Fragaria chiloensis cryptic virus: A New Strawberry Virus Found in Fragaria chiloensis Plants from Chile.

Abstract

Molecular characterization of Fragaria chiloensis latent virus (FClLV) (3) was based on shotgun cloning of double-stranded RNA (dsRNA) obtained from a Chilean Fragaria chiloensis plant. While the majority of the clones acquired belonged to FClLV, several had similarities with the RNA polymerases of viruses of the family Partitiviridae. A region of more than 1 kb of the putative virus (GenBank Accession No. DQ093961) was acquired by a combination of shotgun cloning and reverse transcription-polymerase chain reaction (RT-PCR) (3) and was compared against sequences found in GenBank. The Alphacryptovirus Beet cryptic virus 3 (Genbank Accession No. S63913) and the RNA-dependent RNA polymerase encoded using dsRNA isolated from Pyrus pyrifolia (Genbank Accession No. BAA34783) produced the most significant alignments with approximately 40% amino acid sequence identity and 60% amino acid similarity with the coding region of the sequenced portion of the virus. Detection primers F (5'AAGTCCGTGAGCACTGCCAT3') and R (5'TGAATACAAGTAACGGGAATTGA3') that amplify a 152-bp fragment of the putative virus were developed and used for RT-PCR detection of the virus as described (4) in 20 F. chiloensis plants obtained from the National Clonal Germplasm Repository (NCGR) in Corvallis, OR. These 20 plants as well as the plant used for the dsRNA isolation were a subset of F. chiloensis clones collected from Chile in 1990 and 1992 as germplasm for the Fragaria collection in the NCGR system (2). Seven of the plants were found to be infected with the virus as determined using RT-PCR and sequencing of the amplicons. There was no correlation between the presence of FClLV and the novel virus. To eliminate the possibility that the sequenced region was encoded by F. chiloensis genome, DNA was isolated (DNeasy; QIAGEN Inc., Valencia, CA) and used as a template in PCR, and no amplicons were obtained in these tests. The possibility that the putative virus belonged to the Endornavirus genus was also examined. DsRNA was extracted, and individual bands were gel purified and subjected to cloning as described (4) and RT-PCR amplification. Both methods indicated that the polymerase region was encoded by a dsRNA species of approximately 1.8 kb, which is similar in size to the genomic molecules of other cryptic viruses that encode the virus polymerase (1). This information indicated that the virus is a novel cryptic virus and the name Fragaria chiloensis cryptic virus is proposed.