Isolation Kit Research Articles

Mesenchymal Stem Cell Derived Exosomes as Nanodrug Carrier of Doxorubicin for Targeted Osteosarcoma Therapy via SDF1-CXCR4 Axis.

PurposeThe objective of this study was to investigate the antitumor activity, targeting capability, and mechanism of the developed nanodrug consisting of doxorubicin and exosome (Exo-Dox) derived from mesenchymal stem cells in vitro and in vivo.MethodsThe exosomes were isolated with Exosome Isolation Kit, and the Exo-Dox was prepared by mixing exosome with Dox-HCl, desalinizing with triethylamine and then dialyzing against PBS overnight. The exosome and Exo-Dox were examined by nanoparticle tracking analysis (NTA) and transmission electron microscopy (TEM). The antitumor activity, targeting capability, and mechanism of the developed Exo-Dox were evaluated by cell viability assay, histological and immunofluorescence analysis and in vivo imaging system.ResultsNTA results showed the size of the exosomes had increased from 141.6 nm to 178.1 nm after loading with doxorubicin. Compared with free Dox, the Exo-Dox exhibited higher cytotoxicity against osteosarcoma MG63 cells, HOS cells, and 143B cells than free Dox, the half-maximal inhibitory concentrations (IC50) of Dox, Exo-Dox were calculated to be 0.178 and 0.078 μg mL−1 in MG63 cells, 0.294 and 0.109μg mL−1 in HOS cells, 0.315 and 0.123 μg mL−1 in 143B cells, respectively. The in vivo imaging showed that MSC derived Exo could serve as a highly efficient delivery vehicle for targeted drug delivery. The immunohistochemistry and histology analysis indicated that compared with the free Dox group, the Ki67-positive cells and cardiotoxicity in Exo-Dox group were significantly decreased.ConclusionOur results suggested that MSC-derived Exo could be excellent nanocarriers used to deliver chemotherapeutic drug Dox specifically and efficiently in osteosarcoma, resulting in enhanced toxicity against osteosarcoma and less toxicity in heart tissue. We further demonstrated the targeting capability of Exo was due to the chemotaxis of MSC-derived exosomes to osteosarcoma cells via SDF1-CXCR4 axis.

First Report of Grapevine Red Globe Virus, Grapevine Rupestris Vein Feathering Virus, and Grapevine Syrah Virus-1 Infecting Grapevine in Slovenia.

To investigate the virome status of preclonal grapevine candidates, 82 dormant cuttings of six grape cultivars ('Laški rizling', 'Refošk', 'Rebula', 'Malvazija', 'Zeleni Sauvignon' and 'Pokalca') were taken in 2019 from vines in second cycle of clonal selection in Vipavska dolina (Primorska wine-growing region). All samples were pooled in twelve groups (1x 'Laški rizling', 1x 'Pokalca', 2x 'Rebula', 2x 'Zeleni Sauvignon', 3x 'Malvazija', and 3x 'Refošk') from which small RNAs were isolated using the mirVana miRNA Isolation Kit (Ambion, Life Technolgies), twelve cDNA libraries were constructed and sequenced on an Ion Proton Sequencer (Ion Torrent, Life Technologies, Waltham, MA, USA). The VirusDetect pipeline (Zheng et al. 2017) was used for bioinformatics analysis and 3.6 - 13.9 million reads per library were processed. According to the VirusDetect pipeline, grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) was detected in two libraries of cv. 'Refošk'. In one library, GRGV showed the highest coverage of 63.6% and nt identity of 92.71% with GRGV isolate Graciano-T101 (accession no. KX171166) from Spain, and was represented by 40 contigs with sequence depth of 53.0X. In the second library, GRGV showed the highest coverage of 45.8% and nt identity of 94.49% with GRGV isolate Graciano-T90 (accession no. KX109927) from Spain, and was represented by 36 contigs with sequence depth of 22.9X. Grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) was found in eleven libraries representing six different cultivars. In six libraries, GRVFV showed the highest coverage of 37%-85% and nt identity of 88.53%-94.05% with GRVFV isolate CHASS (accession no. KY513702) from Switzerland, and was represented by 34-90 contigs with sequence depth of 11.0X-93.3X. In the other four libraries, GRVFV showed the highest coverage of 27.5%-64.8% and nt identity of 92.36%-93.87% with GRVFV isolate Mauzac (accession no. KY513701) from France, and was represented by 30-94 contigs with sequence depth of 5.4X-20.7X, while in one library, GRVFV showed the highest coverage of 30.2% and nt identity of 95.30% with GRVFV isolate SK925 (accession no. MH544692) from Slovakia, and was represented by three contigs with sequence depth of 5.6X. Grapevine Syrah virus-1 (GSyV-1; genus Marafivirus, family Tymoviridae) was detected in two libraries of cvs 'Laški rizling' and 'Malvazija'. In the library of cv. 'Laški rizling', GSyV-1 showed the highest coverage of 44.9% and nt identity of 95.36% with GSyV-1 isolate SK351 (accession no. KP221269) from Slovakia, and was represented by three contigs with sequence depth of 20.9X. In the library of cv. 'Malvazija', GSyV-1 showed the highest coverage of 48.8% and nt identity of 92.06% with GSyV-1 isolate SK30 (accession no. KP221256) from Slovakia, and was represented by 25 contigs with sequence depth of 29.4X. Results obtained by HTS were confirmed in individual samples using reverse transcription-polymerase chain reaction (RT-PCR). GRGV was amplified using specific primer pair RG6061F: 5'-CCGAGCTTCTCTCCAAGATCA-3' and RG6801R: 5'-ACTTAACGTAGGCCACTGGGT-3' (Cretazzo and Velasco 2017). GRVFV was amplified using specific primer pair GRVFV_6090F: 5'-CATCGTTCTGATCCTCAGCC-3' and GRVFV_6605R: 5'-AGAGACGCTGACCATGCCAC-3' (Glasa et al. 2019). GSyV-1 was amplified using specific primer pair SY5922F: 5'-CCAATGGGTCGCACTTGTTG-3' and SY6295R: 5'- ACTTCATGGTGGTGCCGGTG -3' (Glasa et al. 2015). Three out of 13 samples of 'Refošk' tested for GRGV, 44 out of 78 samples tested for GRVFV (2 'Laški rizling', 12 'Refošk', 9 'Rebula', 7 'Malvazija', 8 'Zeleni Sauvignon' and 6 'Pokalca') and 3 out of 8 samples tested for GSyV-1 (1 'Laški rizling' and 2 'Malvazija') were positive. Further verification of the amplicons was performed by bidirectional Sanger sequencing and the generated sequences were submitted to GenBank: GRGV (MW446914-MW446916), GRVFV (MW446917-MW446938) and GSyV-1 (MW446939-MW446941). Phylogenetic analysis showed that Slovenian GRGV isolates clustered separately from other GRGV isolates retrieved from the NCBI. Phylogenetic analysis showed that some Slovenian GRVFV isolates clustered with those from France or Slovakia, while some of them clustered separately. Phylogenetic analysis showed that Slovenian GSyV-1 isolates clustered with GSyV-1 isolates from Hungary and Slovakia. To our knowledge, this is the first report of GRGV, GRVFV and GSyV-1 infecting grapevine in Slovenia. Further analysis will be necessary to assess the prevalence of these viruses in Slovenian vineyards and to evaluate their impact on grapevine production.

