dsRNA Isolation Research Articles

Isolation of dsRNA from Plants by Cellulose Chromatography.

As the constitutive molecules of double-stranded RNA (dsRNA) virus genomes and replicative intermediates of single-stranded RNA (ssRNA) viruses, the high-molecular-weight dsRNAs are commonly found in RNA virus-infected plants. Therefore, the dsRNA is recognized as a hallmark of RNA virus infection and the profile of dsRNA has been applied as an efficient tool for diagnoses or characterization of unreported RNA viruses. Cellulose chromatography is one of the most useful procedures for the isolation of viral dsRNAs from total nucleic acids. Here, we describe rapid cellulose-based methods for purification of dsRNAs from plant tissue.

Rapid Purification of dsRNA Using Micro-Spin Cellulose Column.

Double-stranded RNA (dsRNA) is the replication intermediates of all RNA viruses. Purification and analysis of the profile and sequence of dsRNA is vital in virus diagnoses and/or characterization. Cellulose is one of the common materials used for isolation of dsRNA. Cellulose specifically binds dsRNA fraction under 15% ethanol concentration, which allows to isolate dsRNA from total nucleic acid solution or cell lysate. Here, we describe a rapid and reliable method for purifying dsRNA using a home-made micro-spin cellulose column from the cell lysate of virus-infected plant tissue. This labor-saving and rapid method enables routinely high-throughput isolation and analysis of dsRNA in plant or fungi samples.

Improved dsRNA isolation and purification method validated by viral dsRNA detection using novel primers in Saccharomyces cerevisiae

Accurate genomic sequencing demands high-quality double-stranded RNA (dsRNA). Existing methods for dsRNA extraction from yeast, fungi, and plants primarily rely on cellulose, suitable only for small volume extractions, or the time-consuming lithium chloride precipitation. To streamline the traditional phenol-chloroform-based dsRNA extraction method, the main challenge is the reduction of mitochondrial DNA (mtDNA) and Single Stranded RNA (ssRNA) to no detectable levels after gel electrophoresis. This challenge is successfully addressed through the modified approach described here, involving phenol extraction at low pH, followed by the addition of ammonium sulfate to the aqueous buffer. The dsRNA isolated using this novel method exhibits comparable quality to that obtained through cellulose purification, and it is readily amenable to RT-PCR. Moreover, a single batch of yeast cell RNA isolation requires only 2-3 h of hands-on time, thus simplifying and expediting the process significantly.•Buffers were redesigned from [32,33,35].•No DNASE, Ribonuclease A or beads were used during the purification.•Simple and inexpensive dsRNA extraction and purification method is described.

Assessment of mycoviral diversity in Pakistani fungal isolates revealed infection by 11 novel viruses of a single strain of Fusarium mangiferae isolate SP1.

An extensive screening survey was conducted on Pakistani filamentous fungal isolates for the identification of viral infections. A total of 396 fungal samples were screened, of which 36 isolates were found double-stranded (ds) RNA positive with an overall frequency of 9% when analysed by a classical dsRNA isolation method. One of 36 dsRNA-positive strains, strain SP1 of a plant pathogenic fungus Fusarium mangiferae, was subjected to virome analysis. Next-generation sequencing and subsequent completion of the entire genome sequencing by a classical Sanger sequencing method showed the SP1 strain to be co-infected by 11 distinct viruses, at least seven of which should be described as new taxa at the species level according to the ICTV (International Committee on Taxonomy of Viruses) species demarcation criteria. The newly identified F. mangiferae viruses (FmVs) include two partitivirids, one betapartitivirus (FmPV1) and one gammapartitivirus (FmPV2); six mitovirids, three unuamitovirus (FmMV2, FmMV4, FmMV6), one duamitovirus (FmMV5), and two unclassified mitovirids (FmMV1, FmMV3); and three botourmiavirids, two magoulivirus (FmBOV1, FmBOV3) and one scleroulivirus (FmBOV2). The number of coinfecting viruses is among the largest ones of fungal coinfections. Their molecular features are thoroughly described here. This represents the first large virus survey in the Indian sub-continent.

Duplex Structure of Double-Stranded RNA Provides Stability against Hydrolysis Relative to Single-Stranded RNA.

