidogyne enterolobii (Yang and Eisenback 1983; Brito et al. 2004). Morphological measurements (mean, standard deviation and range) of J2s (n = 20) included body length= 436.07 ± 12.5 (411.8 to 464.3) µm, body width = 16.01 ± 1.1 (14.6 to 17.7) µm, stylet length = 12.4 ± 0.8 (11.3 to 13.5) µm, dorsal esophageal gland orifice to the stylet base (DGO) = 3.8 ± 0.3 (3.3 to 4.3) µm, tail = 53.6 ± 4.3 (48.9 to 60.6) µm, and hyaline tail length = 15.9 ± 1.5 (13.6 to 18.3) µm. Measurements of females (n = 20) were: body length = 669.5 ± 43.8 (549.9 to 709.4) μm, body width = 641.9 ± 45.2 (559.3 to 732.8) μm, DGO = 5.3 ± 0.52 (4.6 to 6.1) μm, and stylet length = 14.9 ± 0.86 (13.8 to 16.8) μm. These measurements were also consistent with M. enterolobii (Yang and Eisenback. 1983). The ITS rRNA gene sequence and D2-D3 expansion segment of 28S rDNA were amplified in the DNA of individual J2 using the primers 18S/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006 ). The sequences were submitted in the NCBI with GeneBank Accessions No. MZ617284 (766-bp) and OK072889 (759-bp). The homology of the genes was 99% to 100% identical to that of M. enterolobii in ITS rRNA gene sequence MT406251, MG773551, KF418369. The D2-D3 region of 28S rRNA gene revealed 100% identity with M. enterolobii sequences from MT193450, MF467276, MZ541997 etc. Neighbor-joining phylogenetic analysis showed that it was the most similar to M. enterolobii. For further confirmation, M. enterolobii species-specific primer pairs Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the ribosomal intergenic spacer 2. An expected PCR fragment of approximately 236-bp was obtained (Long et al. 2006). Pathogenicity test was conducted in greenhouse with 26 to 30˚C temperature. Eggs were multiplied in the greenhouse using a single eggmass hand-picked from infested O. hosiei roots. Twelve eight-month-old O. hosiei healthy seedlings were inoculated with 5,000 eggs/pot containing autoclaved soil mix (clay: substrate =1:3, v/v), and 6 noninoculated seedlings were controls. After 10 weeks, the control plants displayed no symptoms. The roots of all inoculated plants showed galling symptoms. The reproduction factor (final population/initial population) was 5.2. Furthermore, the morphological and molecular identification of the nematode was identical to the original samples. M. enterolobii has a broad host range (Philbrick et al. 2020). To our knowledge, this is the first report of M. enterolobii parasitizing O. hosiei worldwide. This finding expands the host range of this nematode.

Enrichment in biodiversity and maturation of the soil food web under conservation agriculture is associated with suppression of rice-parasitic nematodes

Meloidogyne spp. and Hirschmanniella spp. are among the most damaging plant-parasitic nematodes (PPNs). They threaten rice production, the main staple food in Asia. Cropping systems that promote natural biocontrol and plant tolerance to diseases are put forward as sustainable solutions to protect rice from these pests. In particular, cropping systems managed under conservation agriculture (CA) are promising because they improve soil health and functioning. We investigated the effects of two cropping system components in a Cambodian field, (i) CA practices, i.e., no-tillage with a cover crop Stylosanthes guianensis (cv. Nina), versus conventional plow-based tillage with no cover crop, and (ii) using IR504, IR64, Azucena and Zhonghua 11 rice varieties, on PPNs in roots and on communities (bacteria, fungi and nematodes) in the rhizosphere. We used a sequencing approach via amplicon barcoding to target microbial marker genes (16 S and ITS rRNA gene) and a microscopic approach to identify and quantify nematodes in the rhizosphere compartment. The variety had less effect than agricultural practices on the infection by PPNs and on the assembly of the three rhizosphere communities. Under CA, the abundance of PPNs extracted from the roots was reduced by 88%. Soil quality was substantially improved (+83% of total Kjeldahl nitrogen, +34% of available phosphorus, +10% of exchangeable potassium, +110% of soil organic carbon, +30% for the cation exchange capacity), thus providing more basal resources for microbial decomposers, especially fungi (+164% putative saprotrophs). Characterization of the three rhizosphere communities revealed a shift in the structure associated with soil enrichment. Both microbial richness (+3% for bacteria and +38% for fungi) and diversity (Shannon index, +11% for fungi and +5% for nematodes) increased. The relative abundance of taxa was modified by CA with notably more mycorrhizal fungi (+329% Glomeromycota spp.) and fewer Pratylenchidae nematodes (−92% Hirschmanniella spp.) in the rhizosphere. The reassembly of the communities using CA was associated with regulation of PPN populations. The reduction in Meloidogyne spp. abundance in roots (−64%) was correlated with the maturity of the food web (maturity index, +10% under CA) and with the increase in the relative abundance of omnivorous nematodes in the rhizosphere (+68% under CA). Seven years of CA in this field enabled the whole soil food web to mature thus creating a favorable niche for potentially predatory nematodes and microbes antagonistic against PPNs. This study confirms that CA is an alternative to nematicides to limit infection by PPNs in rice cropping systems.