Investigation of CYP1B1*3 and CYP1B1*4 polymorphisms in a Turkish population

CYP1B1 is a P450 enzyme involved in activating pro-carcinogens to carcinogens as well as estrogen metabolism. In order to examine the effect of CYP1B1 on cancer metabolism, it should be compared with healthy individuals and whether the polymorphism between healthy individuals and sick individuals is significant. This study aims to screen the CYP1B1*3 and CYP1B1*4 polymorphisms of a group of individuals who have not been diagnosed with cancer to examine the genetic differences of metabolic enzymes in the Turkish population.This study is a cross-sectional type descriptive study.The study included 295 patients without a cancer diagnosis. The research sample includes patients who applied to Ankara University Medical Faculty Hospital and Afyonkarahisar Health Sciences University Research and Application Hospital. The individuals signed voluntary consent forms before participation, and 3 ml blood samples were taken from each. DNA samples were obtained using a DNA isolation kit, and then polymorphism was determined by real-time PCR. The distribution of CYP1B1*3 and CYP1B1*4 polymorphism in healthy individuals was determined. The frequency of CYP1B1*1/*1 (wild type), CYP1B1*1/*3 (heterozygous) and, CYP1B1*3/*3 (mutant) genotypes were found 39.33%, 50.67% and 10.0% respectively. The frequency of CYP1B1*1/*1 (wild type), CYP1B1*1/*4 (heterozygous) and, CYP1B1*4/*4 (mutant) genotypes were found 39.31%, 60.69% and 0% respectively. No individuals with mutant genotype were detected in this genotype (CYP1B1*4).The results show that the genotype frequencies of the CYP1B1*3 gene polymorphism in a Turkish population are similar to other Caucasian populations. However, it was determined that the Turkish population did not show similarity with other races in terms of CYP1B1*4 polymorphism.

First report of watermelon crinkle leaf-associated virus 1 naturally infecting watermelon (Citrullus lanatus) in Georgia, USA.

Watermelon (Citrullus lanatus) is one of the major vegetable crops grown in Georgia during the spring and summer seasons, contributing $180 million of farmgate value to the state's economy (Georgia Farm Gate Value Report 2019). During the summer of 2021, watermelon plants with foliar symptoms such as yellow mottling, chlorosis, and wrinkling with thickened, bunchy, and upward curling were observed on commercial fields of Georgia, USA. A disease incidence of 15-20% in ~56 ac in Tift county and 10-15% in ~60 ac in Wilcox county was observed. The symptoms observed were similar to those described for watermelon crinkle leaf-associated viruses (WCLaV-1 and WCLaV-2) from Florida (Hendrick et al., 2021) and Texas (Hernandez et al., 2021). Symptomatic leaves from Tift (n=40) and Wilcox (n=20) counties were collected, surface sterilized with 0.1% bleach and used for total nucleic acid extractions using MagMAX 96 Viral RNA isolation kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer's instruction without DNase treatment. The potential introduction of WCLaV-1 and WCLaV-2 into Georgia was tested by reverse-transcription-polymerase chain reaction (RT-PCR) assay using specific primers targeting RNA-dependent-RNA polymerase (RdRp) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). The expected amplicon sizes for RdRp (~900 nt) and MP (~500 nt) genes of WCLaV-1 located on RNA 1 and RNA 2 segements, respectively, were observed in 39 of 40 (97.5%) samples from Tift and seven of 20 (35%) samples from Wilcox. However, WCLaV-2 was not detected in any of the tested samples. All 60 samples also tested negative for the whitefly-transmitted viruses prevalent in the region, including cucurbit chlorotic yellows virus, cucurbit yellow stunting disorder virus, and cucurbit leaf crumple virus using virus-specific primers (Kavalappara et al., 2021). A subset of the samples analyzed by RT-PCR were also tested by SYBR green-based real-time RT-PCR assay targeting MP gene of WCLaV-1 using primers WCLaV-1FP (5'TCCACAAGCTTGATGGA- GGG3') and WCLaV-1RP (5'TCCCGAGTGAGGAAGCTAGT3'). The virus was detected in samples from both counties and the results matched with those obtained by the conventional RT-PCR assays (Suppl. Table 1). The presence of WCLaV-1 was further confirmed by sequencing (Genewiz, South Plainfield, NJ, USA) coupled with BLASTn analysis of amplicons resulted from the conventional RT-PCR from three randomly selected samples . The partial RdRp sequences (OL469153 to OL469155) were 99.3% and 99.9% identical to the corresponding sequences of WCLaV-1 isolates from China (KY781184) and Texas (MW559074) respectively. The partial MP sequences (OL469150 to OL469152) were 100% identical to those from China (KY781185) and Texas (MW559077). WCLaV-1 and WCLaV-2 were first discovered in Asia (Xin et al., 2017). Both viruses were subsequently reported from North and South Americas (Hendrick et al., 2021; Hernandez et al., 2021; Maeda et al., 2021), indicating their geographical expansion. Biological information, including vector relations, is unknown for both viruses and other members of the genus Coguvirus (family Phenuiviridae), to which they are provisionally assigned (Zhang et al., 2021). Further studies are also required to understand the biology and impact of both viruses on watermelon production and other crops, if any.