Phosphodiester bonds in the backbones of double-stranded (ds)RNA and single-stranded (ss)RNA are known to undergo alkaline hydrolysis. Consequently, dsRNA agents used in emerging RNA interference (RNAi) products have been assumed to exhibit low chemical persistence in solutions. However, the impact of the duplex structure of dsRNA on alkaline hydrolysis has not yet been evaluated. In this study, we demonstrated that dsRNA undergoes orders-of-magnitude slower alkaline hydrolysis than ssRNA. Furthermore, we observed that dsRNA remains intact for multiple months at neutral pH, challenging the assumption that dsRNA is chemically unstable. In systems enabling both enzymatic degradation and alkaline hydrolysis of dsRNA, we found that increasing pH effectively attenuated enzymatic degradation without inducing alkaline hydrolysis that was observed for ssRNA. Overall, our findings demonstrated, for the first time, that key degradation pathways of dsRNA significantly differ from those of ssRNA. Consideration of the unique properties of dsRNA will enable greater control of dsRNA stability during the application of emerging RNAi technology and more accurate assessment of its fate in environmental and biological systems, as well as provide insights into broader application areas including dsRNA isolation, detection and inactivation of dsRNA viruses, and prebiotic molecular evolution.

Identification and characterization of a tombusvirus isolated from Japanese gentian.

The DECS (dsRNA isolation, exhaustive amplification, cloning and sequencing) analysis technique for viral diagnosis detected a tombusvirus in Japanese gentian not displaying severe symptoms. We tentatively named this virus "gentian virus A" (GeVA). GeVA systemically but inefficiently infected Japanese gentian without causing visible symptoms, while it led to severe symptoms in some other plants. The complete genome sequence of GeVA indicated a typical tombusvirus-like structure. Phylogenetic analysis of the deduced amino acid sequences of four tombusvirus-encoded proteins did not reveal other known tombusviruses that were closely-related to GeVA, suggesting that it is a novel tombusvirus.

Combined DECS Analysis and Next-Generation Sequencing Enable Efficient Detection of Novel Plant RNA Viruses.

The presence of high molecular weight double-stranded RNA (dsRNA) within plant cells is an indicator of infection with RNA viruses as these possess genomic or replicative dsRNA. DECS (dsRNA isolation, exhaustive amplification, cloning, and sequencing) analysis has been shown to be capable of detecting unknown viruses. We postulated that a combination of DECS analysis and next-generation sequencing (NGS) would improve detection efficiency and usability of the technique. Here, we describe a model case in which we efficiently detected the presumed genome sequence of Blueberry shoestring virus (BSSV), a member of the genus Sobemovirus, which has not so far been reported. dsRNAs were isolated from BSSV-infected blueberry plants using the dsRNA-binding protein, reverse-transcribed, amplified, and sequenced using NGS. A contig of 4,020 nucleotides (nt) that shared similarities with sequences from other Sobemovirus species was obtained as a candidate of the BSSV genomic sequence. Reverse transcription (RT)-PCR primer sets based on sequences from this contig enabled the detection of BSSV in all BSSV-infected plants tested but not in healthy controls. A recombinant protein encoded by the putative coat protein gene was bound by the BSSV-antibody, indicating that the candidate sequence was that of BSSV itself. Our results suggest that a combination of DECS analysis and NGS, designated here as “DECS-C,” is a powerful method for detecting novel plant viruses.

A simple and rapid method to purify viral dsRNA from plant and fungal tissue

The occurrence of high-molecular-weight double-stranded RNA (dsRNA) is a hallmark of RNA virus infection in plants and fungi; thus, dsRNA profiling is an attractive tool for preliminary diagnosis or characterization of novel RNA viruses. Here, we report a fast, inexpensive, and easy method to purify viral dsRNAs using a micro-spin column method based on a dsRNA isolation protocol using cellulose powder. The dsRNAs can be purified in 1 h and does not require a particular type or source of dsRNA. This method will be useful to rapidly screen tissues for viral genomic and subgenomic dsRNAs.

A new method to isolate total dsRNA.

When a diseased plant is suspected to be infected with unknown viruses, the approach of isolating double-stranded RNA (dsRNA) from diseased tissues and analyzing the sequence has been useful for detecting the viruses. This procedure owes its success to the majority of plant pathogenic viruses being RNA viruses, which accumulate dsRNAs as copies of their genome or as a replicative intermediate in infected cells. Conventional dsRNA isolation methods (e.g., chromatography using CF-11 cellulose) require a significant amount of plant material and are laborious and time consuming. Therefore, it has been impractical to isolate dsRNA from many samples at the same time. To overcome these problems, we developed a novel dsRNA isolation method involving a recombinant dsRNA-binding protein. Using this method, we can readily isolate viral dsRNA from a small amount of plant material, and can process numerous samples simultaneously. Purified dsRNA can be used as a template for cDNA synthesis and sequencing, enabling detection of both known and unknown viruses.

The defective RNAs of Closteroviridae

The family Closteroviridae consists of two genera, Closterovirus and Ampelovirus with monopartite genomes transmitted respectively by aphids and mealybugs and the Crinivirus with bipartite genomes transmitted by whiteflies. The Closteroviridae consists of more than 30 virus species, which differ considerably in their phytopathological significance. Some, like beet yellows virus and citrus tristeza virus (CTV) were associated for many decades with their respective hosts, sugar beets and citrus. Others, like the grapevine leafroll-associated ampeloviruses 1, and 3 were also associated with their grapevine hosts for long periods; however, difficulties in virus isolation hampered their molecular characterization. The majority of the recently identified Closteroviridae were probably associated with their vegetative propagated host plants for long periods and only detected through the considerable advances in dsRNA isolation and sequencing of PCR amplified replicons. Molecular characterization of CTV and several other Closteroviridae revealed that, in addition to genomic and subgenomic RNAs, infected plants contain several different subviral defective RNAs (dRNAs). The roles and biological functions of dRNAs associated with Closteroviridae remain terra incognita.

Recombinant plant dsRNA-binding protein as an effective tool for the isolation of viral replicative form dsRNA and universal detection of RNA viruses

The isolation of viral replicative form (RF) double-stranded RNA (dsRNA) is a classic technique for plant virus detection when the virus species cannot be predicted from disease symptoms. However, the method has not been very widely used, most likely because dsRNA isolation using CF-11 cellulose is laborious and time-consuming. Here we report an alternative tool, a recombinant plant dsRNA-binding protein, to isolate dsRNA. This tool enables us to isolate viral RF dsRNA in an hour from either extracted nucleic acids or crude detergent extracts. Combining this technique with sequence-non-specific reverse transcription, PCR amplification, cloning, and sequencing, a variety of viruses were efficiently detected using a single set of reagents and procedures.

Nucleotide sequence of a satellite RNA associated with carrot motley dwarf in parsley and carrot

Carrot motley dwarf (CMD) is known to result from a mixed infection by two viruses, the polerovirus Carrot red leaf virus and one of the umbraviruses Carrot mottle mimic virus or Carrot mottle virus. Some umbraviruses have been shown to be associated with small satellite (sat) RNAs, but none have been reported for the latter two. A CMD-affected parsley plant was used for sap transmission to test plants, that were used for dsRNA isolation. The presence of a 0.8-kbp dsRNA indicated the occurrence of a hitherto unrecognized satRNA associated with CMD. The satRNAs of the CMD isolate from parsley and an isolate from carrot have been sequenced and showed 94% sequence identity. Nucleotide sequences and putative translation products had no significant similarities to GenBank entries. To our knowledge, this is the first report of satRNAs associated with CMD.

A non-phenol–chloroform extraction of double-stranded RNA from plant and fungal tissues

Double-stranded RNA (dsRNA) molecules of viruses are found in nature at a very high frequency. Their detection in plants and fungi has been carried out with difficulty due to the complicated dsRNA extraction techniques used commonly which includes phenol–chloroform extractions. In this study, an extraction method for isolation of dsRNA is described that is free of phenol and chloroform. A lysis buffer, containing β-mercaptoethanol and polyvinylpolypyrrolidone (PVPP-40), was added to homogenised tissues and the subsequent supernatant was filtered through a cellulose CF-11 mini-column. DsRNA molecules were separated based on the differing affinity of nucleic acids for the cellulose CF-11 resin in 20% ethanol buffer. This easy, rapid and cheap technique has been successfully tested on fungi and plants containing different dsRNA virus molecules, indicating the possibility of a wide use of the method.

Modified small-scale batch procedure for isolation of dsRNA from Cryphonectria parasitica

Cytoplasmically-transmissible viral double-stranded RNAs of the genus Hypovirus cause reduced virulence (hypovirulence) in the chestnut blight fungus Cryphonectria parasitica. Biological control of this fungal disease is done by inoculating selected artificial hypovirulent strains of C. parasitica in the wounds of attacked chestnut trees and is followed by testing the transmissibility of dsRNA to C. parasitica isolates affecting these trees. Here we present a modified protocol of isolation and detection of dsRNA. The proposed procedure requires smaller amounts of fungal material for dsRNA detection and uses less reagents, thus resulting in appreciable cost savings.