Comparative Evaluation of an Easy Laboratory Method for the Concentration of Oocysts and Commercial DNA Isolation Kits for the Molecular Detection of Cyclospora cayetanensis in Silt Loam Soil Samples.

Cyclospora cayetanensis is a protozoan parasite that causes foodborne outbreaks of diarrheal illness (cyclosporiasis) worldwide. Contact with soil may be an important mode of transmission for C. cayetanensis and could play a role in the contamination of foods. However, there is a scarcity of detection methods and studies for C. cayetanensis in soil. Traditional parasitology concentration methods can be useful for the detection of C. cayetanensis, as found for other protozoa parasites of similar size. The present study evaluated a concentration method using flotation in saturated sucrose solution, subsequent DNA template preparation and qPCR following the Bacteriological Analytical Manual (BAM) Chapter 19b method. The proposed flotation method was compared to three commercial DNA isolation kits (Fast DNATM 50 mL SPIN kit for soil (MP Biomedicals, Irvine, CA, USA), Quick-DNATM Fecal/Soil Microbe Midiprep kit (Zymo Research, Irvine, CA, USA) and DNeasy® PowerMax® Soil Kit (Qiagen, Hilden, Germany)) for the isolation and detection of DNA from experimentally seeded C. cayetanensis soil samples (5–10 g with 100 oocysts). Control unseeded samples were all negative in all methods. Significantly lower cycle threshold values (CT) were observed in the 100 oocyst C. cayetanensis samples processed via the flotation method than those processed with each of the commercial DNA isolation kits evaluated (p < 0.05), indicating higher recovery of the target DNA with flotation. All samples seeded with 100 oocysts (n = 5) were positive to the presence of the parasite by the flotation method, and no inhibition was observed in any of the processed samples. Linearity of detection of the flotation method was observed in samples seeded with different levels of oocysts, and the method was able to detect as few as 10 oocysts in 10 g of soil samples (limit of detection 1 oocyst/g). This comparative study showed that the concentration of oocysts in soil samples by flotation in high-density sucrose solutions is an easy, low-cost, and sensitive method that could be implemented for the detection of C. cayetanensis in environmental soil samples. The flotation method would be useful to identify environmental sources of C. cayetanensis contamination, persistence of the parasite in the soil and the role of soil in the transmission of C. cayetanensis.

Genome and Transcriptome Sequence Resources and Effector Repertoire of Pythium myriotylum Drechsler.

Genome and Transcriptome Sequence Resources and Effector Repertoire of Pythium myriotylum Drechsler.

Detection of Gluten in Gluten-Free Foods of Plant Origin.

The work deals with the issue of standardization and more accurate methodology for the isolation of gluten DNA in gluten-free products of plant origin, which is more demanding due to the more complex structure of plant cells. Three isolation methods were compared, of which the combination of glass and zirconium beads, Proteinase K and a commercially produced isolation kit was confirmed to be the most effective procedure. The given isolation procedure was more effective in one-component gluten-free foods, where the concentration of the obtained DNA ranged from 80.4 ± 0.7 to 99.0 ± 0.0 ng/µL. The subsequent PCR reaction revealed the presence of gluten not only in guaranteed gluten-free products (40%), but also in naturally gluten-free foods (50%). These were mainly gluten-free sponge cakes, gluten-free biscuits “Cranberries”, cocoa powder, coffee “3in1”, and instant coffee.

Optimised protocol for the extraction of fish DNA from freshwater sediments

Abstract Monitoring fish is necessary for understanding population dynamics, tracking distribution patterns and evaluating conservation efforts. Molecular techniques targeting environmental DNA (eDNA) are now considered effective methods for detecting specific species or characterising fish communities. The analysis of DNA from lake‐surface sediments (sedDNA) can provide a time‐integrated sampling approach which reduces the variability sometimes observed in water samples. However, studies of sedDNA have had varying success in detecting fish. The present study aimed to determine the most effective extraction method for recovering fish DNA from lake‐surface sediments. A literature review was undertaken to identify DNA extraction methods used previously on aquatic sediments targeting aquatic and terrestrial animals. Five methods with various modifications were tested to establish their ability to desorb extracellular DNA. Based on these results, two methods were selected and optimised, and the recovery of fish sedDNA characterised using droplet digital PCR assays targeting eel and perch (Anguilla australis, Anguilla dieffenbachii, Perca fluviatilis). A range of sediment masses (0.25–20 g) were assessed to establish the optimal amount required to accurately assess fish sedDNA. The DNA extraction methods found to be most effective at recovering extracellular DNA spiked into small sediment masses (0.25 g) were the DNeasy PowerSoil DNA Isolation Kit (QIAGEN), and the ABPS protocol which involved an initial alkaline buffer extraction followed by the PowerSoil extraction kit. For larger sediment masses (&gt;0.25 g) the ABPS protocol or the DNeasy PowerMax Soil Kit (QIAGEN) with an additional ethanol DNA concentration step (PMET protocol) yielded the highest concentrations of target genes across a range of lake sediments. Larger sediment masses (≤20 g was tested) increased the likelihood of detection of fish in sedDNA. Optimisation of the ABPS protocol was required (65°C incubation temperature, pooling of multiple PowerSoil extractions) to overcome technical challenges related to co‐precipitation of organic content in lake‐surface sediments. This optimised ABPS protocol was called the “Lakes ABPS protocol”. We recommend the use of the Lakes ABPS protocol as it is cheaper than the PMET protocol. Additionally, after the first extraction step, the process can be automated on a DNA extraction robot, allowing for higher sample throughput. A mass of 10 g is suggested, although higher detection is achieved with more sediment, a suite of challenges, such as co‐precipitation of organic content, are encountered when the amount is increased. This study highlights the complexity of the extraction and detection of fish sedDNA from lake sediment, especially when it has a high organic content. We have optimised a DNA extraction method to overcome some of these complexities that can be applied to a wide range of lake sediments.

Comparison between MACSprep™ forensic sperm microbead kit and Erase Sperm Isolation kit for the enrichment of sperm fractions recovered from sexual assault samples

Sexual assault samples often contain mixtures of cells coming from at least two donors. Ideally, one would need to separate the cells into two cellular fractions: one consisting of the alleged aggressor’s spermatozoa (the sperm fraction) and the other containing the victim’s epithelial cells (the non-sperm fraction). This separation increases the probability of obtaining the alleged offender’s autosomal DNA profile. However, spermatozoa are often collected along with an excess of biological material originating from the victim, and with unfavorable male:female biological material ratios, the absence of separation could result in the PCR amplification of the victim’s DNA profile only. Several approaches are available to enrich/purify the spermatozoa present on sexual assault samples. In this paper, we compare a new method, the MACSprep™ Forensic Sperm MicroBead Kit (MACSprep, based on microbeads conjugated with antibodies bound to spermatozoa and their retention within a magnetic column) with the Erase Sperm Isolation Kit (Erase, a standard differential lysis separation procedure combined with a specific removal of free DNA) routinely used in our lab. The performance of both kits was tested using sets of vaginal and buccal swabs loaded with different dilutions of sperm, or azoospermic semen, representing a total of 120 independent samples. For the samples containing undiluted sperm, an average recovery of 58% was observed for the MACSprep’s sperm fractions and 43% for Erase’s. Significantly better recovery of azoospermic semen was observed in MACSprep’s non-sperm fractions (~ 85%) compared to Erase (~ 28%). Erase performed significantly better than MACSprep in terms of recovery for diluted sperm samples (1:10 to 1:800 sperm dilutions) in the presence of vaginal cells, while the purities of the achieved sperm fractions were in favor of MACSprep for the highest sperm dilutions tested. Similar trends were observed with buccal swabs loaded with 1:200 sperm dilutions. Increased sperm dilutions on vaginal swabs resulted in higher variability in the male material recovered, whatever the separation method used. Both methods were easy to perform and resulted in male DNA extracts ready to use in less than 2 h. Both kits showed their specificities in terms of recovery efficiency and purity of the sperm fractions. Ideally, additional experiments should be performed in different laboratories, using workflow and chemistries different than ours, to better define the peculiarities observed with MACSprep for high dilutions. Improving the recovery of MACSprep for diluted samples, in addition to its better purity observed in the experiments performed, could make it a method of choice for laboratory workflow, despite MACSprep’s current price per sample being about twice the price of Erase’s.

Human papillomavirus DNA resides in surgical drain fluid exosomes from HPV+ oropharyngeal squamous cell carcinoma patients and can be spread to neighboring HPV-negative cells.