Isolation and Identification of Virus dsRNA from Strawberry Plants

The analysis of virus genome is based on nucleic acid isolation. The aims of this study were to develop a method for isolation and identification of virus double-stranded ribonucleic acid (dsRNA) and to elucidate the nucleotide sequences of strawberry virus. Using the modified method, virus dsRNA was extracted from strawberry virus indicator plants and cultivated strawberry plants and detected using agarose gel electrophoresis with ethidium bromide staining and reverse transcription-polymerase chain reaction (RT-PCR). The quantity of virus dsRNA varied among strawberry cultivars. The quantity of dsRNA from in vitro plantlets was higher than that from the young leaves of field plants. For the field-grown plants, there was more dsRNA in the young leaves. Virus dsRNA extracted from strawberry plants was resistant to deoxyribonuclease I (DNase I), but evidently, it became resistant to ribonuclease A (RNase A) only in the presence of 0.5 M NaCl. Its bands in agarose gel could be readily recycled using an agarose gel DNA purification kit. With RT-PCR, the segments of both strawberry mottle virus and Strawberry mild yellow edge virus genomes were amplified by using the virus dsRNA recycled from gel or treated with DNase I/RNase A as templates. The system developed for dsRNA isolation and identification in strawberry plants laid a sound foundation for the work on genome analysis of strawberry virus isolates in China.

Fragaria chiloensis cryptic virus: A New Strawberry Virus Found in Fragaria chiloensis Plants from Chile.

Molecular characterization of Fragaria chiloensis latent virus (FClLV) (3) was based on shotgun cloning of double-stranded RNA (dsRNA) obtained from a Chilean Fragaria chiloensis plant. While the majority of the clones acquired belonged to FClLV, several had similarities with the RNA polymerases of viruses of the family Partitiviridae. A region of more than 1 kb of the putative virus (GenBank Accession No. DQ093961) was acquired by a combination of shotgun cloning and reverse transcription-polymerase chain reaction (RT-PCR) (3) and was compared against sequences found in GenBank. The Alphacryptovirus Beet cryptic virus 3 (Genbank Accession No. S63913) and the RNA-dependent RNA polymerase encoded using dsRNA isolated from Pyrus pyrifolia (Genbank Accession No. BAA34783) produced the most significant alignments with approximately 40% amino acid sequence identity and 60% amino acid similarity with the coding region of the sequenced portion of the virus. Detection primers F (5'AAGTCCGTGAGCACTGCCAT3') and R (5'TGAATACAAGTAACGGGAATTGA3') that amplify a 152-bp fragment of the putative virus were developed and used for RT-PCR detection of the virus as described (4) in 20 F. chiloensis plants obtained from the National Clonal Germplasm Repository (NCGR) in Corvallis, OR. These 20 plants as well as the plant used for the dsRNA isolation were a subset of F. chiloensis clones collected from Chile in 1990 and 1992 as germplasm for the Fragaria collection in the NCGR system (2). Seven of the plants were found to be infected with the virus as determined using RT-PCR and sequencing of the amplicons. There was no correlation between the presence of FClLV and the novel virus. To eliminate the possibility that the sequenced region was encoded by F. chiloensis genome, DNA was isolated (DNeasy; QIAGEN Inc., Valencia, CA) and used as a template in PCR, and no amplicons were obtained in these tests. The possibility that the putative virus belonged to the Endornavirus genus was also examined. DsRNA was extracted, and individual bands were gel purified and subjected to cloning as described (4) and RT-PCR amplification. Both methods indicated that the polymerase region was encoded by a dsRNA species of approximately 1.8 kb, which is similar in size to the genomic molecules of other cryptic viruses that encode the virus polymerase (1). This information indicated that the virus is a novel cryptic virus and the name Fragaria chiloensis cryptic virus is proposed.

Unstable infectivity and sedimentable ds-RNA associated with lettuce speckles mottle virus

Infectivity associated with extracts of lettuce speckles mottle virus (LSMV)-infected tissues is unstable and is susceptible to short periods of aging in vitro or low concentrations of RNase. Infected leaves extracted using phenol yielded greater infectivity than comparable tissue extracted with buffer. No typical virus particles were observed in infected tissues or clarified preparations, but 50- to 70-nm spherical membranous particles were observed associated with the tonoplast in vacuoles of infected cells. Polyacrylamide gel electrophoresis of nucleic acids from infected tissue and LSMV-clarified preparations revealed abundant double-stranded RNA (ds-RNA) in both preparations. A species of LSMV-specific single-stranded RNA (ss-RNA) was also present in LSMV bentonite-clarified preparations. Infectivity was associated only with the ss-RNA fraction. Quantitative isolation of ds-RNA from whole tissue and clarified preparations showed the majority of the ds-RNA was recovered from the bentonite-clarified fractions, and this RNA appeared to be associated with a relatively small structure of a low buoyant density. These data suggest that LSMV lacks a functional coat protein and the sedimentable dsRNA fraction from LSMV-infected tissues more likely contains a viral-specific replication site and not true virus particles.