e18050 Background: Human papillomavirus (HPV) is the primary driver of oropharyngeal squamous cell carcinoma (OPC) in the US. Previous studies have investigated the role of plasma and saliva-based cell-free HPV DNA in OPC, yet the pathophysiological impact of exosomes in HPV+ OPC remains unknown. Exosomes are nanometer-sized membrane vesicles of endocytic origin carrying DNA, RNA and proteins, and have been shown to exist in blood, plasma, and in urine. We hypothesize that serosanguinous fluid drained from the postoperative bed, which we call “surgical drain fluid” (SDF) also contains exosomes. We further hypothesize that exosomes derived from SDF in HPV+ OPC patients contain HPV DNA that can be directly transmitted into HPV-negative cells. Methods: Twenty-six 5-mL SDF samples were collected following surgical neck dissections directly from the surgical drain; 21 from HPV+ and 5 from HPV- OPC patients. Exosomes were isolated from SDF using the Qiagen exoEasy kit. Exosome structure was characterized by transmission electron microscopy (TEM) and nanoparticle tracking analysis (NTA). Western blotting (WB) targeted known exosomal surface markers. Exosomes were pretreated with DNase (New England Biolabs) to cleave the surface DNA, then exosomal DNA was extracted using a cell-free DNA isolation kit (Sigma). TaqMan real-time PCR was employed to detect HPV16 copy numbers. Lastly, exosomes isolated from 3 HPV+ patients’ SDF and 1 HPV- patient’s SDF were incubated with HPV- cell lines, SCC22A and SCC25, in order to query exosome-mediated HPV transmission. Results: TEM identified exosomes as round/oval-shaped vesicles measuring between 70 and 150 nm. NTA enumerated an average of 1.5 x 1011 particles per mL of SDF. WB further confirmed exosomal identity with strong CD63, CD9, and TSG101 signal detected. Among SDF exosomes from HPV+ OPC, 81% (n = 17) had detectable HPV16 DNA by real-time PCR, while all HPV- SDF exosomes (n = 5) showed undetectable HPV16. Paired comparison of HPV16 levels within exosomes to total HPV16 in SDF revealed an average of 90% of HPV16 in SDF was contained within exosomes. In an in vitro assay, SCC22A and SCC25 cells treated with HPV16 + exosomes became real-time PCR-positive for HPV16, while cells treated with HPV16- exosomes remained HPV16 negative. Conclusions: This study demonstrates that SDF, a novel post-surgical biofluid analyte, is enriched for HPV-containing exosomes in HPV+ OPC patients. We also found that exosomes from HPV+ OPC patients can transmit HPV to HPV-negative cells, suggesting a novel mode of virus-mediated spread of disease.

Interleukins of the IL-2 family have different activity against natural killer cells when used in combination with IL-18.

e14511 Background: The main effort to improve adoptive cancer immunotherapy is aimed at overcoming the limitations associated with low MHC expression on tumor cells. Reinfusion of patient's ex vivo activated NK cells, which eliminate tumor cells, regardless of the MHC molecules presence on their surface, is among promising approaches. Natural killers fate is regulated by a whole set of cytokines, of which IL-18 and interleukins of the IL-2 family (IL-2, IL-15, IL-7, IL-21) are of particular importance. Despite the common structure of their receptor, interleukins of the IL-2 family may exert different influence on NK phenotype when combined with IL-18. The aim of the study was to investigate the effect of IL-18 combinations with interleukins of IL-2 family on activation markers expression on breast cancer patients’ peripheral blood NK cells. Methods: Peripheral blood NK cells were enriched by magnetic cell sorting from PBMC using the NK Cell Isolation Kit (#130-092-657, Miltenyi Biotec, Germany). Next, the sorted NK were incubated at 106 cells/ml in RPMI 1640 medium (Gibco, USA) with addition of cytokines at a concentration of 10 ng/ml in 5 variants: 1) IL-18; 2) IL-18 + IL-2; 3) IL-18 + IL-7; 4) IL-18 + IL-15; 5) IL-18 + IL-21. Cells were further incubated at 5.0% CO2 and 370C. After 48 hours of incubation, the expression of CD16, CD56 and CD25 markers on NK was assessed by flow cytometry. Results: A decrease in CD16++CD56+ subpopulation percentage up to 52.5% and 54.9% compared to 62.2% in the control was observed after incubation with IL-18 alone and when it was combined with IL-2, respectively. At the same time, the addition of IL-15 and IL-21 caused a further decrease to 38.7% and 39.1%, respectively. Nevertheless the combination of IL-18 and IL-7 led to an increase in CD16++CD56+ subpopulation percentage up to 71.8%. The percentage of CD25-positive NK cells on the whole followed the dynamics of CD16++CD56+ subpopulation with the IL-18 +IL-15 combination causing the maximum decrease (up to 7.6%). The proportion of NK cells with the CD16+CD56++ phenotype, on the contrary, increased after incubation with IL-18 alone and its combination with IL-2 from 34.5% in control to 46.9% and 44.3%, respectively. Interleukin 18 combinations with IL-15 and IL-21 exhibited even more prominent effect causing increase in CD16+CD56++ proportion to 59.6% and 60.4%, respectively. At the same time, incubation with IL-18+IL-7 caused only a slight decrease in the percentage of the CD16++CD56+ NK subpopulation (up to 27.5%). Conclusions: Thus, IL-18 stimulated the generation of the cytokine-producing NK fraction while suppressing the cytolytic fraction. Also the antagonistic effect of IL-7 with IL-18 and the synergistic effect of IL-15 and IL-21 with IL-18 were revealed on NK cells in vitro.

Comparison of potential biomarker, ACTN3 rs1815739 polymorphism, for athletic performance of Turkish athletes.

α-Actinin-3 is one of the key components of the Z-line structure of sarcomeres and also have importance in muscle cell signaling processes. Therefore, α-Actinin-3 gene rs1815739 polymorphism is one of the most analysed potential genetic biomarkers in sports genetic studies. We aimed to evaluate the genotypic and allelic distribution of α-Actinin-3 gene rs1815739 polymorphism in Turkish athletes. For this purpose, a total of 131 athletes (39 cyclists, 34 sprinters and distance athletes, 33 volleyball players, 15 bodybuilders and 10 ironmen) and 89 sedentary individuals were enrolled in the study. Genomic DNA from venous blood were isolated by using the PureLink DNA isolation kit by following the manufacturers' instructions. The α-Actinin-3 rs1815739 genotyping was carried out by Real-time PCR using the commercially provided Taqman Genotyping Assay. The statistical evaluations were assessed by the chi-square testing using the GraphPad InStat statistical package. Results showed that cyclists, ironmen and volleyball players showed statistically significant differences in terms of the genotype when compared to the controls. The OR of having the dominant trait (RR genotype vs. RX+XX combined) was 0.5 (95%CI: 0.28-0.91; P= 0.02) which was statistically significant, while the OR of having the recessive trait (XX genotype vs. RR+RX combined) was 3.76 (95%CI: 1.82-7.39; P=0.0002). Our findings indicated that the α-Actinin-3 gene rs1815739 RR genotype was more prevalent in the sprinters and distance athletes. In the bodybuilders, cyclists, and ironmen it was found that they were harboring the RR and RX genotype equally. According to the results, we suggest the α-Actinin-3 rs1815739 as a potential biomarker for personal training programs.

Examining the expression levels of ferroptosis-related genes in angiographically determined coronary artery disease patients.

Cardiovascular diseases are the leading cause of death worldwide, with several conditions being affected by oxidative stress. Ferroptosis, recently identified programmed cell death mechanism, is relies on oxidative stress. This study aimed to determine the expressions of the genes involved in the molecular pathways of oxidative stress and ferroptosis and the association of these genes with CAD risk factors in CAD and non-CAD individuals. The blood samples of individuals who underwent coronary angiography were collected and divided according to CAD status. Total RNA isolation was performed using the PAXgene RNA isolation kit from the whole blood samples. The mRNA expression levels of RTN3, GPX4, CAT, HMOX1, ELOVL5, SLC25A1, SLC7A11, and ACSL4 genes were determined using Real-Time PCR. Biochemical analyses were done before coronary angiography, and the results were evaluated statistically. The expression levels of the CAT gene are significantly lower in the CAD group when compared to non-CAD. HMOX1 expression levels are positively correlated with stenosis percentage, Gensini, and SYNTAX scores in the CAD group. RTN3, SLC25A1, and GPX4 mRNA expressions are correlated with HDL-C levels. Moreover, HbA1c levels and BMI, correlate negatively with ACSL4 expression in non-CAD controls. Also, ELOVL5 expression is negatively correlated with total bilirubin and direct bilirubin levels in the CAD group. In this study, the genes related to oxidative stress and ferroptosis were found associated with biochemical parameters associated with CAD risk. These preliminary results may provide a new perspective to further studies investigating the reasons behind the identified associations.

EFFICIENCY OF THREE SYSTEMS OF NUCLEIC ACID EXTRACTION FOR THE DIAGNOSIS OF PRDC-COMPLEX PATHOGENS

The article presents data on the qualitative and quantitative assessment of DNA/RNA obtained using three different isolation kits. Comparative results of PCR with primers for three bacterial and two viral infections are presented. A comparative assessment was carried out.

Comprehensive Evaluation and Application of a Novel Method to Isolate Cell-Free DNA Derived From Bile of Biliary Tract Cancer Patients.

Cell-free DNA (cfDNA) exists in various types of bodily fluids, including plasma, urine, bile, and others. Bile cfDNA could serve as a promising liquid biopsy for biliary tract cancer (BTC) patients, as bile directly contacts tumors in the biliary tract system. However, there is no commercial kit or widely acknowledged method for bile cfDNA extraction. In this study, we established a silica-membrane-based method, namely 3D-BCF, for bile cfDNA isolation, exhibiting effective recovery of DNA fragments in the spike-in assay. We then compared the 3D-BCF method with four other commercial kits: the BIOG cfDNA Easy Kit (BIOG), QIAamp DNA Mini Kit (Qiagen), MagMAXTM Cell-Free DNA Isolation Kit (Thermo Fisher), and NORGEN Urine Cell-Free Circulating DNA Purification Mini Kit (Norgen Biotek). The proposed 3D-BCF method exhibited the highest cfDNA isolation efficiency (p < 0.0001) from patient bile samples, and bile cfDNA of short, medium or long fragments could all be extracted effectively. To test whether the extracted bile cfDNA from patients carries tumor-related genomic information, we performed next-generation sequencing on the cfDNA and verified the gene-mutation results by polymerase chain reaction (PCR)-Sanger chromatograms and copy-number-variation (CNV) detection by fluorescence in situ hybridization (FISH) of tumor tissues. The 3D-BCF method could efficiently extract cfDNA from bile samples, providing technical support for bile cfDNA as a promising liquid biopsy for BTC patient diagnosis and prognosis.

PD31-04 LOWER URINARY TRACT MICROBIOTA DYSBIOSIS IS ASSOCIATED WITH URETHRAL FIBROSIS

You have accessJournal of UrologyCME1 May 2022PD31-04 LOWER URINARY TRACT MICROBIOTA DYSBIOSIS IS ASSOCIATED WITH URETHRAL FIBROSIS Michael Witthaus, Valmik Bhargava, Jill Buckley, and Mahadevan Rajasekaran Michael WitthausMichael Witthaus More articles by this author , Valmik BhargavaValmik Bhargava More articles by this author , Jill BuckleyJill Buckley More articles by this author , and Mahadevan RajasekaranMahadevan Rajasekaran More articles by this author View All Author Informationhttps://doi.org/10.1097/JU.0000000000002582.04AboutPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookLinked InTwitterEmail Abstract INTRODUCTION AND OBJECTIVE: Cellular mechanisms of stricture progression after repeated transurethral interventions (TUI) are unclear. We hypothesize urethral injury and mechanical stretch can cause tears on the urethral epithelial cell lining leading to leaking epithelium and urine extravasation (Fig A). Urinary microbiota traverses the epithelial lining and fibrogenesis can be mediated by inflammation due to microbial metabolites. Our objective is to characterize the urinary microbiome of patients with urethral stricture disease (USD) using 16S rRNA taxonomic profiling to elucidate the clinical relevance of the urinary microbiome in USD progression. METHODS: First catch urine samples from USD patients and healthy volunteers were collected and frozen to −80°C. Prior to analysis, samples were thawed at 2-8°C and centrifuged at 4°C for 15 mins to form a pellet. The pellet was then used for bacterial genomic DNA extraction using the PowerMag Soil DNA Isolation Kit. PCR amplification of the V3 and V4 regions of the 16S rRNA gene was performed. Illumina sequencing adapters and unique dual-index barcodes were added by PCR. Samples were then pooled and sequenced with paired-end 150 base pair reads (PE150) on an Illumina MiSeq Instrument. Data was analyzed using Qiime, which was used to determine alpha and beta diversity metrics per sample and to determine which microbes were presented differentially between the two cohorts. RESULTS: Our results are summarized in Fig B-D. Visualizing the specific microbes using a relative abundance bar plot (Fig B), the microbiome of healthy urine was more diverse than patients with USD. A divergence between the two groups supported distinct microbiomes, and a significant difference between patients with USD and controls was observed with beta diversity analysis (Fig C, D). The findings were indicative of the overall composition of microbial communities in each patient population. CONCLUSIONS: Our findings suggest a potential role for urinary microbiota alterations in developing an inflammatory environment and consequent fibrosis progression in USD. Future studies will determine specific urinary microbes between the two cohorts and their relevance to USD. Further potential for targeting specific microbes using next-generation probiotics to correct the urinary microbiota dysbiosis may be beneficial in preventing stricture progression. Source of Funding: UCSD Academic Senate © 2022 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetails Volume 207Issue Supplement 5May 2022Page: e542 Advertisement Copyright & Permissions© 2022 by American Urological Association Education and Research, Inc.MetricsAuthor Information Michael Witthaus More articles by this author Valmik Bhargava More articles by this author Jill Buckley More articles by this author Mahadevan Rajasekaran More articles by this author Expand All Advertisement PDF DownloadLoading ...

Quantitative Expression of Drug, Phospholipid and Nucleoside Transporters in the Lung Tissues across Species

ObjectiveIt has been proven that transporters play a pivotal role in organ distribution of drugs, and subsequently in drug efficacy and toxicity. Active transport processes may affect the local pulmonary disposition of drugs administered directly to the lung by the inhaled route as well as the uptake of drugs to the lung from the systemic circulation. While drug transporter expressions and their roles in drug disposition and elimination in the major elimination organs including intestine, liver and kidney are well‐characterized, the expression of drug transporters and the comparison across species in the lung remain overall poorly understood. For example, azithromycin levels in pulmonary tissue remained to be high for up to 5 days after a single oral dose, in contrast to much lower plasma levels. However, the mechanisms associated with azithromycin lung loading and efficacy remain unknown. The aim of this study was to comprehensively determine the mRNA and protein expression levels of drug transporters in the lung in human and preclinical species using quantitative targeted proteomics approaches. The findings can be useful to further explore potential mechanisms in lung specific disposition.MethodsTotal cellular mRNA was isolated from human lower lung tissues using a Qiagen mRNA isolation kit. qRT‐PCR was performed, and β‐actin mRNA expression was used to normalize target gene expression. The mRNA levels were expressed as a fold change using the 2‐ΔΔCt method. The total membrane proteins of lung tissues from human, monkey, dog and rat were extracted by Native Membrane Protein Extraction Kit, and subsequently digested by trypsin followed by the treatment of DTT and iodoacetamide (IAA). The levels of transporter proteins were quantified using a Sciex 7500 triple‐quadruple mass spectrometer coupled to a Shimadzu LC (SLC‐30A) system with optimized ionization conditions. The Na K‐ATPase level in the lung was measured as the membrane protein marker.Results and conclusionIn the current investigation, thirteen ABC efflux transporters and twenty‐three solute carriers (SLC) were characterized. Among those, mRNAs of eleven ABC transporters and fifteen SLC transporters were detected by the RT‐PCR method. In addition, eight ABC transporter and eleven SLC transporter proteins were quantified using the targeted proteomics LC‐MS/MS method. The mRNA expression pattern agrees with the protein expression; however, no quantitative correlation can be drawn between mRNA and protein expression. While OATP2B1 was only detected in human lung tissues, OATP2A1 and 3A1 are expressed in the lungs of human, monkey dog and rat. The expressions of three equilibrative nucleoside transporters (ENT1/2/3) in human lung tissues were higher than those in monkey. The expression of ABCA1, ABCA3 and ABCG1, the ABC transporters that are the regulators of cellular cholesterol and phospholipid homeostasis, were detected in all tested species, and found to be high in rat. Collectively, the comparison of transporter expression profiles can contribute to a better understanding of drug distribution and transport in the lung and aid pulmonary drug discovery and development.

Dietary Impacts on Changes in Diversity and Abundance of the Murine Microbiome During Progression and Treatment of Cancer

The microbiome has been recognized as being highly impactful for cancer outcomes, both with respect to the diversity and composition of the microbial population, as well as overall abundance. Presence or absence of certain microbial species has been correlated to improved cancer outcomes, in concert with specific treatments. However, little research has been performed to consider the reciprocal of this relationship: how different treatments, or the progression of disease, impact the microbiome. Further, though correlations have been demonstrated between dietary intake of both fats and carbohydrates and the composition and breadth of the microbiome, no studies have investigated the microbiome population as it is impacted by cancer and therapeutic treatments under different dietary regiments.This study aims to investigate how dietary patterns, in concert with progression of cancer and both surgical and therapeutic interventions, impact the diversity and abundance of the murine microbiome.A total of 116 c57BI/6 female mice (7‐8 weeks old) were randomized into four groups (n=29/group, each) one week post ovariectomy. Mice received a specific, semi‐purified diet consisting of A) low sucrose, high omega 3 fatty acid; B) low sucrose, low omega 3 fatty acid; C) high sucrose, high omega 3 fatty acid; or D) high sucrose, high omega 3 fatty acid. For high omega 3 fatty acid groups, 2% of daily calories were supplied to the mice as EPA and DHA in a 1.5:1 ratio. One week after implementation of diets all mice were inoculated with E0771 breast cancer cells. Twelve days following inoculation all mice were subject to lumpectomy. Eight days following, measurement procedures were repeated, as at baseline. Ten days following lumpectomy, half of the mice from each dietary cohort were treated with saline, while the other half were treated with a chemotherapeutic agent (9 mg/kg body weight doxorubicin and 90 mg/kg body weight cyclophosphamide). Six days later, the experiment ended, and mice were sacrificed following IACUC guidelines. Fecal samples, which had been collected at each time point noted above, were processed using QIAmp® PowerFecal® DNA isolation kit and were sent to MCIC (OSU Wooster Campus) for 16S ribosomal genetic profiling. A genomic library was generated, using previously validated primers for the V4 region. FASTQ files were filtered, trimmed, dereplicated, and denoised. Cleaned FASTQ files were then used to infer ASVs.Over the progression of cancer, there has been a consistent decrease in the alpha diversity of the microbiome. The effect of diet was mitigated by introduction of chemotherapeutic agents, though the significance of this effect is yet to be determined. While the analysis is still ongoing, it has been determined that there is a clear dietary effect which interacts with abundance. Multiple ASVs have been shown to be positively associated with high fat consumption, though inverse effects, as well as timepoint and treatment effects, have also been noted. Akkermansia muciniphila was a highly present bacterial species in all treatments, despite it usually being noted only as a minor resident of the gut.

MRNA Expression of Genes Involves In Intrinsic Apoptotic Pathway During HIV Infection and Therapy and Its Relation In Circulating cd4 T-Lymphocytes

Background: CD4 T-lymphocyte apoptosis in Human Immunodeficiency Virus infection may occur due to activation of the intrinsic apoptotic pathway or triggered via death receptors. In this study, the differential expression of the genes involved in the intrinsic apoptotic pathway was investigated on circulating CD4 T-lymphocytes of HIV-infected patients and healthy controls. Methods: The study included 55 HIV patients who were (1) asymptomatic antiretroviral therapy naive, (2) symptomatic antiretroviral therapy naive, and (3) on antiretroviral therapy. As control 20 healthy persons were included. CD4 T-lymphocytes were isolated from blood samples of HIV patients and healthy controls using density gradient centrifugation method and by negative selection from peripheral blood mononuclear cells (using CD4+ T Cell Isolation Kit followed by total RNA extraction and cDNA synthesis. Genes involved in the intrinsic apoptotic pathway of CD4+ T-lymphocyte including BAX, BAK, BIM, MCL-1 and BCL-2, Caspase-3, Caspase-9 and Calpain-1 were selected and analyzed by real-time PCR to detect their expression. The fold changes of gene expression of PLHIV groups were compared with that of healthy controls. Results: Among the genes under study, no significant upregulation in the expression of BAX, BAK, Caspase-3, Calpain-1 and no significant downregulation in BIM, MCL-1 expression was observed with the exception of upregulation of BCL-2 and downregulation of Caspase-9 expression which were statistically significant (p &lt;0.05). None of the studied genes showed any significant correlations between the gene expressions and CD4 T-lymphocyte count. Conclusion: Gene expression of intrinsic apoptotic pathway may not have significant effect on peripheral CD4 T-lymphocytes count in HIV infection and treatment. Bangladesh J Medicine 2022; 33: 176-185

Natural Antioxidants as a Tool to Protect the Organs from Tumors Induced Ehrlich Ascites in Mice

The objective of this study was to estimate if pre-treatment with pomegranate or beetroot juice and their combination for EAC which induces tumor in mice has the antitumor effect. Therefore, antioxidant activity DPPH scavenging was determined. The organs liver, spleen, and kidney were weighted to body weight in mice injected with EAC and treated by cisplatin, pomegranate, beetroot, and both of each pomegranate and beetroot and compared with the mice normal group. Single-cell suspension from the spleen was determined and RNA was extracted from the liver using a total RNA isolation kit and mRNA gene expression in EAC Cells was quantitative Real-Time PCR (RT-qPCR) analysis. The results showed that the pomegranate and beetroot contained high amounts of phenolic acid and flavonoid compounds and the highest antioxidant activity, which gave the highest DPPH scavenging activity. Moreover, the changes in the organ weight of vital organs were determined and compared with the control group. Because homologous recombination appears a new objective for cancer treatment by pomegranate and beetroot juice as an alternative to anticancer drugs. Therefore, pomegranate and beetroot juice have antitumor and antiproliferative influences on the Ehrlich tumor. Therefore, the pomegranate or beetroot and their combination were homologous recombinations that sensitize cells to growth inhibition and apoptosis. Keywords: Pomegranate, Beetroot juice, Ehrlich Ascites, Cisplatin, Cancer